Dieten hur evolu.onen av en ny funk.on kan ha en nega.v effekt på vår hälsa

Storlek: px
Starta visningen från sidan:

Download "Dieten hur evolu.onen av en ny funk.on kan ha en nega.v effekt på vår hälsa"

Transkript

1 Dieten hur evolu.onen av en ny funk.on kan ha en nega.v effekt på vår hälsa Ulf Gyllensten, Ins.tu.onen för Immunologi, Gene.k och Patologi, Uppsala Universitet och Science for Life Laboratory Uppsala

2

3 Homo erectus H. sapiens (Cro- Magnon) Homo neanderthalensis

4 Nervsystemet är.ll stor del (60%) uppbyggt av fep, i första hand fleromäpade fepsyror. Dessa grupperas i Omega- 3 och Omega- 6, och är bägge nödvändiga för hjärnans funk.on. Omega 3 och Omega 6 Omega 6 Omega 3

5 Långa fleromäpade fepsyror (LC- PUFAs) Omega- 3 har första dubbelbandet mellan 3:e och 4:e kolatomen och Omega- 6 mellan 6:e and 7:e. Essen.ella fepsyror: via dieten som förformer (linolensyra, LA, och α- linolensyra ALA) eller som färdiga PUFAs (AA och DHA). DHA finns i fisk och marina däggdjur och AA i ägg, fep från landdjur och lever. Förformerna, LA and ALA, finns i vissa vegetariska oljor.

6 Betydelsen av långa fleromäpade fepsyror Omega 3 (DHA) är nödvändigt för hjärnans och synnervens utveckling. DHA nivån hos vuxna påverkar arbetsminne och mentala funk.oner. DHA motverkar produk.onen av inflamma.onsökande substanser (dvs är an.inflammatoriskt) DHA has visats minska risken för kardiovaskulär sjukdom, reuma.sm och vissa former av cancer.

7 Energimängd och fepsyror i födan för.diga Afrikanska Hominder.

8 AP utveckla och bibehålla storhjärnan Utvecklingen av människan stora hjärna krävde.llgång.ll Omega 3 och Omega 6 via dieten eller genom ap synte.sera dem. Den bästa källan.ll Omega 3 är fisk och marina däggdjur, men dessa är mindre bra källor.ll kalorier. Kan en fysiologisk anpassning ha skep där en muta.on gav den moderna människan möjlighet ap öka produk.onen av Omega 3 och Omega 6 fepsyror?

9 EUROSPAN - European Special Popula.on Research Network Hälsoundersökning av europeiska popula.oner utanför storstadsområdena. Miljöfaktorer: Hur påverkar klimat, diet och livss.l den humana hälsan? Iden.fiering av gene.ska faktorer som är av betydelse för sjukdomsrisken.

10 Sverige Karesuando/Soppero Storbritannien Orkneyöarna Sverige Subark.skt klimat Extrem varia.on i dagslängd Utomhusarbete, mkt fysisk ak.vitet Livss.l Diet: viltköp och fisk Arbete (Utomhusarbete, fysisk ak.vitet) Nederländerna Byar på landet Stabil popula.on och miljö Italien Alpbyar i Tyrolen Kroa.en Öar i Adria.ska havet

11 Karesuando - 35 C

12 Midvinter maxdagljus

13 EUROSPAN Popula.onsbaserad, alla boende inbjudna 5 popula.oner < personer Undersökning Hälsoundersökning (t ex BMI, puls, blodtryck, lungor, bentäthet) Kliniskt kemiska analyser t ex blodfeper Livss.l (diet, socioeconomi, fysisk ak.vitet) Analyser av gene.sk varia.on

14 Varför studera blodfeper? Kolesterol en av de vanligaste kliniska analyserna och en indikator för risk ap utveckla hjärt- kärlsjukdomar. - LDL kolesterol (low density lipoprotein cholesterol) det dåliga kolesterolen - HDL kolesterol (high denisty lipoprotein cholesterol) det goda kolesterolen Både miljömässiga och ärlliga faktorer bidrar.ll kolesterolnivån

15 Kolesterol 6,2 6 5,8 Kolesterol (män) Kolesterol (kvinnor) 5,6 5,4 5,2 5 4,8 Sverige Kroatien Italien Storbritannien Nederländerna

16 FADS enzymernas funk.on

17 FADS enzymernas funk.on

18 Två olika gene.ska varianter av FADS generna; A = ancestral, D=derived SNP Freq. (percent) Assoc Haplotype Tot High Low Pval D CCCTCGTTAATCTTAAAAACCACCCTAG e-65 A AGTCGACCGGCTCCGGGGGTTGAAAAGA e-52 M1 CGTCCGCCGGTCTTGGAGGTTGAAAAGA e-04 M2 AGTCGACCGGCTCCGGGGGTTGACAAGA e-02 M3 AGTCGACCGGTTCCGGGGGTTGAAAAGA e-01 M4 CCCTCGTTAATCTTAAAAACCAAAAAGA e

19 FADS D varianten ökar syntesen av Omega 3 och 6

20 FADS D varianten finns bara hos människan D för Derived (red), A för Ancestral (blue)

21 FADS D varianten uppkom för 250 kya FADS1 FADS2 low hz 30 kb region Chimpanzee vs. hg muta.on/bp/genera.on Haplotypen DD hos Afrikaner Haplotype AA hos Paleo- Eskimo & Aborigin från Australien 600 kya 250 kya

22 FADS D varianten har selekterats för

23 Geografiska fördelningen of FADS varianterna Hypotes: D uppkom i Afrika och när de första grupperna av moderna människor lämnade Afrika tog de med sig både A och D. Selek.onen för D fortsape i Afrika,.lls dagens situa.on när det endast finns D. De grupper som vandrade in i Amerika hade inte med sig D varianten.

24 Summering De två FADS- variaterna är olika effek.va för ap synte.sera PUFAs. Den effek.va varianten (D) finns endast hos den moderna människan. Varianten uppkom för cirka år sedan i Afrika och har varit under posi.v selek.on. Idag är den effek.va varianten dominerande i Afrika, finns i hög frekvens i Europa och Asien, men inte alls i Amerika.

25 Summering D ger en överlevnadsfördel när.llgången.ll PUFAs är begränsad, som under människans utveckling. Den västerländska dieten har ändrats från ep förhållande mellan Omega 6:Omega 3 om 1:1,.ll 20:1. Ökad Omega 6 (AA) som är starkt proinflammatorisk. D varianten ökar risken för hjärt- kärlsjukdom, och är en thrily genotype = gene.sk faktor som en gång varit posi.v ap ha men som med överskop på energi och fep nu ökar risken ap bli sjuk.

