Dieten hur evolu.onen av en ny funk.on kan ha en nega.v effekt på vår hälsa

Storlek: px
Starta visningen från sidan:

Download "Dieten hur evolu.onen av en ny funk.on kan ha en nega.v effekt på vår hälsa"

Transkript

1 Dieten hur evolu.onen av en ny funk.on kan ha en nega.v effekt på vår hälsa Ulf Gyllensten, Ins.tu.onen för Immunologi, Gene.k och Patologi, Uppsala Universitet och Science for Life Laboratory Uppsala

2

3 Homo erectus H. sapiens (Cro- Magnon) Homo neanderthalensis

4 Nervsystemet är.ll stor del (60%) uppbyggt av fep, i första hand fleromäpade fepsyror. Dessa grupperas i Omega- 3 och Omega- 6, och är bägge nödvändiga för hjärnans funk.on. Omega 3 och Omega 6 Omega 6 Omega 3

5 Långa fleromäpade fepsyror (LC- PUFAs) Omega- 3 har första dubbelbandet mellan 3:e och 4:e kolatomen och Omega- 6 mellan 6:e and 7:e. Essen.ella fepsyror: via dieten som förformer (linolensyra, LA, och α- linolensyra ALA) eller som färdiga PUFAs (AA och DHA). DHA finns i fisk och marina däggdjur och AA i ägg, fep från landdjur och lever. Förformerna, LA and ALA, finns i vissa vegetariska oljor.

6 Betydelsen av långa fleromäpade fepsyror Omega 3 (DHA) är nödvändigt för hjärnans och synnervens utveckling. DHA nivån hos vuxna påverkar arbetsminne och mentala funk.oner. DHA motverkar produk.onen av inflamma.onsökande substanser (dvs är an.inflammatoriskt) DHA has visats minska risken för kardiovaskulär sjukdom, reuma.sm och vissa former av cancer.

7 Energimängd och fepsyror i födan för.diga Afrikanska Hominder.

8 AP utveckla och bibehålla storhjärnan Utvecklingen av människan stora hjärna krävde.llgång.ll Omega 3 och Omega 6 via dieten eller genom ap synte.sera dem. Den bästa källan.ll Omega 3 är fisk och marina däggdjur, men dessa är mindre bra källor.ll kalorier. Kan en fysiologisk anpassning ha skep där en muta.on gav den moderna människan möjlighet ap öka produk.onen av Omega 3 och Omega 6 fepsyror?

9 EUROSPAN - European Special Popula.on Research Network Hälsoundersökning av europeiska popula.oner utanför storstadsområdena. Miljöfaktorer: Hur påverkar klimat, diet och livss.l den humana hälsan? Iden.fiering av gene.ska faktorer som är av betydelse för sjukdomsrisken.

10 Sverige Karesuando/Soppero Storbritannien Orkneyöarna Sverige Subark.skt klimat Extrem varia.on i dagslängd Utomhusarbete, mkt fysisk ak.vitet Livss.l Diet: viltköp och fisk Arbete (Utomhusarbete, fysisk ak.vitet) Nederländerna Byar på landet Stabil popula.on och miljö Italien Alpbyar i Tyrolen Kroa.en Öar i Adria.ska havet

11 Karesuando - 35 C

12 Midvinter maxdagljus

13 EUROSPAN Popula.onsbaserad, alla boende inbjudna 5 popula.oner < personer Undersökning Hälsoundersökning (t ex BMI, puls, blodtryck, lungor, bentäthet) Kliniskt kemiska analyser t ex blodfeper Livss.l (diet, socioeconomi, fysisk ak.vitet) Analyser av gene.sk varia.on

14 Varför studera blodfeper? Kolesterol en av de vanligaste kliniska analyserna och en indikator för risk ap utveckla hjärt- kärlsjukdomar. - LDL kolesterol (low density lipoprotein cholesterol) det dåliga kolesterolen - HDL kolesterol (high denisty lipoprotein cholesterol) det goda kolesterolen Både miljömässiga och ärlliga faktorer bidrar.ll kolesterolnivån

15 Kolesterol 6,2 6 5,8 Kolesterol (män) Kolesterol (kvinnor) 5,6 5,4 5,2 5 4,8 Sverige Kroatien Italien Storbritannien Nederländerna

16 FADS enzymernas funk.on

17 FADS enzymernas funk.on

18 Två olika gene.ska varianter av FADS generna; A = ancestral, D=derived SNP Freq. (percent) Assoc Haplotype Tot High Low Pval D CCCTCGTTAATCTTAAAAACCACCCTAG e-65 A AGTCGACCGGCTCCGGGGGTTGAAAAGA e-52 M1 CGTCCGCCGGTCTTGGAGGTTGAAAAGA e-04 M2 AGTCGACCGGCTCCGGGGGTTGACAAGA e-02 M3 AGTCGACCGGTTCCGGGGGTTGAAAAGA e-01 M4 CCCTCGTTAATCTTAAAAACCAAAAAGA e

19 FADS D varianten ökar syntesen av Omega 3 och 6

20 FADS D varianten finns bara hos människan D för Derived (red), A för Ancestral (blue)

21 FADS D varianten uppkom för 250 kya FADS1 FADS2 low hz 30 kb region Chimpanzee vs. hg muta.on/bp/genera.on Haplotypen DD hos Afrikaner Haplotype AA hos Paleo- Eskimo & Aborigin från Australien 600 kya 250 kya

22 FADS D varianten har selekterats för

23 Geografiska fördelningen of FADS varianterna Hypotes: D uppkom i Afrika och när de första grupperna av moderna människor lämnade Afrika tog de med sig både A och D. Selek.onen för D fortsape i Afrika,.lls dagens situa.on när det endast finns D. De grupper som vandrade in i Amerika hade inte med sig D varianten.

