The Central Dogma. Molekylär bioteknik. Sophia Hober. Secondary structure. Tertiary structure. Importance of correct fold. Quaternary structure

Transkript

1 The Central Dogma Molekylär bioteknik DNA CGCGGATTCATTAGCTGAAGCTAAAGTCTTAGCTCTGAG GCGCCTAAGTAATCGACTTCGATTTCAGAATCGAGACTC Replication Måndagen den 3/11 mrna Transcription CGCGGAUUCAUUAGCUGAAGCUAAAGUCUAGCUCUGAG Translation Sophia Hober telefon nr: A D S Q A K L A V L K D L Q A T R L GV S D T Folding protein Secondary structure Tertiary structure antiparallell "-sheet parallell "-sheet!-helix Quaternary structure Importance of correct fold PrP c PrP Sc

2 The angles in a peptide bond Levinthals paradox!random fit to a native fold!result: Folding time will exceed the estimated life time of the universe A=100 aa, every aa has 2 conf. -> 10 7 years Levinthal, C. (1969) How to fold graciously Ramachandran plot Folding - a self assembly-process!all Folding information in the polypeptide chain!no extrinsic factors needed!no input of energy needed Anfinsen, C. B., et al (1961) Proc. Natl. Acad. Sci. USA 47, To fold or not to fold Why study protein folding? Unfolded Stabilizing factors! H-bonds! Van der Waals interactions! Covalent bonds Native! Total energy (100 a.a.)! [kcal / mol]! Conformational stability #G! -10 [kcal / mol]! A single hydrogen bond up to #G! -10 [kcal / mol]!to understand protein function!to perform protein design!to predict 3-D structures!to refold product proteins

3 Two-state model of protein folding Jigsaw puzzle model U N K eq = N U Nucleation model U I I I1 I2 I3 N The Molten Globule!Condensed, in a globular form!contains secondary structure!stabilized by non-specific hydrophobic interactions!topology close to native!rate limiting step Molten globule model

4 Experimental methods to study stability and folding (1) UNSPECIFIC:!Spectroscopic methods Absorbance spectra of HCAII Absorbance: Electronic excitation of the aromatic residues Tertiary structures Fluorescence: Electronic excitation and emission of the aromatic residues Tertiary structures Freskgård P.-O. (1994) Thesis Fluorescence emission spectra of HCAII Experimental methods to study stability and folding (2) UNSPECIFIC:!Spectroscopic methods Circular Dichroism proteins absorb right and left handed polarized light differently Freskgård P.-O. (1994) Thesis!Near UV ( nm) Tertiary structures Aromatic residues Cysteines!Far UV ( nm) Secondary structures!, "... Circular Dichroism CD spectra for various secondary structures!-helix "-sheet "-turn random coil

5 Far UV Circular Dichroism Near UV Circular Dichroism Denatured hprp Reduced hprp Reduced hprp Oxidized hprp Oxidized hprp Jackson G.S. et al (1999) Science 283, Jackson G.S. et al (1999) Science 283, Experimental methods to study stability and folding (3) SPECIFIC:!Probes Fluorescent probes covalently bound depends on environment Chemical reactivity probes accessibility Cysteines accessibility, charged reactants (IAA) Experimental methods to study stability and folding (4) SPECIFIC:!NMR, measuring the H-bonds Pulse labeled NMR Quenched hydrogen exchange NMR!Disulfide exchange folding Natural probes following folding by trapping the disulfide intermediates Pulse labeled NMR Disulfide exchange folding Unfolding conditions D 2 O Refolding conditions t= from 1 ms D H 2 O Refolding D H H + Analysis by NMR Roder et al 1988 Nature

6 Separation of IGF-I variants with various disulfides by gel electrophoresis Experimental methods to study stability and folding (5) SPECIFIC:!Protein engineering should not affect the native structure Remove specific interactions Measure changes in energetics during folding Measure changes in stability Change tryptophane residues for phenylalanine Measure changes in fluorescence during folding Protein engineering to understand protein folding Using CD spectroscopy for kinetic measurements Far UV measures the secondary structure content Fluorescence emission measures the tertiary structure content

7 Strategier för rekombinant proteinproduktion i Escherichia coli Prokaryotic cell Extracellulär produktion Intracellulär produktion Proteinet är stabilt och lösligt!proteinrening Escherichia coli Proteinet bryts ner! byta bakteriestam! byta ut känsliga amino syror i proteinet! optimera odlingsbetingelser Proteinet är stabilt!lysering av cellerna!proteinrening Proteinet är lösligt Proteinet bildar inklusionskroppar Proteinet bryts ner! byta bakteriestam! byta ut känsliga amino syror i proteinet! optimera odlingsbetingelser!lysering av cellerna!proteinrening!upplösning av inklusionskroppar!renaturering!proteinrening Prokaryotic Cell Wall Expressionsvektor Gram+ Gram- antibiotikaresistensgen-för att plasmiden ska stanna i cellen målprotein-det proteiner som egentligen önskas affinitetssvans-för att underlätta detektion/rening replikationsstart (ORI)-för att plasmiden ska replikeras signalsekvens-för att proteinet ska exporteras ut ur cellen promotor- för att den önskade DNA-sekvensen ska transkriberas till RNA och sedan translateras till ett protein Production of a protein Extracellular, secreted THE PURIFICATION PROBLEM S Product +little contaminants -some proteins impossible to secrete Intracellular Product +higher yields -more contaminants than when secreted -/+may lead to inclusion bodies