26

27 Metabolic pathways of omega-6 and omega-3 fatty acids AA FADS DHA

28 Medical relevance Tradi.onal diet of some na.ve popula.ons is rich in Omega 3 and Omega 6, but the diet transi.on means less intake of PUFAs and therefore an increased risk of deficiency. In the last 150 years the average Western diet has changed from a Omega 6: Omega 3 ra.on of 1:1 ra.o to an es.mated 20:1. The D haplotype may act as a thrily genotype and represent a risk factor for life- style related diseases.

29 Medical relevance FADS genotypes associated with inflamma.on and coronary artery disease. Carriers of FADS D haplotype prone to a proinflammatory response favoring atherosclero.c vascular damage. Mar$nelli et al. Am J Clin Nutr Oct;88(4): Differences in FADS gene variants in African Americans and European Americans with diabetes or the metabolic syndrome. A gene.c risk factor contribu.ng to health dispari.es between popula.ons of African and European descent. Sergeant et al. Br J Nutr Feb;107(4):

30 Medical relevance Total cholesterol, HDL, LDL and triglyceride are influenced by the FADS genotype already in 10 year old children. Gene.cally determined blood lipid levels during childhood predispose development of cardiovascular diseases. Standl et al, for the GINIplus Study Group and LISAplus Study Group PLOS ONE 2012

31 LC- PUFA and cogni.ve func.on " Mice exposed to a diet rich in omega- 6 PUFAs during gesta.on display anxiety- like behavior. Prenatal diet rich in omega- 6 PUFAs result in classic features of au.sm. Maternal diet rich in omega-6 polyunsaturated fatty acids during gestation and lactation produces autistic-like sociability deficits in adult offspring. Jones et al, Behavioural Brain Research, The ra.o between maternal dietary n6 and n3 (LC)PUFA intake influences the childs brain development during fetal life,. The Dietary n6:n3 FaYy Acid Ra$o during Pregnancy Is Inversely Associated with Child Neurodevelopment. Bernard,et al and the EDEN Mother- Child Cohort Study Group. The Journal of Nutri$on " "

Fetter och kolesterol hur gamla missförstånd lever vidare. Ralf Sundberg Kirurg, docent, författare

Fetter och kolesterol hur gamla missförstånd lever vidare. Ralf Sundberg Kirurg, docent, författare Fetter och kolesterol hur gamla missförstånd lever vidare Ralf Sundberg Kirurg, docent, författare Organpreservation Kroppstemperatur 37 C, 3-4 nm Fosfolipidernas sammansättning 45% mättade fettsyror i

Läs mer

Är det nyttigt med fet mat?

Är det nyttigt med fet mat? Är det nyttigt med fet mat? Forskningens dag Falun 151008 David Iggman ST-läkare Norslund/Svärdsjö VC Centrum för Klinisk Forskning Dalarna, Falun Klinisk Nutrition och Metabolism, Uppsala Universitet

Läs mer

Efalex Mor & Barn. Omega-3 med hög koncentration av DHA för gravida och ammande!

Efalex Mor & Barn. Omega-3 med hög koncentration av DHA för gravida och ammande! Efalex Mor & Barn Omega-3 med hög koncentration av DHA för gravida och ammande! Särskilt DHA behövs för att fostret ska utvecklas optimalt, bland annat när det gäller motorik, minnesfunktion och kognitiv

Läs mer

Stillasittande & ohälsa

Stillasittande & ohälsa Stillasittande & ohälsa FaR:s dag att skapa möjligheter till fysisk aktivitet 19 november Malmö Johan Faskunger Fil dr Fysisk aktivitet & hälsovetenskap Föreläsningens upplägg: Stillasittande & ohälsa

Läs mer

Nutri&on och inflamma&on. Lena Jonasson Professor, överläkare Kardiologiska kliniken Universitetssjukhuset, Linköping

Nutri&on och inflamma&on. Lena Jonasson Professor, överläkare Kardiologiska kliniken Universitetssjukhuset, Linköping Nutri&on och inflamma&on Lena Jonasson Professor, överläkare Kardiologiska kliniken Universitetssjukhuset, Linköping An&inflammatorisk mat - finns det? 10 i topp: Lax Kelp (brunalg) Olivolja Grönsaker,

Läs mer

Barnkliniker Universitetskliniker

Barnkliniker Universitetskliniker Vi har aldrig varit så många Vi representerar idag 57 registrerande enheter! 32 21 4 BUMMAR Barnkliniker Universitetskliniker BORIS Styrgrupp 2014 Jovanna Dahlgren läkare Göteborg Pernilla Danielsson ssk

Läs mer

Nationella Diabetesregistret, Registercentrum Västra Götaland

Nationella Diabetesregistret, Registercentrum Västra Götaland Nationella Diabetesregistret, Registercentrum Västra Götaland Agenda Lipidvärden och lipidsänkande behandlingdata från nya årsrapporten Vad har NDR lärt oss om lipidvärden och lipidsänkande behandling

Läs mer

Metabola Syndromet. Bukfetma, dyslipidemi (ogynnsamt blodfettsmönster), hyperglykemi (högt blodsocker) och förhöjt blodtryck.

Metabola Syndromet. Bukfetma, dyslipidemi (ogynnsamt blodfettsmönster), hyperglykemi (högt blodsocker) och förhöjt blodtryck. Metabola Syndromet Bukfetma, dyslipidemi (ogynnsamt blodfettsmönster), hyperglykemi (högt blodsocker) och förhöjt blodtryck. Definition av MetS 3 av 5. 1. Midjemått (beroende av etnicitet) >90cm för män

Läs mer

Graviditet och stor viktuppgång, hur förebygger vi? Läkaresällskapet 2 feb 2016

Graviditet och stor viktuppgång, hur förebygger vi? Läkaresällskapet 2 feb 2016 Graviditet och stor viktuppgång, hur förebygger vi? Läkaresällskapet 2 feb 2016 ELISABETH STORCK LINDHOLM MÖDRAHÄLSOVÅRDSÖVERLÄKARE SLL Våga väga interventionsprojekt för feta gravida kvinnor 2006 tom

Läs mer

Kombinerad träning kan muskeln bli snabb, stark och uthållig på samma gång?