24 Summering De två FADS- variaterna är olika effek.va för ap synte.sera PUFAs. Den effek.va varianten (D) finns endast hos den moderna människan. Varianten uppkom för cirka år sedan i Afrika och har varit under posi.v selek.on. Idag är den effek.va varianten dominerande i Afrika, finns i hög frekvens i Europa och Asien, men inte alls i Amerika.

25 Summering D ger en överlevnadsfördel när.llgången.ll PUFAs är begränsad, som under människans utveckling. Den västerländska dieten har ändrats från ep förhållande mellan Omega 6:Omega 3 om 1:1,.ll 20:1. Ökad Omega 6 (AA) som är starkt proinflammatorisk. D varianten ökar risken för hjärt- kärlsjukdom, och är en thrily genotype = gene.sk faktor som en gång varit posi.v ap ha men som med överskop på energi och fep nu ökar risken ap bli sjuk.

26

27 Metabolic pathways of omega-6 and omega-3 fatty acids AA FADS DHA

28 Medical relevance Tradi.onal diet of some na.ve popula.ons is rich in Omega 3 and Omega 6, but the diet transi.on means less intake of PUFAs and therefore an increased risk of deficiency. In the last 150 years the average Western diet has changed from a Omega 6: Omega 3 ra.on of 1:1 ra.o to an es.mated 20:1. The D haplotype may act as a thrily genotype and represent a risk factor for life- style related diseases.

29 Medical relevance FADS genotypes associated with inflamma.on and coronary artery disease. Carriers of FADS D haplotype prone to a proinflammatory response favoring atherosclero.c vascular damage. Mar$nelli et al. Am J Clin Nutr Oct;88(4): Differences in FADS gene variants in African Americans and European Americans with diabetes or the metabolic syndrome. A gene.c risk factor contribu.ng to health dispari.es between popula.ons of African and European descent. Sergeant et al. Br J Nutr Feb;107(4):

30 Medical relevance Total cholesterol, HDL, LDL and triglyceride are influenced by the FADS genotype already in 10 year old children. Gene.cally determined blood lipid levels during childhood predispose development of cardiovascular diseases. Standl et al, for the GINIplus Study Group and LISAplus Study Group PLOS ONE 2012

31 LC- PUFA and cogni.ve func.on " Mice exposed to a diet rich in omega- 6 PUFAs during gesta.on display anxiety- like behavior. Prenatal diet rich in omega- 6 PUFAs result in classic features of au.sm. Maternal diet rich in omega-6 polyunsaturated fatty acids during gestation and lactation produces autistic-like sociability deficits in adult offspring. Jones et al, Behavioural Brain Research, The ra.o between maternal dietary n6 and n3 (LC)PUFA intake influences the childs brain development during fetal life,. The Dietary n6:n3 FaYy Acid Ra$o during Pregnancy Is Inversely Associated with Child Neurodevelopment. Bernard,et al and the EDEN Mother- Child Cohort Study Group. The Journal of Nutri$on " "

Fetter och kolesterol hur gamla missförstånd lever vidare. Ralf Sundberg Kirurg, docent, författare

Fetter och kolesterol hur gamla missförstånd lever vidare. Ralf Sundberg Kirurg, docent, författare Fetter och kolesterol hur gamla missförstånd lever vidare Ralf Sundberg Kirurg, docent, författare Organpreservation Kroppstemperatur 37 C, 3-4 nm Fosfolipidernas sammansättning 45% mättade fettsyror i

Läs mer

Är det nyttigt med fet mat?

Är det nyttigt med fet mat? Är det nyttigt med fet mat? Forskningens dag Falun 151008 David Iggman ST-läkare Norslund/Svärdsjö VC Centrum för Klinisk Forskning Dalarna, Falun Klinisk Nutrition och Metabolism, Uppsala Universitet

Läs mer

Efalex Mor & Barn. Omega-3 med hög koncentration av DHA för gravida och ammande!

Efalex Mor & Barn. Omega-3 med hög koncentration av DHA för gravida och ammande! Efalex Mor & Barn Omega-3 med hög koncentration av DHA för gravida och ammande! Särskilt DHA behövs för att fostret ska utvecklas optimalt, bland annat när det gäller motorik, minnesfunktion och kognitiv

Läs mer

Stillasittande & ohälsa

Stillasittande & ohälsa Stillasittande & ohälsa FaR:s dag att skapa möjligheter till fysisk aktivitet 19 november Malmö Johan Faskunger Fil dr Fysisk aktivitet & hälsovetenskap Föreläsningens upplägg: Stillasittande & ohälsa

Läs mer

Barnkliniker Universitetskliniker

Barnkliniker Universitetskliniker Vi har aldrig varit så många Vi representerar idag 57 registrerande enheter! 32 21 4 BUMMAR Barnkliniker Universitetskliniker BORIS Styrgrupp 2014 Jovanna Dahlgren läkare Göteborg Pernilla Danielsson ssk

Läs mer

Plasma fa(y acids and treatment response

Plasma fa(y acids and treatment response Study 2. Results Plasma fa(y acids and treatment response For the whole group, no significant correla:on could be found between the degree of improvement in ADHD Ra:ng Scale scores and the degree of change

