Prokaryot proteinproduktion

Transkript

1 Some recombinant therapeutic products (2008) Prokaryot proteinproduktion 4/ Anti-TNF Antibodies Major Cancer Antibodies Insulin and Insulin Analogs Erythropoietins Coagulation factors hgh 16.4 bln US dollars 15.6 bln US dollars 10.9 bln US dollars 10 bln US dollars 5 bln US dollars 2.7 bln US dollars Expression of cloned genes in bacteria Modifiering av genexpression Genetiska strategier Medel: - promotorer - terminatorer - RBS-styrka - antal genkopior - genfusioner - gensekvens (codon usage) - etc Att ta hänsyn till: - transkription - translation - lokalisering - proteinstabilitet - metabola förhållanden - reningsprocess etc Biologiska system för proteinexpression Prokaryota expressionsvärdar Escherichia coli Bacillus subtilis Saccharomyces cerevisiae (jäst) Insektsceller Däggdjursceller Växtceller Transformationsmetoder - CaCl 2 + värme - elektroporering - gene-gun - virusmedierade - liposomer Escherichia coli - Gram-negativ stav - rörlig - ickepatogen - generationstid ca 25 min - genetiskt och fysiologiskt karaktäriserad - många specialstammar tillgängliga 1

2 Prokaryota expressionsvärdar A prokaryotic cell E. coli-promotorer fungerar i de flesta Gram-negativa bakterier. Universalplasmider kan användas. Salmonella spp., Cholera spp., Shigella spp. m.fl. används bl.a. i vaccinforskning p.g.a immunogena egenskaper Bacillus spp.- hög proteasaktivitet vilket ofta skapar problem Coryonebacterium glutamicum Trichoderma reesei Pseudomonas spp. Staphylococcus spp. Streptococcus spp. The prokaryotic cell wall Produktionsstrategier Gram+ Gram- Extracellulär sekretion Periplasmatiskt Intracellulärt, lösligt Intracellulärt, olösligt Ytexpression Strategier för rekombinant proteinproduktion i Escherichia coli Proteinet är stabilt och lösligt Proteinrening Escherichia coli Extracellulär produktion Proteinet bryts ner byta bakteriestam byta ut känsliga amino syror i proteinet optimera odlingsbetingelser Proteinet är stabilt Lysering av cellerna Proteinrening Intracellulär produktion Proteinet är lösligt Proteinet bryts ner byta bakteriestam byta ut känsliga amino syror i proteinet optimera odlingsbetingelser Proteinet bildar inklusionskroppar Lysering av cellerna Proteinrening Upplösning av inklusionskroppar Renaturering Proteinrening Intracellulära proteiner Lösliga Inget behov av solubilisering och refolding Löslighetsförhöjande fusionspartners Thioredoxin MBP Kan vara skadliga för cellen Proteolys Komplex rening Inklusionskroppar Hög produktion Lätta att isolera Skyddar mot proteolys Solubilisering och refolding krävs 2

3 Sekreterade proteiner Ytexpression Extracellulärt - signalpeptid behövs - enklare rening - inte alla proteiner är sekretionskomp. Periplasmatiskt - signalpeptid behövs - disulfidbindningar möjliga - proteolysproblem - osmotisk chock Gram- bakterier: - fusioner till bakteriella yttermembranproteiner, ex. OmpA Gram+ bakterier: - cellväggs ankare, ex. SpA Bibliotek för screening - slumpmässiga DNA-snuttar i OmpA-gen Vaccinapplikationer - immunogena peptider/proteiner Various display formats Expressionsplasmid antibiotikaresistensgen-för att plasmiden ska stanna i cellen målprotein-det proteiner som egentligen önskas affinitetssvans-för att underlätta detektion/rening replikationsstart (ORI)-för att plasmiden ska replikeras signalsekvens-för att proteinet ska exporteras ut ur cellen promotor- för att den önskade DNA-sekvensen ska transkriberas till RNA och sedan translateras till ett protein ion of a protein The purification problem Extracellular, secreted S +little contaminants -some proteins impossible to secrete Intracellular +higher yields -more contaminants than when secreted -/+may lead to inclusion bodies 3