Kombinerad träning kan muskeln bli snabb, stark och uthållig på samma gång? OMT/FYIM Kongress/Årsmöte 20-21 mars 2015 Kombinerad träning kan muskeln bli snabb, stark och uthållig på samma gång? Tommy Lundberg Karolinska Institutet Acknowledgements Inst. för hälsovetenskap, Mittuniversitetet

Läs mer

Fysisk aktivitet för barn och ungdomar. Örjan Ekblom, docent Åstrandlaboratoriet, GIH

Fysisk aktivitet för barn och ungdomar. Örjan Ekblom, docent Åstrandlaboratoriet, GIH Fysisk aktivitet för barn och ungdomar Örjan Ekblom, docent Åstrandlaboratoriet, GIH Exponering Mekanism Riskfaktorer Utfall Begreppet fysisk aktivitet Fysisk aktivitet Hjärta/kärl Plaque CVD - Intensitet

Läs mer

EPIPAIN. Den vidunderliga generaliserade smärtan. Stefan Bergman

EPIPAIN. Den vidunderliga generaliserade smärtan. Stefan Bergman EPIPAIN Den vidunderliga generaliserade smärtan Stefan Bergman 1993 läste jag en ar/kel The prevalence of chronic widespread pain in the general popula5on Cro7 P, Rigby AS, Boswell R, Schollum J, Silman

Läs mer

Psykisk sjukdom i samband med graviditet, barnafödande och spädbarnstid

Psykisk sjukdom i samband med graviditet, barnafödande och spädbarnstid Psykisk sjukdom i samband medgraviditet och spädbarnst Psykisk sjukdom i samband med graviditet, barnafödande och spädbarnstid Ulla Björklund Överläkare, mödrahälsovård och förlossningsvård Psykisk sjukdom

Läs mer

Hur påverkas familjen runt den överviktsopererade patienten? Mikaela Willmer, leg dietist, med dr

Hur påverkas familjen runt den överviktsopererade patienten? Mikaela Willmer, leg dietist, med dr Hur påverkas familjen runt den överviktsopererade patienten? Mikaela Willmer, leg dietist, med dr Upplägg Bakgrund Möjliga påverkansvägar Familjen som arena för förändring Forskning på området (inkl min

Läs mer

Plasma fa(y acids and treatment response

Plasma fa(y acids and treatment response Study 2. Results Plasma fa(y acids and treatment response For the whole group, no significant correla:on could be found between the degree of improvement in ADHD Ra:ng Scale scores and the degree of change

Läs mer

The lower the better? XIII Svenska Kardiovaskulära Vårmötet Örebro

The lower the better? XIII Svenska Kardiovaskulära Vårmötet Örebro The lower the better? XIII Svenska Kardiovaskulära Vårmötet Örebro Karin Manhem Sahlgrenska Universitetssjukhuset Göteborg Överlevnad Blodtryck Överlevnad NEJ Blodtryck Överlevnad Blodtryck Blodtryck och

Läs mer

Faktor som är statistiskt associerad till ökad risk för insjuknande i sjukdomen Rimlig biologisk mekanism finns som förklarar sambandet faktor -

Faktor som är statistiskt associerad till ökad risk för insjuknande i sjukdomen Rimlig biologisk mekanism finns som förklarar sambandet faktor - Fredrik Wallentin Faktor som är statistiskt associerad till ökad risk för insjuknande i sjukdomen Rimlig biologisk mekanism finns som förklarar sambandet faktor - sjukdom Dosrelation (graderat samband)

Läs mer

Behöver lipider tas fastande? Mäta eller beräkna LDL? Peter Ridefelt Klinisk kemi och farmakologi Akademiska sjukhuset Uppsala

Behöver lipider tas fastande? Mäta eller beräkna LDL? Peter Ridefelt Klinisk kemi och farmakologi Akademiska sjukhuset Uppsala Behöver lipider tas fastande? Mäta eller beräkna LDL? Peter Ridefelt Klinisk kemi och farmakologi Akademiska sjukhuset Uppsala Fastekrav? European Atherosclerosis Society (EAS) European Federation of Clinical

Läs mer

Att kalla för hälsosamtal: Finns det evidens? Levnadsvanor: Vad nytt under solen? 13-02-06 Lars Jerdén

Att kalla för hälsosamtal: Finns det evidens? Levnadsvanor: Vad nytt under solen? 13-02-06 Lars Jerdén Att kalla för hälsosamtal: Finns det evidens? Levnadsvanor: Vad nytt under solen? 13-02-06 Lars Jerdén Påverkar metoden hälsosamtal rökning, alkoholvanor, fysisk aktivitet och matvanor? I så fall: Hur

Läs mer

Från epidemiologi till klinik SpAScania

Från epidemiologi till klinik SpAScania Från epidemiologi till klinik SpAScania Ann Bremander, PT, PhD Docent vid Lunds Universitet Institutionen för kliniska vetenskaper Avdelningen för reumatologi SpAScania 2007 The impact of SpA on the individual

Läs mer

Lipidsänkande behandling efter hjärtinfarkt - eller före? Kristina Hambraeus Överläkare, Cardiologkliniken Falu Lasarett

Lipidsänkande behandling efter hjärtinfarkt - eller före? Kristina Hambraeus Överläkare, Cardiologkliniken Falu Lasarett Lipidsänkande behandling efter hjärtinfarkt - eller före? Kristina Hambraeus Överläkare, Cardiologkliniken Falu Lasarett Disposition Primär- eller sekundärprevention? Högriskeller befolkningsstrategi?

Läs mer

Luftföroreningar, astma och allergi hos barn Nya fynd från svenska studier

Luftföroreningar, astma och allergi hos barn Nya fynd från svenska studier Luftföroreningar, astma och allergi hos barn Nya fynd från svenska studier Göran Pershagen Institutet för Miljömedicin Karolinska Institutet Bakgrund Luftföroreningar kan öka risken för luftvägssymtom

Läs mer

Economics - questions, methods, data and the aim for results KATARINA STEEN CARLSSON, INST KLINISKA VETENSKAPER, MALMÖ

Economics - questions, methods, data and the aim for results KATARINA STEEN CARLSSON, INST KLINISKA VETENSKAPER, MALMÖ Economics - questions, methods, data and the aim for results KATARINA STEEN CARLSSON, INST KLINISKA VETENSKAPER, MALMÖ Uncertainty and the Welfare Economics of Medical Care Kenneth J. Arrow, American Economic

Läs mer

BIOMARKERS MEDIATORS SYSTEMIC LUPUS ERYTHEMATOSUS

BIOMARKERS MEDIATORS SYSTEMIC LUPUS ERYTHEMATOSUS BIOMARKERS AND MEDIATORS IN SYSTEMIC LUPUS ERYTHEMATOSUS IFNα versus the CRP response, and evalua8on of supar and an8- dsdna an8body assays Helena Enocsson Linköpings Universitet, Ins8tu8onen för klinisk

Läs mer

AMOS study (Adolescent Morbidity Obesity Surgery)

AMOS study (Adolescent Morbidity Obesity Surgery) --9 AMOS study (Adolescent Morbidity Obesity Surgery) Inclusion -9 Prospective controlled nonrandomized Stockholm, Gothenburg, Malmö Surgery at Sahlgrenska, Gothenburg Gothenburg Malmö Stockholm Inclusion

Läs mer

Är de officiella kostråden felaktiga? Fredrik Nyström professor i internmedicin

Är de officiella kostråden felaktiga? Fredrik Nyström professor i internmedicin Är de officiella kostråden felaktiga? Fredrik Nyström professor i internmedicin Look AHEAD studien Long Term Effects of a Lifestyle Intervention on Weight and Cardiovascular Risk Factors in Individuals

Läs mer

Att utveckla allergi en fråga om risk, frisk eller fiskfaktorer? Fettsyra metabolism

Att utveckla allergi en fråga om risk, frisk eller fiskfaktorer? Fettsyra metabolism Att utveckla allergi en fråga om risk, frisk eller fiskfaktorer? Allergistämman, Göteborg 2012 Karel Duchén Docent, Barnallergolog. Barn och ungdomskliniken Universitetssjukhuset i Linköping Fettsyra metabolism

Läs mer

Farmakogene*k/genomik

Farmakogene*k/genomik Farmakogene*k/genomik HT- 2009 Jonas Melke Ins2tu2onen för neurovetenskap och fysiologi Sek2onen för farmakologi Göteborgs universitet jonas.melke@pharm.gu.se Översikt Introduk*on Defini2oner Gene2sk varia2on.