8 Interaktioner Affinity chromatography Negativa laddningar Hydrofoba ytor! Powerful unit operation! Product concentration and!!! purification in a single step Positiva laddningar Yta med specifik affinitet! Ideal technology as early capture! step in bioprocesses Benefits of affinity chromatography Fermentation Cell disruption Initial sample preparation Chromatography 1 Chromatography 2 Chromatography 3 Fermentation Cell disruption Initial sample preparation Affinity chromatography +/- with affinity chromatography + high specificity fewer purification steps necessary products in low concentration can be purified - expensive limited amount of ligands ligand stability column cleaning Polishing Polishing Final product Final product Affinity chromatography Two possibilities Gene fusion Native target Tag Target Target Affinitetssvansar används för att underlätta rening / detektion Anpassas efter vilka förhållanden som målproteinet tål under framreningen + General method for many targets + Several tag fusion systems available - Specific cleavage necessary to remove tag + Recovery of native target - New ligand for each target (or group)

9 Production of a protein Extracellular, secreted Några väl använda affinitetsvansar S Handle Product S Product Handle S Product Intracellular Handle Product Product Handle Product +little contaminants -some proteins impossible to secrete +higher yields -more contaminants than when secreted -/+may lead to inclusion bodies ProteinA 31kDa binder IgG elueras med lågt ph Z 7kDa binder IgG elueras med lågt ph ABP 5-25kDa binder HSA elueras med lågt ph GST 25kDa binder glutation elueras med glutation His6 6 aa binder metalljoner elueras med imidazol eller lågt ph Biotin 13kDa binder avidin elueras med biotin FLAG-peptid 8 aa binder till mono- elueras med lågt ph klonal antikropp elleredta För att kunna rena fram det önskade målproteinet behöver ibland fusionssvansen klyvas bort Enzymatiska metoder: mer specifika dyrare fysiologiska förhållanden Kemiska metoder: mer ospecifika billigare kräver ofta ofysiologiska förhållanden Ibland måste fusionssvansen klyvas bort för att målproteinet ska bli användbart Exempel på enzymatiska klyvningsmetoder: Trombin H64Subtilisin Enterokinas Trypsin Proteas 3C klyver efter Arg, beroende av 3D-strukuren klyver efter Ala-His-Tyr, mindre beroende av 3D-strukt. klyver efter(asp) 3-5-Lys, mycket selektivt klyver efter Arg och Lys, för oselektivt för många appl. klyver efter Leu-Glu-Thr-Leu-Phe-Gln, mycket selektivt Ionexchange chromatography För att kunna rena fram det önskade målproteinet måste fusionssvansen ibland klyvas bort Exempel på kemiska klyvningsmetoder: CNBr klyver efter Met, ej om Met finns i målproteinet Hydroxylamin klyver mellan Asn och Gly, kan modifiera produkten

10 Gelfiltration Strategy for production and recovery 1) Fermentation Absorbance 2) Isolation 3) Solubilization Time or Volume 4) Renaturation native misfolded aggregated Inclusion bodies Aggregates of partly folded proteins Affected by the rate of expression Mainly non-covalently bound + the protein is protected from degradation - solubilization is needed Cell breakage Recovery (1) " Separation of inclusion bodies from the cell debris: 1.Sonication or high pressure homogenization 2.Centrifugation 3.Washing (when expression levels are low) " Solubilization of the cell and the inclusion body: 1.Urea or GdmCl 2. Centrifugation d= !m (E. coli"2!m) Recovery (2) Concerns when solubilizing the inclusion bodies " Avoid interference with the coming purification methods " Inhibit proteases " Avoid chemical reactivity towards labile amino acids " If thiol groups are present add reducing agent Suggested solution 6M GdmHCl (charged) or 8M Urea (contaminated with isocyanate) 100mM Tris ph 8 100mM DTT Refolding (1) The main problem is aggregation " Low protein concentration ("!M) " Stepwise dilution before removal of denaturant by dialysis " Additives stoichiometric amounts of PEG (MW 350) 0.5-1M L-arginine detergents, for instance Lauryl-maltoside, CHAPS co-factors suiting your protein glycerol <20 % EtOH <30 % " Chemical modifications of the protein to increase the solubility

11 Characterization of purified and refolded targets "Purity / Homogeneity "Folded? Circular dichroism Absorbance NMR... Thereafter: "Specific assays enzymaic activity affinity... Disulfide formation (1) Air oxidation, catalyzed by metal ions + cheap - slow - nonreversible, problems with dimer-formation and mismatched disulfides - oxidation of Met and Cys Alternatively block all free cysteines reversible (sulfitolysis) purify under denaturating conditions disulfide formation Cole, R. D. (1967) Methods Enz. 11, Disulfide formation (2) Disulfide exchange - expensive (in large scale) + reversible system, mismatched disulfides can be reduced 5:1 or 10:1 of GSSG:GSH (0.1-10mM), since the effective molarity of protein cysteines are higher, protein disulfides will be favoured