4 Interaktioner Affinity chromatography Negativa laddningar Hydrofoba ytor Positiva laddningar Yta med specifik affinitet! Powerful unit operation! concentration and!!! purification in a single step! Ideal technology as early capture! step in bioprocesses Benefits of affinity chromatography Affinity chromatography-two possibilities Fermentation Cell disruption Initial sample preparation Fermentation Cell disruption Initial sample preparation Gene fusion Native target Tag Target Target Chromatography 1 Chromatography 2 Affinity chromatography Chromatography 3 Polishing Final product Polishing Final product + General method for many targets + Several tag fusion systems available - Specific cleavage necessary to remove tag + Recovery of native target - New ligand for each target (or group) ion of a protein Extracellular, secreted S S S Intracellular Handle Handle Handle Handle +little contaminants -some proteins impossible to secrete +higher yields -more contaminants than when secreted -/+may lead to inclusion bodies Vanliga affinitetssvansar Några väl använda affinitetsvansar ProteinA 31kDa binder IgG elueras med lågt ph Z 7kDa binder IgG elueras med lågt ph ABP 5-25kDa binder HSA elueras med lågt ph GST 25kDa binder glutation elueras med glutation His6 6 aa binder metalljoner elueras med imidazol eller lågt ph Biotin 13kDa binder avidin elueras med biotin FLAG-peptid 8 aa binder till mono- elueras med lågt ph klonal antikropp elleredta 4

5 Borttagning av affinitetssvansar Exempel på klyvningsmetoder Exempel på enzymatiska klyvningsmetoder: Enzymatiska metoder: mer specifika dyrare fysiologiska förhållanden Kemiska metoder: mer ospecifika billigare kräver ofta ofysiologiska förhållanden Trombin klyver efter Arg, beroende av 3D-strukuren H64Subtilisin klyver efter Ala-His-Tyr, mindre beroende av 3D-strukt. Enterokinas klyver efter(asp) 3-5-Lys, mycket selektivt Trypsin klyver efter Arg och Lys, för oselektivt för många appl. Proteas 3C klyver efter Leu-Glu-Thr-Leu-Phe-Gln, mycket selektivt Exempel på kemiska klyvningsmetoder: CNBr klyver efter Met, ej om Met finns i målproteinet Hydroxylamin klyver mellan Asn och Gly, kan modifiera produkten Ion exchange chromatography Z basic : grafting positive charge onto helix 1 & 2 Z Z basic1 Z basic2 Cation exchange at ph 9 Constructions for purification and cleavage mau 1500 Z basic2 ms/cm 80 Purification tag E A L F Q G P Target 1000 Z wt 60 Z basic Purification tag X X X X X X X Protease 5

6 Cultivation First purification and capture step by Cleavage EBA-technology Second purification and capture step in Pure product packed bed Zb-Target Purification of Zbasic2 fusion proteins with EBA-technology Absorbance(280 nm) ion and purification strategy Zbasic-QG-Klenow L FT P Time kda Zbasic-3C L FT P kda Zb-3C Strategy for protein production: recovery of target protein from inclusion bodies Levinthals paradox 1) Fermentation 2) Isolation Random fit to a native fold Result: Folding time will exceed the estimated life time of the universe 3) Solubilization A=100 aa, every aa has 2 conf. -> 107 years Levinthal, C. (1969) How to fold graciously 4) Renaturation native misfolded aggregated Folding - a self assembly-process All Folding information in the polypeptide chain No extrinsic factors needed No input of energy needed Anfinsen, C. B., et al (1961) Proc. Natl. Acad. Sci. USA 47, To fold or not to fold Unfolded Native Stabilizing factors Total energy (100 a.a.) [kcal / mol] H-bonds Van der Waals interactions Covalent bonds Conformational stability G -10 [kcal / mol] A single hydrogen bond up to G -10 [kcal / mol] 6