Läs mer

Obesity Trends* Among U.S. Adults BRFSS, 1985

Obesity Trends* Among U.S. Adults BRFSS, 1985 Obesity Trends* Among U.S. Adults BRFSS, 1985 (*BMI 30, or ~ 30 lbs overweight for 5 4 person) No Data

Läs mer

Högt blodtryck. Åderlåtning i Landeryd/Hylte

Högt blodtryck. Åderlåtning i Landeryd/Hylte Högt blodtryck Åderlåtning i Landeryd/Hylte 2 Bra källor att läsa om hypertoni Läkemedelskommitténs Terapirekommendationer 2014 Nya riktlinjer från Läkemedelsverket 2014 som kommer senast i början av hösten,

Läs mer

Omega-3, självproducerat eller via dieten? Anders Jacobsson Stockholms Universitet

Omega-3, självproducerat eller via dieten? Anders Jacobsson Stockholms Universitet Omega-3, självproducerat eller via dieten? Anders Jacobsson Stockholms Universitet DU BLIR VAD DU ÄTER!? World Consumption of Oils and Fats (FAO) World consumption of oils and fats has grown steadily during

Läs mer

Fredrik Sjödin Institutionen för psykologi Epost: fredrik.sjodin@umu.se

Fredrik Sjödin Institutionen för psykologi Epost: fredrik.sjodin@umu.se Fredrik Sjödin Epost: fredrik.sjodin@umu.se SAMHÄLLSBULLER - AGENDA 1. Kort info om exponering och störning 2. Hälsoeffekter 3. Kostnader 4. Åtgärder kostnad/vinst SAMHÄLLSBULLER BAKGRUND Buller omger

Läs mer

När stamcellerna kommer till klassrummet

När stamcellerna kommer till klassrummet När stamcellerna kommer till klassrummet Klas Blomgren Översikt Hjärnans utveckling Plasticitet och stamceller Fysisk aktivitet Psykisk aktivitet berikad miljö 1 Huvudet och hjärnan Pannloben Hjässloben

Läs mer

THE SALUT PROGRAMME A CHILD HEALTH INTERVENTION PROGRAMME IN SWEDEN. ISSOP 2014 Nordic School of Public Health. Gothenburg SWEDEN UMEÅ UNIVERSITY

THE SALUT PROGRAMME A CHILD HEALTH INTERVENTION PROGRAMME IN SWEDEN. ISSOP 2014 Nordic School of Public Health. Gothenburg SWEDEN UMEÅ UNIVERSITY THE SALUT PROGRAMME A CHILD HEALTH INTERVENTION PROGRAMME IN SWEDEN UMEÅ UNIVERSITY VÄSTERBOTTEN COUNTY COUNCIL Epidemiology and Global Health Strategic Development Office Public Health Unit ANNELI IVARSSON

Läs mer

Kardiovaskulär primärpreven2on i kri2sk belysning vad håller vi på med egentligen?

Kardiovaskulär primärpreven2on i kri2sk belysning vad håller vi på med egentligen? Kardiovaskulär primärpreven2on i kri2sk belysning vad håller vi på med egentligen? Moderatorer: Lena Jonasson, Linköping, Peter M Nilsson, Malmö Preven&onens svåra e&k problemets omfa4ning och riktlinjernas

Läs mer

Hur kan gentekniken hjälpa oss att lösa stora folkhälsfrågor? Tove Fall Institutionen för medicinska vetenskaper Uppsala Universitet

Hur kan gentekniken hjälpa oss att lösa stora folkhälsfrågor? Tove Fall Institutionen för medicinska vetenskaper Uppsala Universitet Hur kan gentekniken hjälpa oss att lösa stora folkhälsfrågor? Tove Fall Institutionen för medicinska vetenskaper Uppsala Universitet Hjärt- kärlsjukdom Samlade namnet för sjukdomar i hjärta och blodkärl

Läs mer

Use it or lose it - Barnhälsovårdens ansvar för barns hjärnor som framtidsinvestering. Anna Sarkadi

Use it or lose it - Barnhälsovårdens ansvar för barns hjärnor som framtidsinvestering. Anna Sarkadi Use it or lose it - Barnhälsovårdens ansvar för barns hjärnor som framtidsinvestering Anna Sarkadi BRAINS Barnhälsovårdens uppdrag: att skapa optimala förutsättningar för BRAINS, Better Relations And Interconnected

Läs mer

XIVSvenska. Gemensam hälsokurs på KS för kardiometabola pa9enter. Gudrun Andersson och Chris9na Jarnert Stockholm. Kardiovaskulära Vårmötet

XIVSvenska. Gemensam hälsokurs på KS för kardiometabola pa9enter. Gudrun Andersson och Chris9na Jarnert Stockholm. Kardiovaskulära Vårmötet Kardiovaskulära Vårmötet XIVSvenska 25-27 april, 2012, Stockholm Gemensam hälsokurs på KS för kardiometabola pa9enter Gudrun Andersson och Chris9na Jarnert Stockholm Ingen intressekonflikt föreligger Dysglykemi

Läs mer

Mat från havet ska göra oss friskare

Mat från havet ska göra oss friskare Mat från havet ska göra oss friskare Institutionen för Kemi och Bioteknik Chalmers Tekniska Högskola Utmaningar Sjukdomar associerade med felnäring (fetma och kostrelaterade sjukdomar) prevention i form

Läs mer

Amning inlärning och intelligens

Amning inlärning och intelligens Amning inlärning och intelligens Per Gustafsson BUP-klin, US Linköping Per.Gustafsson@imk.liu.se Duchén K Avd för pediatrik, Birberg U, Karlsson T Avd för Psykologi Många studier har visat ett positivt

Läs mer

Hur kan FHV samarbeta med arbetsgivarna? Öl Berndt Karlsson Arbets- o Miljömedicinska kliniken NUS Umeå

