Prokaryot proteinproduktion II

Transkript

1 Modifiering av genexpression Genetiska strategier Prokaryot proteinproduktion II 5/ Medel: promotorer terminatorer RBSstyrka antal genkopior genfusioner gensekvens (codon usage) etc Att ta hänsyn till: transkription translation lokalisering proteinstabilitet metabola förhållanden reningsprocess etc Promoter strength affect the protein expression level Promoter (Escherichia coli) Start of RNA synthesis Start of coding sequence CCGGTTGACAGATAGTCGTGTATGCGATATAATCAGCCCGTAGTCGGAGGGTCCTGACATG GGCCAACTGTCTATCAGCACATACGCTATATTAGTCGGGCATCAGCCTCCCAGGACTGTAC "Pribnow box" P Gene for protein 5 Produced molecule Translation Figure 63 Molecular Biology of the Cell ( Garland Science 2008) Vanligt använda promotorer Promotor Induktionsmedel a Styrka lac IPTG rel. svag tac 35 trp 10 lac IPTG rel. stark trc IPTG rel. stark trp Trpsvält/βIAA T7 IPTG mkt stark P L (λ) Värme mkt stark lac(ts) Värme P SPA Konstitutiv svag P BAD Larabinos rel. stark Test av promotorstyrka His 6 ABPGFP T7 Trc LacUV5 SPA Negative control Ett urval av promotorer använda för hög proteinexpression i E. coli a mest använda metod för inducering. Förkortningar: SPA, Staphylococcus aureus protein A; IPTG, isopropylβdthiogalactopyranoside; βiaa, βindolakrylsyra. Fluorescence intensity Red = T7 Green = Trc Blue = LacUV5 Yellow = SPA H. Tegel, unpublished 1

2 Reglering av laktosoperonet (E. coli) Trpoperonet Promotor Lac I Cykliskt Promotor= Catabolite AMP Landningsplats för Activator (camp) RNApolymeras Protein (CAP) RNApol. CAP Lac I start Lac Z Lac Y Lac A DNA repressor Trp Lacrepressor (Lac I) Laktos eller IPTG (syntetisk analog) S.D. 5 Lac I 3 camp/capbindningsställe Operatorsekvens S.D. S.D. S.D. Lac Z Lac Y Lac A 5 3 βgalaktosidas: Spjälkar laktos till galaktos och glukos Laktospermeas: Reglerar införsel av laktos Thiogalaktosidacetylas: Bryter ned ej klyvbara laktosanaloger Frånvaro av laktos: Lacrepressorn binder till operatorsekvensen Transkriptionen blockeras; inget βgalaktosidasenzym (eller något av de andra enzymerna) produceras Närvaro av laktos (eller IPTG): Lacrepressorn kan inte binda till operatorsekvensen Transkriptionsker; βgalaktosidasenzym (och alla de andra enzymerna) produceras Närvaro av laktos (eller IPTG) samt låga halter av glukos: Halten av camp stiger campcapkomplex bildas som kan binda uppströms om promotorn campcapkomplex främjar transkriptionen (vägleder RNApolymeraset) Mer βgalaktosidasenzym produceras trpl operator promotor Tryptofansvält repressor trpl trpe trpd trpc trpb trpa trpe trpd trpc trpb trpa T7systemet och P L pet protein expression system T7systemet Lacpromotor Lacoperatopolymeras T7 RNAgen T7promotor gen T7 RNApolymeras P L promotorn repressorprotein från bakteriofag λ Odling 2830 C aktiv repressor Inducering 42 C inaktiv repressor ger genexpression FIGURE 10.4 P BAD promoter Replicons (ori) carried by plasmid vectors Plasmid Replicon Copy nr. References pbr322 pmb Bolivar et al. (1977) puc pmb1 deriv Viera & Messing (1982, 1987) pmob45 pkn Bittner & Vapnek (1981) pacyc p15a 1822 Chang & Cohen (1978) psc101 psc101 ~ 5 Stoker et al. (1982) cole1 cole Kahn et al. (1979) Incompatability groups: cole1, pmb1 IncFII, pt181 P1, F, R6K, psc101, p15a FIGURE