7 Inclusion bodies Recovery (I) Cell breakage Aggregates of partly folded proteins Affected by the rate of expression Mainly non-covalently bound + the protein is protected from degradation - solubilization is needed Separation of inclusion bodies from the cell debris: 1.Sonication or high pressure homogenization 2.Centrifugation 3.Washing (when expression levels are low) Solubilization of the cell and the inclusion body: 1.Urea or GdmCl 2.Centrifugation d= µm (E. coli 2µm) Recovery (II) Refolding (I) Concerns when solubilizing the inclusion bodies The main problem is aggregation! Avoid interference with the coming purification methods Inhibit proteases Avoid chemical reactivity towards labile amino acids If thiol groups are present add reducing agent Suggested solution 6M GdmHCl (charged) or 8M Urea (contaminated with isocyanate) Low protein concentration ( µm) Stepwise dilution before removal of denaturant by dialysis Additives stoichiometric amounts of PEG (MW 350) 0.5-1M L-arginine detergents, for instance Lauryl-maltoside, CHAPS co-factors suiting your protein glycerol <20 % EtOH <30 % 100mM Tris ph 8 Chemical modifications of the protein to increase the solubility 100mM DTT Refolding: disulfide formation (I) Air oxidation, catalyzed by metal ions + cheap - slow - nonreversible, problems with dimer-formation and mismatched disulfides - oxidation of Met and Cys Alternatively: - block all free cysteines reversibly (sulfitolysis) - purify under denaturating conditions - disulfide formation Refolding: disulfide formation (II) Disulfide exchange - expensive (in large scale) + reversible system, mismatched disulfides can be reduced 5:1 or 10:1 of GSSG:GSH (0.1-10mM), since the effective molarity of protein cysteines are higher, protein disulfides will be favoured Cole, R. D. (1967) Methods Enz. 11,

8 Disulfide exchange folding Separation of IGF-I variants with various disulfides Promoter strength affect the protein expression level Promoter (Escherichia coli) Start of RNA synthesis Start of coding sequence CCGGTTGACAGATAGTCGTGTATGCGATATAATCAGCCCGTAGTCGGAGGGTCCTGACATG GGCCAACTGTCTATCAGCACATACGCTATATTAGTCGGGCATCAGCCTCCCAGGACTGTAC "Pribnow box" P Gene for protein 5 Produced molecule Translation Figure 6-3 Molecular Biology of the Cell ( Garland Science 2008) Vanligt använda promotorer Promotor Induktionsmedel a Styrka lac IPTG rel. svag tac -35 trp -10 lac IPTG rel. stark trc IPTG rel. stark trp Trp-svält/β-IAA T7 IPTG mkt stark P L (λ) Värme mkt stark lac(ts) Värme P SPA Konstitutiv svag P BAD L-arabinos rel. stark Ett urval av promotorer använda för hög proteinexpression i E. coli a mest använda metod för inducering. Förkortningar: SPA, Staphylococcus aureus protein A; IPTG, isopropyl-β-d-thiogalactopyranoside; β-iaa, β-indolakrylsyra. Promotor Lac-repressor (Lac I) Laktos eller IPTG (syntetisk analog) Reglering av laktos-operonet (E. coli) Lac I Catabolite Activator Protein (CAP) S.D. 5 Lac I 3 CAP Cykliskt AMP (camp) camp/capbindningsställe Promotor= Landningsplats för RNA-polymeras RNA-pol Lac I -start Lac Z Lac Y Lac A DNA Operatorsekvens S.D. S.D. S.D. Lac Z Lac Y Lac A 5 3 β-galaktosidas: Spjälkar laktos till galaktos och glukos Laktos-permeas: Reglerar införsel av laktos Thio-galaktosid-acetylas: Bryter ned ej klyvbara laktos-analoger Frånvaro av laktos: Lac-repressorn binder till operator-sekvensen Transkriptionen blockeras; inget β-galaktosidas-enzym (eller något av de andra enzymerna) produceras Närvaro av laktos (eller IPTG): Lac-repressorn kan inte binda till operator-sekvensen Transkriptionsker; β-galaktosidas-enzym (och alla de andra enzymerna) produceras Närvaro av laktos (eller IPTG) samt låga halter av glukos: Halten av camp stiger camp-cap-komplex bildas som kan binda uppströms om promotorn camp-cap-komplex främjar transkriptionen (vägleder RNA-polymeraset) Mer β-galaktosidas-enzym produceras 8

9 Trp-operonet T7-systemet och P L promotor repressor operator Trp trpl trpe trpd trpc trpb trpa T7-systemet Lac-promotor Lacoperatopolymeras- T7 RNAgen T7-promotor gen Tryptofan-svält repressor T7 RNA-polymeras trpl trpe trpd trpc trpb trpa P L -promotorn repressorprotein från bakteriofag λ Odling C aktiv repressor Inducering 42 C inaktiv repressor ger genexpression pet protein expression system P BAD promoter FIGURE 10.4 FIGURE 10.5 Test av promotorstyrka His 6 ABPGFP Trc T7 Negative control SPA LacUV5 Fluorescence intensity Red = T7 Green = Trc Blue = LacUV5 Yellow = SPA H. Tegel, unpublished 9