Hur kan FHV samarbeta med arbetsgivarna? Öl Berndt Karlsson Arbets- o Miljömedicinska kliniken NUS Umeå Rehabilitering i av skiftesarbetare? t motverka hälsoriskerna Hur kan FHV samarbeta med arbetsgivarna? Öl Berndt Karlsson Arbets- o Miljömedicinska kliniken NUS Umeå Min bakgrund Allmän medicin Geriatrik

Läs mer

Livsgnista som en del av det goda åldrandet: fokus på svensk- och finskspråkiga äldre

Livsgnista som en del av det goda åldrandet: fokus på svensk- och finskspråkiga äldre Livsgnista som en del av det goda åldrandet: fokus på svensk- och finskspråkiga äldre Marina Näsman, Doktorand i socialpolitik vid Åbo Akademi och forskare i samhällsvetenskaper vid Svenska Litteratursällskapet

Läs mer

Hälsoproblem. Graviditetsstörning 2014-02-24. Hälsoproblem hos skiftarbetare

Hälsoproblem. Graviditetsstörning 2014-02-24. Hälsoproblem hos skiftarbetare Hälsoproblem hos skiftarbetare Anders Knutsson Arbets- och miljömedicin, Sundsvall Umeå 17 februari 2014 Hälsoproblem Sömnproblem, trötthet, olycksfall Graviditetsstörning Magtarmbesvär Hjärt-kärl sjukdom

Läs mer

Klinisk kemisk diagnos.k

Klinisk kemisk diagnos.k Klinisk kemisk diagnos.k Introduk.on Johan Malm professor/överläkare i klinisk kemi inst f transla.onell medicin Lunds universitet Skånes universitetssjukhus Malmö kvinna, 53 år,.digare frisk, vill bli

Läs mer

Vad vet vi om animaliska livsmedel?

Vad vet vi om animaliska livsmedel? Department of Food Science Vad vet vi om animaliska livsmedel? särskilt fokus på fettsammansättning Jana Pickova Institutionen för livsmedelsvetenskap; SLU DHA i maten har minskat Kyle and Arterburn, 1998

Läs mer

2013-10- 08. Slutsatser om livsmedel, drycker, koster- barnperspek=v. Slutsatser rörande råd om STATENS BEREDNING FÖR MEDICINSK UTVÄRDERING

2013-10- 08. Slutsatser om livsmedel, drycker, koster- barnperspek=v. Slutsatser rörande råd om STATENS BEREDNING FÖR MEDICINSK UTVÄRDERING 2013-10- 08 STATENS BEREDNING FÖR MEDICINSK UTVÄRDERING Sidfot Slutsatser om livsmedel, drycker, koster- barnperspek=v Carl- Erik Flodmark Mat vid fetma Slutsatser rörande råd om Viktnedgång hos barn och

Läs mer

Cykling i ett folkhälsoperspektiv

Cykling i ett folkhälsoperspektiv Cykling i ett folkhälsoperspektiv Peter Schantz Mittuniversitetet, Östersund & FoU-gruppen för rörelse, hälsa och miljö, GIH, Stockholm Changes in Prevalence of Adult Obesity >= 25% 20-24% 15-19% 10-14%

Läs mer

Långvarigt stillasittande - en hälsofara i tiden. Elin Ekblom Bak, PhD Gymnastik- och idrottshögskolan, Stockholm Utbildningsdag, Uppsala.

Långvarigt stillasittande - en hälsofara i tiden. Elin Ekblom Bak, PhD Gymnastik- och idrottshögskolan, Stockholm Utbildningsdag, Uppsala. Långvarigt stillasittande - en hälsofara i tiden Elin Ekblom Bak, PhD Gymnastik- och idrottshögskolan, Stockholm Utbildningsdag, Uppsala. 6 maj 2015 Obesity Trends* Among U.S. Adults BRFSS, 1985 (*BMI

Läs mer

På professorns tallrik så ska vi äta enligt forskare och myndigheter

På professorns tallrik så ska vi äta enligt forskare och myndigheter På professorns tallrik så ska vi äta enligt forskare och myndigheter Mai-Lis Hellénius, professor, Karolinska Institutet Överläkare, Livsstilsmottagningen, Hjärtkliniken, Karolinska Universitetssjukhuset,

Läs mer

Prioritering på svenska Hur effektiva ska åtgärderna vara för att de ska prioriteras?

Prioritering på svenska Hur effektiva ska åtgärderna vara för att de ska prioriteras? Prioritering på svenska Hur effektiva ska åtgärderna vara för att de ska prioriteras? Ulf Persson IHE, The Swedish Institute for Health Economics & Institute of Economic Research, School of Economics and

Läs mer

ADHD och stress. Johan Isaksson. Leg psykolog, med dr Inst. för neurovetenskap, BUP Uppsala universitet

ADHD och stress. Johan Isaksson. Leg psykolog, med dr Inst. för neurovetenskap, BUP Uppsala universitet ADHD och stress Johan Isaksson Leg psykolog, med dr Inst. för neurovetenskap, BUP Uppsala universitet ADHD Symtomdiagnos, utifrån DSM-IV 1994 (2013) Huvudsakligen bristande Uppmärksamhet Huvudsakligen

Läs mer

Kolesterol på gott & ont

Kolesterol på gott & ont Undvik fett så går du ner i vikt och slipper sjukdom! Ät mer fett så går du ner i vikt och håller dig frisk! Kolesterol på gott & ont Vilka olika fetter finns i kroppen Fosfolipider Fosfat med två fettsyror

Läs mer

En guidad tur i kostdjungeln

En guidad tur i kostdjungeln Malmö 2015-09-30 En guidad tur i kostdjungeln Staffan Lindeberg Distrikstläkare, Vårdcentralen Sankt Lars, Lund Docent i allmänmedicin, Centrum för primärvårdsforskning 1 Alla är överens detta är inte

Läs mer

BALANSEN MELLAN OMEGA 3

BALANSEN MELLAN OMEGA 3 BALANSEN MELLAN OMEGA 3 OCH OMEGA 6 1 Kroniska inflammationer i det moderna samhället BALANSERA DIN HÄLSA 2 Balansen mellan omega-6 och omega-3 Varje cell i kroppen och cellorganellerna är omgivna av ett

Läs mer

känslan av att vakna utvilad

känslan av att vakna utvilad känslan av att vakna utvilad Sömnen fysiskt, mentalt och socialt viktig Sömnen ger viktig återhämtning för hjärna och kropp. Läkarvetenskapen har funnit en möjlig koppling mellan sömnbrist och flera stora

Läs mer

Calicivirus och andra virus. Kjell-Olof Hedlund Enheten för Speciell Diagnostik Smittskyddsinstitutet