3 Plasmider en börda för cellen Expression optimization:transcriptional level Plasmider spottas ut Strategi: plasmidkodat protein som behövs för överlevnad i cellkulturen Kräver tillsats av antibiotika eller nödvändig metabolit (dyrt och i många fall oönskat) Risk med plasmider för överförande av genetiskt material Promoter strength: degree of consensus sequence Sigma factor availability: growth condition dependent Positive/negative regulation Enhancer/silencer regions Lösning: DNAintegration i värdkromosom Expression optimization: translational level Heterologous protein expression in E. coli RBSsekvensberoende UAAGGAGG AUUCCUCC 16SRNA Avstånd RBSATG Sekundärstruktur hos t Codon usage Common problems protein aggregation protein misfolding inactive protein low yield Solutions decreased synthesis rate (weaker promoter, reduce conc. of inducer, low temperature) coexpression of folding modulators fusion tags protein engineering of target host engineering Expression of a eukaryotic gene in bacteria Codon usage: E. coli FIGURE

4 Codon usage: H. sapiens Codon usage affect the translation rate FIGURE 10.3 Problems caused by rare codons Solutions to problems caused by rare codons reduced translational rate low expression levels amino acid misincorporations truncated or amino aciddeleted proteins frameshifted proteins exchange the rare codon/s for a more frequently used codon introduce extra copies of the limiting trna genes Chaperoneassisted protein folding (cytoplasm) Role of DnaK and GroE chaperone machines in nascent protein folding Baneyx F et al, Nature Biotechnology (2004), 22: Georgopoulos, C. Genetics 2006;174: Copyright 2007 by the Genetics Society of America 4

5 Cytoplasmic chaperones Effect of coexpression of GroEL/ES Family Hsp100 Name Clp Cofactors Function Disaggregase Substrate specificity Regions rich in aromatic and bacic aa ATP requirement + P HSD1 EGFP Hsp90 HtpG Folding/secretory chap.? + Hsp70 Hsp60 Hp33 DJ1 superfam. DnaK GroEL Hsp33 Hsp31 DnaJ, GrpE GroES Folding chaperone Folding chap. Holding chap. Holding chap. Segm. of four to five hydrophobic aa, enriched in leucine and flanked by basic residues α/β folds enriched in hudrophobic and basic residues + + time: 4 h DH5alpha/11bHSD1eGFP DH5alpha/11bHSD1eGFP/GroELES Small Hsps IbpA, IbpB Holding chap. PPIase TF Hold. chap., PPIase Eight aa motif enriched in aromatic and basic residues SecB SecB Secretory chap. Nine aa motif enriched in aromatic and basic residues Periplasmic chaperones Export and periplasmic folding pathways Classification Generic chaperones Specialized chap. PPIases Proteins involved in disulfide bond formation Protein Skp (OmpH) FkpA SurA LolA PapD FimC SurA PpiD FkpA PpiA DsbA DsbB DsbC DsbG DsbD DsbE (CcmG) CcmH Substrates Outer membr. proteins and misfolded periplasmic proteins Broad substrate range Outer membrane proteins Outer membrane lipoproteins Proteins involved in P Pili biosynthesis Proteins involved in type 1 pili biosynthesis Outer membrane betabarrel proteins Outer membrane betabarrel proteins Broad substrate range Reduces cellenvelope proteins Reduces DsbA Proteins with nonnative disulfides Proteins with nonnative disulfides Oxidised DsbC, DsbG and CcmG Cytochrome c biogenesis Cytochrome c biogenesis Baneyx F et al, Nature Biotechnology (2004), 22: E. coli: periplasm E. coli: periplasm Folding in the bacterial periplasm: protein disulphideisomerases DsbA, a generic dithiol oxidase in the periplasm of E. coli Folding in the bacterial periplasm: protein disulphideisomerases DsbC catalyzes disulphide bond exchange reactions 5