Läs mer

THE SALUT PROGRAMME A CHILD HEALTH INTERVENTION PROGRAMME IN SWEDEN. ISSOP 2014 Nordic School of Public Health. Gothenburg SWEDEN UMEÅ UNIVERSITY

THE SALUT PROGRAMME A CHILD HEALTH INTERVENTION PROGRAMME IN SWEDEN. ISSOP 2014 Nordic School of Public Health. Gothenburg SWEDEN UMEÅ UNIVERSITY THE SALUT PROGRAMME A CHILD HEALTH INTERVENTION PROGRAMME IN SWEDEN UMEÅ UNIVERSITY VÄSTERBOTTEN COUNTY COUNCIL Epidemiology and Global Health Strategic Development Office Public Health Unit ANNELI IVARSSON

Läs mer

Är de officiella kostråden felaktiga? Fredrik Nyström professor i internmedicin

Är de officiella kostråden felaktiga? Fredrik Nyström professor i internmedicin Är de officiella kostråden felaktiga? Fredrik Nyström professor i internmedicin Look AHEAD studien Long Term Effects of a Lifestyle Intervention on Weight and Cardiovascular Risk Factors in Individuals

Läs mer

Fredrik Sjödin Institutionen för psykologi Epost: fredrik.sjodin@umu.se

Fredrik Sjödin Institutionen för psykologi Epost: fredrik.sjodin@umu.se Fredrik Sjödin Epost: fredrik.sjodin@umu.se SAMHÄLLSBULLER - AGENDA 1. Kort info om exponering och störning 2. Hälsoeffekter 3. Kostnader 4. Åtgärder kostnad/vinst SAMHÄLLSBULLER BAKGRUND Buller omger

Läs mer

Att utveckla allergi en fråga om risk, frisk eller fiskfaktorer? Fettsyra metabolism

Att utveckla allergi en fråga om risk, frisk eller fiskfaktorer? Fettsyra metabolism Att utveckla allergi en fråga om risk, frisk eller fiskfaktorer? Allergistämman, Göteborg 2012 Karel Duchén Docent, Barnallergolog. Barn och ungdomskliniken Universitetssjukhuset i Linköping Fettsyra metabolism

Läs mer

Obesity Trends* Among U.S. Adults BRFSS, 1985

Obesity Trends* Among U.S. Adults BRFSS, 1985 Obesity Trends* Among U.S. Adults BRFSS, 1985 (*BMI 30, or ~ 30 lbs overweight for 5 4 person) No Data

Läs mer

Måltidersättning och viktreduktion

Måltidersättning och viktreduktion Stockholms Obesitasdagar 12-13 maj 2011 Måltidersättning och viktreduktion Anna Hägg Leg. Dietist Överviktscentrum Definitoner av och regler kring Livsmedel för viktminskning Studier om måltidsersättning

Läs mer

Omega-3, självproducerat eller via dieten? Anders Jacobsson Stockholms Universitet

Omega-3, självproducerat eller via dieten? Anders Jacobsson Stockholms Universitet Omega-3, självproducerat eller via dieten? Anders Jacobsson Stockholms Universitet DU BLIR VAD DU ÄTER!? World Consumption of Oils and Fats (FAO) World consumption of oils and fats has grown steadily during

Läs mer

2013-10- 08. Slutsatser om livsmedel, drycker, koster- barnperspek=v. Slutsatser rörande råd om STATENS BEREDNING FÖR MEDICINSK UTVÄRDERING

2013-10- 08. Slutsatser om livsmedel, drycker, koster- barnperspek=v. Slutsatser rörande råd om STATENS BEREDNING FÖR MEDICINSK UTVÄRDERING 2013-10- 08 STATENS BEREDNING FÖR MEDICINSK UTVÄRDERING Sidfot Slutsatser om livsmedel, drycker, koster- barnperspek=v Carl- Erik Flodmark Mat vid fetma Slutsatser rörande råd om Viktnedgång hos barn och

Läs mer

Mat från havet ska göra oss friskare

Mat från havet ska göra oss friskare Mat från havet ska göra oss friskare Institutionen för Kemi och Bioteknik Chalmers Tekniska Högskola Utmaningar Sjukdomar associerade med felnäring (fetma och kostrelaterade sjukdomar) prevention i form

Läs mer

Protein en livsviktig byggsten

Protein en livsviktig byggsten Protein en livsviktig byggsten Ingvar Bosaeus Enheten för klinisk nutrition Sahlgrenska universitetssjukhuset Göteborg KSLA 2015-02-19 Aminosyra Alpha Amino- grupp Fredrik Bertz Karboxyl- grupp 20 aa

Läs mer

BALANSEN MELLAN OMEGA 3

BALANSEN MELLAN OMEGA 3 BALANSEN MELLAN OMEGA 3 OCH OMEGA 6 1 Kroniska inflammationer i det moderna samhället BALANSERA DIN HÄLSA 2 Balansen mellan omega-6 och omega-3 Varje cell i kroppen och cellorganellerna är omgivna av ett

Läs mer

Nytt i Nya Nordiska Näringsrekommendationerna

Nytt i Nya Nordiska Näringsrekommendationerna Nytt i Nya Nordiska Näringsrekommendationerna Mikael Fogelholm, professor i näringslära Helsingfors universitet Institutionen för livsmedel- och miljövetenskaper Faculty of Agriculture and Forestry Department