Calicivirus och andra virus. Kjell-Olof Hedlund Enheten för Speciell Diagnostik Smittskyddsinstitutet Calicivirus och andra virus Kjell-Olof Hedlund Enheten för Speciell Diagnostik Smittskyddsinstitutet Tarmen kan liknas vid ett kärl som lämpar sig mycket väl för virusodling Ryhovs sjukhus drabbat av vinterkräksjukan

Läs mer

HT 2011. En farmakologs syn på. Biologisk variation. Orsaker & konsekvenser Läkemedelsanvändning. I Nylander. Medicin & Farmaci

HT 2011. En farmakologs syn på. Biologisk variation. Orsaker & konsekvenser Läkemedelsanvändning. I Nylander. Medicin & Farmaci HT 2011 En farmakologs syn på Biologisk variation Orsaker & konsekvenser Läkemedelsanvändning I Nylander Medicin & Farmaci Individrelaterade faktorer Vad händer i veckan? Introduktion Miljöns inverkan

Läs mer

Konsultsjuksköterska inom barncancervård. Ulrika Larsson Barncancercentrum Drottning Silvias barn och ungdomssjukhus Göteborg

Konsultsjuksköterska inom barncancervård. Ulrika Larsson Barncancercentrum Drottning Silvias barn och ungdomssjukhus Göteborg Konsultsjuksköterska inom barncancervård Ulrika Larsson Barncancercentrum Drottning Silvias barn och ungdomssjukhus Göteborg Konsultsjuksköterskor Tidig kontakt med familjen Information Samordna psykosoc

Läs mer

Distriktssköterskan och Socialstyrelsens nya Riktlinjer gällande Levnadsvanor!

Distriktssköterskan och Socialstyrelsens nya Riktlinjer gällande Levnadsvanor! Distriktssköterskan och Socialstyrelsens nya Riktlinjer gällande Levnadsvanor! Trender i livsstil och hälsa 50-åriga män, Göteborg, Sverige, 1963-2003 1963 2003 Rökning % 56 22 Regelbunden FA % 32 24 Stress

Läs mer

Föräldrars /lltro /ll sin förmåga a7 påverka sina ungdomar (self- efficacy): Koppling /ll föräldrabeteenden och föräldra- barnrela/onen.

Föräldrars /lltro /ll sin förmåga a7 påverka sina ungdomar (self- efficacy): Koppling /ll föräldrabeteenden och föräldra- barnrela/onen. Föräldrars /lltro /ll sin förmåga a7 påverka sina ungdomar (self- efficacy): Koppling /ll föräldrabeteenden och föräldra- barnrela/onen Terese Glatz Presentation Vad är self- efficacy? - Teore/sk bakgrund

Läs mer

Inkvarteringsstatistik. Göteborg & Co. Februari 2012

Inkvarteringsstatistik. Göteborg & Co. Februari 2012 Inkvarteringsstatistik Göteborg & Co Februari 2012 FoU/ Marknad & Försäljning Gästnätter storstadsregioner Februari 2012, hotell och vandrarhem Gästnattsutveckling storstadsregioner Februari 2012, hotell

Läs mer

Hälsoeffekter av luftföroreningar i Stockholm Göran Pershagen

Hälsoeffekter av luftföroreningar i Stockholm Göran Pershagen Hälsoeffekter av luftföroreningar i Stockholm Göran Pershagen Göran Pershagen 23 oktober 2013 1 PM 2,5 absorbans och PM 10 koncentrationer i olika europeiska städer Eeftens et al. 2012 NOx 1960 1970 1980

Läs mer

TRÄNING, KOSTHÅLLNING OCH ANTI AGE LIGGER I TIDEN

TRÄNING, KOSTHÅLLNING OCH ANTI AGE LIGGER I TIDEN 2/12 3/12 01 TRÄNING, KOSTHÅLLNING OCH ANTI AGE LIGGER I TIDEN Hur kommer det sig att en rad kroniska sjukdomar som hjärt- och kärlsjukdomar, diabetes typ 2 och fetma bara ökar? Studier visar att en balans

Läs mer

Socker och sjukdomsrisk. Emily Sonestedt, PhD Lunds Universitet

Socker och sjukdomsrisk. Emily Sonestedt, PhD Lunds Universitet Socker och sjukdomsrisk Emily Sonestedt, PhD Lunds Universitet Aspekter att ta hänsyn till vid tolkning av forskningen! Vilken typ av socker har studerats?! Vilken typ av studiedesign har använts?! Har

Läs mer

Graviditetsdiabetes hälsokonsekvenser för mor och barn i ett längre perspektiv

Graviditetsdiabetes hälsokonsekvenser för mor och barn i ett längre perspektiv Graviditetsdiabetes hälsokonsekvenser för mor och barn i ett längre perspektiv Ingrid Östlund Kvinnokliniken USÖ SFOG 2010-08-30 Graviditetsdiabetes (GDM) asymptomatiskt tillstånd av glucosintolerans upptäckt

Läs mer

Carotid Artery Wall Layer Dimensions during and after Pre-eclampsia An investigation using non-invasive high-frequency ultrasound

Carotid Artery Wall Layer Dimensions during and after Pre-eclampsia An investigation using non-invasive high-frequency ultrasound Carotid Artery Wall Layer Dimensions during and after Pre-eclampsia An investigation using non-invasive high-frequency ultrasound Studie I-IV I. Increased carotid intima thickness and decreased media thickness

Läs mer

Biosimilarer ur ett svenskt perspektiv. Bertil Jonsson Medical Products Agency

Biosimilarer ur ett svenskt perspektiv. Bertil Jonsson Medical Products Agency Biosimilarer ur ett svenskt perspektiv Bertil Jonsson Medical Products Agency Vad? Godkännande Visst det finns riktlinjer Riskhantering (RMP, PhV) Original och kopia Uppföljning i Sverige Spårbarhet PhV

Läs mer

Medicinsk riskbedömning med hjälp av ASA-klassificering

Medicinsk riskbedömning med hjälp av ASA-klassificering Larsson et al Accepterad för publicering den 3 mars 2000 Medicinsk riskbedömning med hjälp av ASA-klassificering Bengt Larsson, Nils Bäckman och Anna-Karin Holm I en tidigare publicerad studie undersöktes

Läs mer

Kunskapslyftet. Berndt Ericsson. Esbo Utbildning, arbetsliv och välfärd 2007-10-16 17. Ministry of Education and Research. Sweden

Kunskapslyftet. Berndt Ericsson. Esbo Utbildning, arbetsliv och välfärd 2007-10-16 17. Ministry of Education and Research. Sweden Kunskapslyftet Berndt Ericsson Sweden 2007-10-16 17 Esbo Utbildning, arbetsliv och välfärd 1997-2002 Four important perspectives or aims Develop adult education Renew labour market policy Promote economic

Läs mer

Protein en livsviktig byggsten

Protein en livsviktig byggsten Protein en livsviktig byggsten Ingvar Bosaeus Enheten för klinisk nutrition Sahlgrenska universitetssjukhuset Göteborg KSLA 2015-02-19 Aminosyra Alpha Amino- grupp Fredrik Bertz Karboxyl- grupp 20 aa

Läs mer

Det nya åldrandet. Förändringar i Göteborgs äldre befolkning under 40 år

Det nya åldrandet. Förändringar i Göteborgs äldre befolkning under 40 år Det nya åldrandet. Förändringar i Göteborgs äldre befolkning under 40 år Ingmar Skoog Föreståndare för AGECAP Centrum i Göteborg Neuropsykiatrisk Epidemiologi Institutionen för Klinisk Neurovetenskap och

Läs mer

Amning del 2 Bröstmjölk Modersmjölksersättning April 2015. Cecilia Hedström, leg dietist Centrala barnhälsovården Göteborg och S Bohuslän.