6 E. coli: periplasm Known components of the thioredoxin system and glutaredoxin system. Folding in the bacterial periplasma: peptidylprolyl cis/transisomerases polypeptide bonds are synthesized in trans configuration 5% cis peptidylprolyl bonds in native proteins E a = 20 kcal/mol for peptidylprolylisomerisation Ratedetermining step of protein folding Prinz W A et al. J. Biol. Chem. 1997;272: by American Society for Biochemistry and Molecular Biology trxb/gor mutants allow disulfide formation in the cytoplasm Urokinase becomes active in the cytoplasm of WP759 and WP778 Prinz W A et al. J. Biol. Chem. 1997;272: Prinz W A et al. J. Biol. Chem. 1997;272: by American Society for Biochemistry and Molecular Biology 1997 by American Society for Biochemistry and Molecular Biology Low temperature adaptation Metabol belastning Plasmider med högt kopieantal Syrebegränsning Överproduktion av främmande proteiner tär på lagret av trna Exportmaskineriet blockeras. Export av värdcellens egna proteiner hindras Förändrade metabola egenskaper i vissa stammar försämrar Främmande proteiner kan störa cellen. Ev. toxiska egenskaper hos målproteinet Ferrer M et al, Nature Biotechnology (2003) 21:

7 Syrebegränsning Långsammare tillväxt och ändrad metabolism vid syrebegränsning Stressrespons aktiveras. Proteaser tillverkas Åtgärder: Proteasnegativa stammar ger minskad nedbrytning, men felaktiga proteiner kan ej brytas ner Uttryck av bakteriellt hemoglobin för intracellulär O 2 bindning Vad händer med cellen? Celltillväxt minskar Form och storlek förändras Stressrespons. Proteaser tillverkas Minskad tillförlitlighet i DNAproof reading Fel aminosyra sätts in om något trna eller någon aminosyra är begränsad Minskning av metabol belastning Fluorescence activated cell sorter (FACS) Använda andra kodon Promotorer som är reglerbara och inte läcker Minskad produktionsnivå kan i många fall ge högre celltäthet Figure 82 Molecular Biology of the Cell ( Garland Science 2008) OVERALL GOAL DRIVING HYPOTHESIS TO SOLVE EXPRESSION PROBLEMS FOR "DIFFICULT PROTEINS" ATG Construct plasmid library (different 5 ends) Express all variants in E. coli Isolate "successfull" variants by FACS P SD Insert gene for target protein TIR ATG Library X 5 S.D. Nucleotidelevel effects: Proteinlevel effects: Codon effects on translation (initiationrate) secondary structure stability Providing alternative start of translation Effects on product pi, solubility Foldingeffects Effects on proteolytic resistance Promoting/hindering interactions with host factors 7

8 s s BACKGROUND CBioPT Library constructions Plac Lib1 Codon library trpl Z EGFP Lib2 Freely randomized library L I B #1 L I B #2 Met Lys Ala Ile Phe Val Leu Lys ATG AAA GCA ATT TTC GTA CTG AAA CAA... T G T C T T T G C A C C Met/ G G A Leu Lys Ala Ile Phe Val Leu Lys ATG AAA GCA ATT TTC GTA TTG AAA CAA... T G T C T T A G C A C G G Met Xaa Xaa Xaa Xaa Xaa Xaa Xaa ATG NNG NNG NNG NNG NNG NNG NNG CAA... T T T T T T T T Theoretical diversity genetic variants 1 peptide variant Present library= 8.9 x 10 7 members Theoretical diversity 6.8 x genetic variants 2.5 x 109 peptide variants Present library= 1.7 x 10 8 members AUG GUG UUG most common > 10% DNAcorner Library vector analyses FACS analysis Library analysis 30/37ºC IPTG 1820h PBS wash FACS TIRLib1 TIRLib2 80 Low Med High 80 Low Med High Count 40 Count FL1H FL1H Sorted subpopulations remains stable after recultivation Library sorting Sorted clones Shake flask cultures, 37ºC Library IPTG 1820h 1h sorting 5000 cells/s 1.8x10 7 cells Library 1 Library 2 ZEGFP ZEGFP trplzegfp trplzegfp Mean: TIRLIB1c3 Mean: TIRLIB2c7 1h, 37 º C Increased fluorescence:

9 IgGpurification Lib2c7SR trplzegfp ZEGFP 100 ml shake flask ZEGFP 6,4 mg/l TrpLZEGFP 17,2 mg/l Lib2c7SR 696 mg/l 9