Läs mer

Inkvarteringsstatistik. Göteborg & Co. Februari 2012

Inkvarteringsstatistik. Göteborg & Co. Februari 2012 Inkvarteringsstatistik Göteborg & Co Februari 2012 FoU/ Marknad & Försäljning Gästnätter storstadsregioner Februari 2012, hotell och vandrarhem Gästnattsutveckling storstadsregioner Februari 2012, hotell

Läs mer

Hälsoproblem. Graviditetsstörning 2014-02-24. Hälsoproblem hos skiftarbetare

Hälsoproblem. Graviditetsstörning 2014-02-24. Hälsoproblem hos skiftarbetare Hälsoproblem hos skiftarbetare Anders Knutsson Arbets- och miljömedicin, Sundsvall Umeå 17 februari 2014 Hälsoproblem Sömnproblem, trötthet, olycksfall Graviditetsstörning Magtarmbesvär Hjärt-kärl sjukdom

Läs mer

Vad vet vi om animaliska livsmedel?

Vad vet vi om animaliska livsmedel? Department of Food Science Vad vet vi om animaliska livsmedel? särskilt fokus på fettsammansättning Jana Pickova Institutionen för livsmedelsvetenskap; SLU DHA i maten har minskat Kyle and Arterburn, 1998

Läs mer

Carotid Artery Wall Layer Dimensions during and after Pre-eclampsia An investigation using non-invasive high-frequency ultrasound

Carotid Artery Wall Layer Dimensions during and after Pre-eclampsia An investigation using non-invasive high-frequency ultrasound Carotid Artery Wall Layer Dimensions during and after Pre-eclampsia An investigation using non-invasive high-frequency ultrasound Studie I-IV I. Increased carotid intima thickness and decreased media thickness

Läs mer

Vi är inte vegetarianer

Vi är inte vegetarianer Kapitel 8 Vi är inte vegetarianer Matsmältningsapparaten Växtätare får hjälp av mikroorganismer med att sönderdela cellulosans sockerkedjor. Idisslare förjäser cellulosan i en stor vom, hästen och gnagarna

Läs mer

Amning del 2 Bröstmjölk Modersmjölksersättning April 2015. Cecilia Hedström, leg dietist Centrala barnhälsovården Göteborg och S Bohuslän.

Amning del 2 Bröstmjölk Modersmjölksersättning April 2015. Cecilia Hedström, leg dietist Centrala barnhälsovården Göteborg och S Bohuslän. Amning del 2 Bröstmjölk Modersmjölksersättning April 2015 Cecilia Hedström, leg dietist Centrala barnhälsovården Göteborg och S Bohuslän. Amning Minskar risk för (grade 1): - Mag- och tarminfektioner -

Läs mer

Kolesterol på gott & ont

Kolesterol på gott & ont Undvik fett så går du ner i vikt och slipper sjukdom! Ät mer fett så går du ner i vikt och håller dig frisk! Kolesterol på gott & ont Vilka olika fetter finns i kroppen Fosfolipider Fosfat med två fettsyror

Läs mer

Stroke. Trombocythämning och antikoagulantia efter stroke. - en folksjukdom! Per Wester, Umeå Strokecenter

Stroke. Trombocythämning och antikoagulantia efter stroke. - en folksjukdom! Per Wester, Umeå Strokecenter 1 Trombocythämning och antikoagulantia efter stroke Per Wester, Umeå Strokecenter STROKE - vilka läkemedel kan förhindra återinsjuknande och hur effektiva är de? Läkemedelskommittén Örebro Läns Landsting

Läs mer

På professorns tallrik så ska vi äta enligt forskare och myndigheter

På professorns tallrik så ska vi äta enligt forskare och myndigheter På professorns tallrik så ska vi äta enligt forskare och myndigheter Mai-Lis Hellénius, professor, Karolinska Institutet Överläkare, Livsstilsmottagningen, Hjärtkliniken, Karolinska Universitetssjukhuset,

Läs mer

Den framtida redovisningstillsynen

Den framtida redovisningstillsynen Den framtida redovisningstillsynen Lunchseminarium 6 mars 2015 Niclas Hellman Handelshögskolan i Stockholm 2015-03-06 1 Källa: Brown, P., Preiato, J., Tarca, A. (2014) Measuring country differences in

Läs mer

2013-10- 08 STATENS BEREDNING FÖR MEDICINSK UTVÄRDERING. Råd om mat vs. fakoskt intag ramverk för tolkning av slutsatser om koster

2013-10- 08 STATENS BEREDNING FÖR MEDICINSK UTVÄRDERING. Råd om mat vs. fakoskt intag ramverk för tolkning av slutsatser om koster STATENS BEREDNING FÖR MEDICINSK UTVÄRDERING MAT VID FETMA EN SYSTEMATISK LITTERATURÖVERSIKT, 2013 SLUTSATSER OM KOSTER Hot Topic- seminarium 25 september 2013 Swedish NutriOon FoundaOon/ Göteborgs Universitet

Läs mer

TRÄNING, KOSTHÅLLNING OCH ANTI AGE LIGGER I TIDEN

TRÄNING, KOSTHÅLLNING OCH ANTI AGE LIGGER I TIDEN 2/12 3/12 01 TRÄNING, KOSTHÅLLNING OCH ANTI AGE LIGGER I TIDEN Hur kommer det sig att en rad kroniska sjukdomar som hjärt- och kärlsjukdomar, diabetes typ 2 och fetma bara ökar? Studier visar att en balans

Läs mer

Hälsoeffekter av fibrer och fullkorn olika studier olika svar? 1. Råg faktorn

Hälsoeffekter av fibrer och fullkorn olika studier olika svar? 1. Råg faktorn 2013-11- 21 Hälsoeffekter av fibrer och fullkorn olika studier olika svar? 1. Råg faktorn 1 Rye products in the diabe8c diet. Postprandial glucose and hormonal responses in non- insulin- dependent diabe8c

Läs mer

Diabetes Hur kan vi förebygga typ 2 diabetes?