Amning del 2 Bröstmjölk Modersmjölksersättning April 2015. Cecilia Hedström, leg dietist Centrala barnhälsovården Göteborg och S Bohuslän. Amning del 2 Bröstmjölk Modersmjölksersättning April 2015 Cecilia Hedström, leg dietist Centrala barnhälsovården Göteborg och S Bohuslän. Amning Minskar risk för (grade 1): - Mag- och tarminfektioner -

Läs mer

Skräddarsydd kostbehandling vid övervikt och fetma hos vuxna

Skräddarsydd kostbehandling vid övervikt och fetma hos vuxna Skräddarsydd kostbehandling vid övervikt och fetma hos vuxna Anna Hägg Leg.Dietist Överviktscentrum Finns en kost som passar alla? 1 Skräddarsydd kostbehandling Område som behöver utvecklas, fler studier

Läs mer

Vi är inte vegetarianer

Vi är inte vegetarianer Kapitel 8 Vi är inte vegetarianer Matsmältningsapparaten Växtätare får hjälp av mikroorganismer med att sönderdela cellulosans sockerkedjor. Idisslare förjäser cellulosan i en stor vom, hästen och gnagarna

Läs mer

Induk&on 26:e augus& 2015

Induk&on 26:e augus& 2015 Induk&on 26:e augus& 2015 Jag har inga jäv eller intressekonflikter att deklarera Primum non nocere Induktion leder till Längre förlossningar Ökad risk för sectio Slutsats: Inducera bara på medicinsk indikation

Läs mer

2013-10- 08 STATENS BEREDNING FÖR MEDICINSK UTVÄRDERING. Råd om mat vs. fakoskt intag ramverk för tolkning av slutsatser om koster

2013-10- 08 STATENS BEREDNING FÖR MEDICINSK UTVÄRDERING. Råd om mat vs. fakoskt intag ramverk för tolkning av slutsatser om koster STATENS BEREDNING FÖR MEDICINSK UTVÄRDERING MAT VID FETMA EN SYSTEMATISK LITTERATURÖVERSIKT, 2013 SLUTSATSER OM KOSTER Hot Topic- seminarium 25 september 2013 Swedish NutriOon FoundaOon/ Göteborgs Universitet

Läs mer

Måltidersättning och viktreduktion

Måltidersättning och viktreduktion Stockholms Obesitasdagar 12-13 maj 2011 Måltidersättning och viktreduktion Anna Hägg Leg. Dietist Överviktscentrum Definitoner av och regler kring Livsmedel för viktminskning Studier om måltidsersättning

Läs mer

Dokument nr: 4.3 (6) Titel: Kosttillskott. Inledning:

Dokument nr: 4.3 (6) Titel: Kosttillskott. Inledning: Dokument nr: 4.3 (6) Titel: Kosttillskott Inledning: Den legitimerade optikern är en del av den primära ögonhälsovården, och utför majoriteten av alla synundersökningar. Pga. detta har den legitimerade

Läs mer

Stroke. Trombocythämning och antikoagulantia efter stroke. - en folksjukdom! Per Wester, Umeå Strokecenter

Stroke. Trombocythämning och antikoagulantia efter stroke. - en folksjukdom! Per Wester, Umeå Strokecenter 1 Trombocythämning och antikoagulantia efter stroke Per Wester, Umeå Strokecenter STROKE - vilka läkemedel kan förhindra återinsjuknande och hur effektiva är de? Läkemedelskommittén Örebro Läns Landsting

Läs mer

Yttrande över RUFS 2010-Underlag för att bedöma aktualitet och användbarhet (LS 1304-0578)

Yttrande över RUFS 2010-Underlag för att bedöma aktualitet och användbarhet (LS 1304-0578) 2013-12-19 SLSO 13-1395 Yttrande över RUFS 2010-Underlag för att bedöma aktualitet och användbarhet (LS 1304-0578) Ärendet Stockholms läns sjukvårdsområde har erbjudits möjlighet att yttra sig över aktualitet

Läs mer

Diabetes Hur kan vi förebygga typ 2 diabetes?

Diabetes Hur kan vi förebygga typ 2 diabetes? Diabetes Hur kan vi förebygga typ 2 diabetes? Föreläsning vid öppet hus på KI den 30 augusti 2014 Kerstin Brismar Professor, överläkare Karolinska Universitetssjukhuset-Sophiahemmet Inst för Medicin och

Läs mer

Barn och unga i palliativ vård

Barn och unga i palliativ vård Barn och unga i palliativ vård Ulrika Kreicbergs, Leg. Ssk, Med.Dr Gålöstiftelsens professur i palliativ vård av barn och unga Ulrika.Kreicbergs@esh.se WHO s DEFINITION AV PALLIATIV VÅRD AV BARN Palliativ

Läs mer

Vägen 'll spelproblem, hur hjärnan påverkas & stöd-/behandlingsmöjligheter

Vägen 'll spelproblem, hur hjärnan påverkas & stöd-/behandlingsmöjligheter Vägen 'll spelproblem, hur hjärnan påverkas & stöd-/behandlingsmöjligheter Anne H Berman, docent leg psykolog, leg psykoterapeut anne.h.berman@ki.se Drogfokus 2016 Uppsala, 20 oktober Översikt Psykosociala

Läs mer

Trö,het hjärnans has;ghetsmätare. (och stoppsignal) Torbjörn Åkerstedt

Trö,het hjärnans has;ghetsmätare. (och stoppsignal) Torbjörn Åkerstedt Trö,het hjärnans has;ghetsmätare Stress > störd sömn > trö,het > sjukfrånvaro (och stoppsignal) Torbjörn Åkerstedt Stressforskningsins;tutet, Torbjörn Åkerstedt Stockholms universitet Stockholm Stress

Läs mer

Nytt i Nya Nordiska Näringsrekommendationerna

Nytt i Nya Nordiska Näringsrekommendationerna Nytt i Nya Nordiska Näringsrekommendationerna Mikael Fogelholm, professor i näringslära Helsingfors universitet Institutionen för livsmedel- och miljövetenskaper Faculty of Agriculture and Forestry Department

Läs mer

Hälsoeffekter av motion?