Diabetes Hur kan vi förebygga typ 2 diabetes? Diabetes Hur kan vi förebygga typ 2 diabetes? Föreläsning vid öppet hus på KI den 30 augusti 2014 Kerstin Brismar Professor, överläkare Karolinska Universitetssjukhuset-Sophiahemmet Inst för Medicin och

Läs mer

Stiftelsen Allmänna Barnhuset KARLSTADS UNIVERSITET

Stiftelsen Allmänna Barnhuset KARLSTADS UNIVERSITET Stiftelsen Allmänna Barnhuset KARLSTADS UNIVERSITET National Swedish parental studies using the same methodology have been performed in 1980, 2000, 2006 and 2011 (current study). In 1980 and 2000 the studies

Läs mer

Professor Göran Petersson augusti 2013 Kemi- och Bioteknik, Chalmers Publikationslista. MJÖLKFETT CHARKFETT Fiskfetter rätt omega-3

Professor Göran Petersson augusti 2013 Kemi- och Bioteknik, Chalmers Publikationslista. MJÖLKFETT CHARKFETT Fiskfetter rätt omega-3 Professor Göran Petersson augusti 2013 Kemi- och Bioteknik, Chalmers Publikationslista MJÖLKFETT CHARKFETT Fiskfetter rätt omega-3 Olivolja Kokosolja Rapsolja Palmolja Fleromättade Fröfetter farligt omega-6

Läs mer

Fysisk aktivitet och påverkan på prestation på olika sätt genetiska förutsättningar och vad händer med hjärnan?

Fysisk aktivitet och påverkan på prestation på olika sätt genetiska förutsättningar och vad händer med hjärnan? 2015-03-20 Fysisk aktivitet och påverkan på prestation på olika sätt genetiska förutsättningar och vad händer med hjärnan? Jessica Norrbom PhD, Forskare Institutionen för Fysiologi & Farmakologi, Karolinska

Läs mer

Liv & hälsa Ung Västmanland

Liv & hälsa Ung Västmanland Liv & hälsa Ung Västmanland E3 kunskapsunderlag om ungas hälsa Visst berör det tandvården? Tandläkare Klinikchef Folktandvården Samverkan - primärvård barnhälsovård beställare tandvård barn som riskerar

Läs mer

6 februari 2013. Soffia Gudbjörnsdottir Registerhållare NDR

6 februari 2013. Soffia Gudbjörnsdottir Registerhållare NDR 6 februari 2013 Soffia Gudbjörnsdottir Registerhållare NDR NDR utveckling sedan 1996 Verktyg i förbättringsarbetet Mer än 1200 enheter online 2012 Nationella riktlinjer 100% av sjukhusklinikerna Kvalitetskontroll

Läs mer

Fettets kvalitet. viktigare än mängden

Fettets kvalitet. viktigare än mängden Konferens: Essential Fats for Future Health Fettets kvalitet viktigare än mängden Fettsyror är en energikälla, men har också många andra viktiga funktioner i kroppen. De kan till exempel påverka immunförsvaret,

Läs mer

FACIT. Sant. eller. falskt? Här har du svaren.

FACIT. Sant. eller. falskt? Här har du svaren. FACIT Sant eller falskt? Här har du svaren. 1 2 3 En deciliter havregryn väger 35 gram och ger därmed 35 gram fullkorn. Sant Havregryn framställs av hela havrekorn och är därmed till 100% fullkorn. Jag

Läs mer

Peik Gustafsson, Nóra Kerekes, Henrik Anckarsäter, Paul Lichtenstein, Christopher Gillberg, Maria Råstam

Peik Gustafsson, Nóra Kerekes, Henrik Anckarsäter, Paul Lichtenstein, Christopher Gillberg, Maria Råstam . Motorik och percep,on vid ADHD, au,sm och uppförandestörning hos barn Ar#kel i Journal of Neurodevelopmental Disorders: 2014, 6(1):11:1-10 Motor func#on and percep#on in children with neuropsychiatric

Läs mer

Spelar det någon roll vilka fetter vi äter? Ralf Sundberg Docent i transplantationskirurgi

Spelar det någon roll vilka fetter vi äter? Ralf Sundberg Docent i transplantationskirurgi Spelar det någon roll vilka fetter vi äter? Ralf Sundberg Docent i transplantationskirurgi Ancel Keys 1952 Strictly nutritional evidence points to a small need for dietary fats as such. In human diets,

Läs mer

Fysisk aktivitet och träning vid övervikt och fetma, vilka effekter nås?

Fysisk aktivitet och träning vid övervikt och fetma, vilka effekter nås? Fysisk aktivitet och träning vid övervikt och fetma, vilka effekter nås? Anita Wisén Forskargruppen sjukgymnastik Institutionen för hälsa, vård och samhälle Vad är fysisk aktivitet och träning? Intensitet

Läs mer

Läkemedel nytta och risker hos äldre

Läkemedel nytta och risker hos äldre Läkemedel nytta och risker hos äldre Arne Melander Professor emeritus Klinisk Farmakologi och Läkemedelsepidemiologi, Lunds universitet Läkemedelssakkunnig SPF (F d Överläkare Klinisk farmakologi, Malmö

Läs mer

SSRI till Barn och Ungdomar vid Depression Var står vi idag? Anne-Liis von Knorring Stockholm 1 april 2009

SSRI till Barn och Ungdomar vid Depression Var står vi idag? Anne-Liis von Knorring Stockholm 1 april 2009 SSRI till Barn och Ungdomar vid Depression Var står vi idag? Anne-Liis von Knorring Stockholm 1 april 2009 Recent advances in depression across the generations Weissman et al, Arch Gen Psychiatry 2007;62,

Läs mer

Viktig, ung och stolt. Göteborg 080515.

Viktig, ung och stolt. Göteborg 080515. Viktig, ung och stolt. Göteborg 080515. Övervikt och fetma i Sverige För tio år sedan var en av tio svenska sjuåringar överviktig Idag har minst var fjärde sjuåring övervikt Prognos; Åtta av tio förblir

Läs mer

Carl von Linné, år 1733:

Carl von Linné, år 1733: Carl von Linné, år 1733: Hwad är kiärare än lifwet, liufware än hälsan Kunglig macht och konst äro intet mot hälsan Skaparen har intet fehl, han har gifwit meniskian en kropp, som lefwa kan längre än något

Läs mer

Efalex. Hälsa för hjärna och ögon

Efalex. Hälsa för hjärna och ögon Efalex Hälsa för hjärna och ögon Hälsa för hjärna och ögon med omega-3 Essentiella fettsyror är livsnödvändiga för vår hälsa. Vi kan inte tillverka de själva, utan de måste tillföras via vår kost. Fettsyror

Läs mer

Pressinformation. Fakta om omega-3

Pressinformation. Fakta om omega-3 Pressinformation Fakta om omega-3 Livsviktiga fettsyror Fett är livsnödvändigt. Det finns olika typer av fettsyror (fett) och de har alla viktiga funktioner att fylla i kroppen, som att bygga upp och reparera

Läs mer

Forskning Formar Framtiden

Forskning Formar Framtiden 2 3 1 4 5 Forskning Formar Framtiden DGA:s utbildningsvecka 2010 Maria Strandberg maria.strandberg@golf.se Utmaningar Klimatförändringar Begränsade naturresurser Lagar och restriktioner Opinion och politiskt

Läs mer

Hundar hjälper oss att förstå människans sjukdomar. Kerstin Lindblad-Toh

Hundar hjälper oss att förstå människans sjukdomar. Kerstin Lindblad-Toh Hundar hjälper oss att förstå människans sjukdomar Kerstin Lindblad-Toh Målsättning med min forskning Att hitta människors sjukdomsgener via: - djurmodeller - en bättre förståelse av arvsmassan - storskalig

Läs mer

Jonkanalsjukdomar: från diagnos 3ll bedömning av risk för plötslig död. Pyotr Platonov Stockholm, Lund, Umeå

Jonkanalsjukdomar: från diagnos 3ll bedömning av risk för plötslig död. Pyotr Platonov Stockholm, Lund, Umeå Jonkanalsjukdomar: från diagnos 3ll bedömning av risk för plötslig död Pyotr Platonov Stockholm, Lund, Umeå 2014 Braunwald s Heart Disease, 9 th edi;on, Elsevier Saunders, 2012 LQTS: vad är det?! Förlängd

Läs mer

Maria Bäck, Göteborg. Rörelserädsla. Ett hinder för lyckad hjärtrehabilitering?

Maria Bäck, Göteborg. Rörelserädsla. Ett hinder för lyckad hjärtrehabilitering? Kardiovaskulära Vårmötet XIVSvenska 25-27 april, 2012, Stockholm Maria Bäck, Göteborg Rörelserädsla Ett hinder för lyckad hjärtrehabilitering? Sahlgrenska Akademin, Institutionen för Medicin, Göteborgs

Läs mer

Vad kan vi lära oss av posi/v psykologi?

Vad kan vi lära oss av posi/v psykologi? Vad kan vi lära oss av posi/v psykologi? Arbets- och miljö medicinskt vårmöte Uppsala 140410 Lo8a Wallin, Utbildare, handledare, Skövde Högskola PhD student. Organiza/onal health and wellbeing, Lancaster

Läs mer

Omega-3 från fiskolja är viktigt för en bra start i livet

Omega-3 från fiskolja är viktigt för en bra start i livet Omega-3 från fiskolja är viktigt för en bra start i livet Intervju med Dr Alex Richardson, verksam vid universitetet i Oxford, på Food and Behaviour Research (FAB), Inverness, Skottland (www.fabresearch.org

Läs mer

Smoltpro- Malin Rosengren-Göteborgs Universitet

Smoltpro- Malin Rosengren-Göteborgs Universitet Smoltpro- Malin Rosengren-Göteborgs Universitet SMOLTPRO- Aim - Research on sustainable smolt production - Develop ecologically and ethically sound methods for supplementary rearing of salmonids Kompensationsodlad

Läs mer

Klinisk kemisk diagnos.k

Klinisk kemisk diagnos.k Klinisk kemisk diagnos.k Introduk.on Johan Malm professor/överläkare i klinisk kemi inst f transla.onell medicin Lunds universitet Skånes universitetssjukhus Malmö Man, 63 år söker inkommer med ambulans.ll