Hälsoeffekter av motion? Fysisk aktivitet vid typ 2-diabetes Olika typer av aktivitet och effekter Tomas Fritz dl Sickla Hälsocenter Vem tror att regelbunden motion har positiva hälsoeffekter för människor? FARs Dag 21 September

Läs mer

Bästa konditionsträningen på 30 min

Bästa konditionsträningen på 30 min Bästa konditionsträningen på 30 min - Örjan Ekblom -Forskare vid Åstrandlaboratoriet, GIH -Arbetar främst med studier kring hälsoeffekter av fysisk aktivitet och kondition. -Även intresserad av prestationsutveckling,

Läs mer

6 februari 2013. Soffia Gudbjörnsdottir Registerhållare NDR

6 februari 2013. Soffia Gudbjörnsdottir Registerhållare NDR 6 februari 2013 Soffia Gudbjörnsdottir Registerhållare NDR NDR utveckling sedan 1996 Verktyg i förbättringsarbetet Mer än 1200 enheter online 2012 Nationella riktlinjer 100% av sjukhusklinikerna Kvalitetskontroll

Läs mer

Caroline Löfvenmark, leg ssk, doktorand Karolinska Institutet, Institutionen för kliniska vetenskaper, Danderyds sjukhus

Caroline Löfvenmark, leg ssk, doktorand Karolinska Institutet, Institutionen för kliniska vetenskaper, Danderyds sjukhus Multiprofessionellt utbildningsprogram för närstående till hjärtsviktspatienter Caroline Löfvenmark, leg ssk, doktorand Karolinska Institutet, Institutionen för kliniska vetenskaper, Danderyds sjukhus

Läs mer

Minskar måttlig alkoholkonsumtion risken för hjärt-kärlsjukdom?

Minskar måttlig alkoholkonsumtion risken för hjärt-kärlsjukdom? Minskar måttlig alkoholkonsumtion risken för hjärt-kärlsjukdom? Sven Andréasson Karolinska institutet Riddargatan 1 Mottagningen för alkohol och hälsa Hur säker är den skyddande effekten? Observationsstudier:

Läs mer

Benamputationer i Sverige = Lika för alla? Anton Johannesson Ortopedingenjör, Med Dr.

Benamputationer i Sverige = Lika för alla? Anton Johannesson Ortopedingenjör, Med Dr. Benamputationer i Sverige = Lika för alla? Anton Johannesson Ortopedingenjör, Med Dr. Friskrivningsklausul Denna sammanfattning, om inte annat anges, av amputationsstatistik i Sverige är tagen från Socialstyrelsen

Läs mer

Vad händer med havsnivån i Stockholms län - vad behöver vi planera för? Signild Nerheim SMHI

Vad händer med havsnivån i Stockholms län - vad behöver vi planera för? Signild Nerheim SMHI Vad händer med havsnivån i Stockholms län - vad behöver vi planera för? Signild Nerheim SMHI Vad händer med havet? Global höjning av vattenståndet i havet 1993-2005 uppmätt med sateliter http://earthobservatory.nasa.gov/iotd/view.php?id=6638

Läs mer

Namn: Anneli Svensson, Linköping Titel: Nya diagnos9ska kriterier för ARVC: Vad blir det för konsekvenser för familjeutredning?

Namn: Anneli Svensson, Linköping Titel: Nya diagnos9ska kriterier för ARVC: Vad blir det för konsekvenser för familjeutredning? Namn: Anneli Svensson, Linköping Titel: Nya diagnos9ska kriterier för ARVC: Vad blir det för konsekvenser för familjeutredning? Ingen intressekonflikt Ursprungs- och reviderade kriterier VI. Family history

Läs mer

Fysisk aktivitet och träning vid övervikt och fetma, vilka effekter nås?

Fysisk aktivitet och träning vid övervikt och fetma, vilka effekter nås? Fysisk aktivitet och träning vid övervikt och fetma, vilka effekter nås? Anita Wisén Forskargruppen sjukgymnastik Institutionen för hälsa, vård och samhälle Vad är fysisk aktivitet och träning? Intensitet

Läs mer

Dan Andersson, Högskolan i Borås 1

Dan Andersson, Högskolan i Borås 1 Sambandet mellan rörelse och hälsa Dan Andersson Ins5tu5onen för vårdvetenskap Högskolan i Borås Fysisk aktivitet = Alla sorters rörelser som leder till att energi förbrukas. Motion = medveten fysisk aktivitet

Läs mer

Fysisk aktivitet och psykisk hä. hälsa. Jill Taube oktober 2012

Fysisk aktivitet och psykisk hä. hälsa. Jill Taube oktober 2012 Fysisk aktivitet och psykisk hä hälsa Jill Taube oktober 2012 Projekt: Öppna jämförelser 2010 Psykiatrisk vård- Socialstyrelsen EN SLUTSATS: En överdödlighet i somatiska sjukdomar hos patienter som vårdats

Läs mer

Att följa, stimulera och bedöma språkutveckling en uppgift för barnhälsovården i Sverige. Ett förslag till allmän hälsokontroll av 4-åringar

Att följa, stimulera och bedöma språkutveckling en uppgift för barnhälsovården i Sverige. Ett förslag till allmän hälsokontroll av 4-åringar Att följa, stimulera och bedöma språkutveckling en uppgift för barnhälsovården i Sverige Monica Westerlund, leg logoped, docent vid Medicinska fakulteten, Uppsala universitet monica.westerlund@kbh.uu.se

Läs mer

Validering av kvalitetsregisterdata vad duger data till?

Validering av kvalitetsregisterdata vad duger data till? Validering av kvalitetsregisterdata vad duger data till? Anders Ekbom, Professor Karolinska Institutet Institutionen för medicin Solna Enheten för klinisk epidemiologi Karolinska Universitetssjukhuset

Läs mer

Sekundärprevention efter hjärtinfarkt- når vi målen?

Sekundärprevention efter hjärtinfarkt- når vi målen? Sekundärprevention efter hjärtinfarkt- når vi målen? Inledning Det är sedan länge känt att sekundärpreventiv behandling efter genomgången hjärtinfarkt är effektivt, och i europeiska riktlinjer publicerade

Läs mer

Varför är det så viktigt att barnfetma uppmärksammas tidigt?

Varför är det så viktigt att barnfetma uppmärksammas tidigt? Varför är det så viktigt att barnfetma uppmärksammas tidigt? Claude Marcus National Childhood Obesity Centre Karolinska Institutet Stockholm, Sweden Varför är det så viktigt att barnfetma uppmärksammas

Läs mer