Läs mer

Utblick luft, miljö och hälsa. Lars Modig Yrkes- och miljömedicin, Umeå Universitet

Utblick luft, miljö och hälsa. Lars Modig Yrkes- och miljömedicin, Umeå Universitet Utblick luft, miljö och hälsa Lars Modig Yrkes- och miljömedicin, Umeå Universitet Disposition Riskfaktorer för folkhälsa globalt Luftföroreningar, ett hälsoproblem på global och Europeisknivå Vilka hälsoeffekter

Läs mer

Miniprojektet. Catarina Almqvist Malmros

Miniprojektet. Catarina Almqvist Malmros Miniprojektet Catarina Almqvist Malmros Barnläkare och docent Astrid Lindgrens barnsjukhus och Institutionen för medicinsk epidemiologi och biostatistik (MEB) Mini project "Upptakten" VetU te 1 Läkarprogrammet

Läs mer

Barnets rätt till hälsa och välfärd

Barnets rätt till hälsa och välfärd Barnets rätt till hälsa och välfärd på vilket sätt är det viktigt och lönsamt? Ingemar Kjellmer Centrum för barns rätt till hälsa Drottning Silvias barn- och ungdomssjukhus Kunskapscentrum för Barnkonventionen

Läs mer

Inkvarteringsstatistik. Göteborg & Co

Inkvarteringsstatistik. Göteborg & Co Inkvarteringsstatistik Göteborg & Co Mars 2012 FoU/ Marknad & Försäljning Gästnätter storstadsregioner Mars 2012, hotell och vandrarhem Gästnattsutveckling storstadsregioner Mars 2012, hotell och vandrarhem

Läs mer

SWEDIABKIDS, hjälp i förbättringsarbete Resultat 2010

SWEDIABKIDS, hjälp i förbättringsarbete Resultat 2010 SWEDIABKIDS, hjälp i förbättringsarbete Resultat 2010 Ulf Samuelsson HbA1c, mmol/mol HbA1c år 2010 för pojkar resp.flickor med insulinbehov >0,5 E/kg 75 70 65 60 Flickor Pojkar 55 50 1 2 3 4 5 6 7

Läs mer

Barn och ungdomars Vitamin D-status

Barn och ungdomars Vitamin D-status Barn och ungdomars Vitamin D-status vid inskrivning på Rikscentrum Barnobesitas Kerstin Ekbom Leg ssk, Med Dr Kort sammanfattning vitamin D Vitamin-D D2 (ergokalciferol, förekommer i vissa svampar) D3

Läs mer

Resande och det vardagliga livet

Resande och det vardagliga livet Resande och det vardagliga livet Lars E. Olsson Docent i psykologi SAMOT/CTF, Karlstads universitet @Lyckolars Olsson, L. E. Örebroregionens infrastruktur- och transportdag, 20/3 2015 SAMOT - Service och

Läs mer

Fakta om omega-3 och barn

Fakta om omega-3 och barn Pressinformation Fakta om omega-3 och barn intag, behov och effekter Omega-3-fettsyror Både läkare och forskare är eniga om att omega-3 är bra för hälsan. För att tillfredsställa kroppens behov av omega-3

Läs mer

Riskfaktorer för hjärtkärlsjukdom postpartum - betydelsen av viktnedgång under amning

Riskfaktorer för hjärtkärlsjukdom postpartum - betydelsen av viktnedgång under amning Riskfaktorer för hjärtkärlsjukdom postpartum - betydelsen av viktnedgång under amning Hilde Brekke, Docent Avd för invärtesmedicin och klinisk nutrition Göteborgs universitet, Sweden Bakgrund I epidemiologiska

Läs mer

Bakgrundsdata för studien i Kalmar Län

Bakgrundsdata för studien i Kalmar Län FÖLJS ÅLDERSGRUPPEN ÖVER 80 MED DIABETES ENLIGT NATIONELLA RIKTLINJER? ANN-SOFIE NILSSON-NEUMARK, DISTRIKTS & DIABETESSJUKSKÖTERSKA BLÅ KUSTENS HÄLSOCENTRAL OSKARSHAMN Andelen befolkning 80 år och äldre

Läs mer

Överviktskirurgi vem, hur och resultat?

Överviktskirurgi vem, hur och resultat? Överviktskirurgi vem, hur och resultat? Magnus Sundbom Ansvarig för obesitaskirurgi, VO Kirurgi, Akademiska sjukhuset, Uppsala Ordförande SOTEG Swedish Obesity Expert Treatment Group Antal överviktsingrepp

Läs mer

Skyddar bilirubin mot hjärtinfarkt och stroke?

Skyddar bilirubin mot hjärtinfarkt och stroke? Skyddar bilirubin mot hjärtinfarkt och stroke? Kim Ekblom Centrallasarettet Växjö Medicinsk biovetenskap, Klinisk kemi Umeå universitet 2011-10-13 Bilirubin Endogen antioxidant Variabiliteten en av de

Läs mer

Epidemiologi och riskfaktorer. Kan man förebygga demens?

Epidemiologi och riskfaktorer. Kan man förebygga demens? Epidemiologi och riskfaktorer. Kan man förebygga demens? Ingmar Skoog professor i psykiatrisk epidemiologi Enheten för Neuropsykiatrisk epidemiologi Institutionen för Neurovetenskap och fysiologi Sahlgrenska

Läs mer

DINA LEVNADSVANOR DU KAN GÖRA MYCKET FÖR ATT PÅVERKA DIN HÄLSA

DINA LEVNADSVANOR DU KAN GÖRA MYCKET FÖR ATT PÅVERKA DIN HÄLSA DINA LEVNADSVANOR DU KAN GÖRA MYCKET FÖR ATT PÅVERKA DIN HÄLSA FYSISK AKTIVITET Fysiskt aktiva individer löper lägre risk att drabbas av bland annat benskörhet, blodpropp, fetma och psykisk ohälsa. Källa:

Läs mer

BILAGA III Resultat årsrapport 2013 Fosterdiagnos9kregistret

BILAGA III Resultat årsrapport 2013 Fosterdiagnos9kregistret BILAGA III Resultat årsrapport 2013 Fosterdiagnos9kregistret 1 Resultat Stockholms Län Enskilda enheter 2 1 Period 1 sep 2006 30 Juni 2013 Karolinska universitetssjukhuset; Solna (n= 7700) + Huddinge (n=

Läs mer

Björn Kadesjö.Glädje och utmaningar generellt föräldrastöd

Björn Kadesjö.Glädje och utmaningar generellt föräldrastöd Abstract till presentationerna den 22 oktober. Björn Kadesjö.Glädje och utmaningar generellt föräldrastöd Många föräldrar i stadsdelen Angered i Göteborg har i kontakt med förskolan uttryckt osäkerhet

Läs mer

FISKLEVEROLJA - Traditionellt skandinaviskt kosttillskott med besk bismak

FISKLEVEROLJA - Traditionellt skandinaviskt kosttillskott med besk bismak FISKLEVEROLJA - Traditionellt skandinaviskt kosttillskott med besk bismak Av: Sofia Artursson, Akupunkturakademin 2008. Kort historik Intresset för fiskleveroljans hälsosamma effekter ökade i samband med

Läs mer

ProViva ett levande livsmedel. Siv Ahrné Laboratoriet för f r livsmedelshygien, Institutionen för f r Livsmedelsteknik, Lunds Universitet

ProViva ett levande livsmedel. Siv Ahrné Laboratoriet för f r livsmedelshygien, Institutionen för f r Livsmedelsteknik, Lunds Universitet ProViva ett levande livsmedel Siv Ahrné Laboratoriet för f r livsmedelshygien, Institutionen för f r Livsmedelsteknik, Lunds Universitet Fermenterad havre för f enteral nutrition Startade 1987 Motverka

Läs mer

Inflammation är en grundläggande del av livet. Det inflammatoriska svaret, som ligger

Inflammation är en grundläggande del av livet. Det inflammatoriska svaret, som ligger VETENSKAPLIG SAMMAN- FATTNING AV TESTET FÖR HJÄRTHÄLSA Inledning: Inflammation är en grundläggande del av livet. Det inflammatoriska svaret, som ligger bakom rodnad, värme, svullnad och smärta runt exempelvis

Läs mer

Fysisk Aktivitet och KOL

Fysisk Aktivitet och KOL Fysisk Aktivitet och KOL Mattias Damberg, Docent, Hjärtkliniken, Karolinska Institutet, KS Solna Specialist i Allmänmedicin, CityPraktiken, Västerås Västerås 2012-04-19 Samarbete Öka självupplevd hälsa

Läs mer

Klimatförtroendebarometern Så tycker folket 2012

Klimatförtroendebarometern Så tycker folket 2012 Klimatförtroendebarometern Så tycker folket 2012 Sifo undersökning, beställd av Hagainitiativet, om svenska folkets syn företags klimatinformation och deras trovärdighet (juni 2012) BAKGRUND Hagainitiativet

Läs mer

Ger socker typ 2-diabetes?

Ger socker typ 2-diabetes? Ger socker typ 2-diabetes? Emily Sonestedt, PhD Lunds Universitet SNF 2015-04- 20 Diabetesepidemin! 382 miljoner individer i världen har diabetes! 8,3% av den vuxna befolkningen! Antalet har dubblerats

Läs mer

Fettsyror för den vetgirige

Fettsyror för den vetgirige Fettsyror för den vetgirige Innehåll Introduktion... 3 Fettsyror... 3 Mättade fettsyror... 3 Myristinsyra... 4 Palmitinsyra... 4 Stearinsyra... 4 Arakinsyra... 5 Behensyra... 5 Lignocerinsyra... 5 Omega

Läs mer

Skillnader i folkhälsa hur ser det ut i Sverige i dag? Johan Carlson, generaldirektör Folkhälsomyndigheten

Skillnader i folkhälsa hur ser det ut i Sverige i dag? Johan Carlson, generaldirektör Folkhälsomyndigheten Skillnader i folkhälsa hur ser det ut i Sverige i dag? Johan Carlson, generaldirektör Folkhälsomyndigheten Skillnader i folkhälsa hur kan vi förklara hälsoklyftorna? Medellivslängden år Sid 2. Sjukdomsutfall

Läs mer

Psykisk hälsa och ohälsa ibland elever i särskolan. Petra Boström Göteborgs universitet 2015-04-21

Psykisk hälsa och ohälsa ibland elever i särskolan. Petra Boström Göteborgs universitet 2015-04-21 Psykisk hälsa och ohälsa ibland elever i särskolan Petra Boström Göteborgs universitet 2015-04-21 Agenda Hur mäter vi psykisk hälsa bland barn med intellektuella funktionsnedsättningar? Hur mår barn och

Läs mer

Typ 1- diabetes i e; livslångt perspek>v hur arbetar vi förebyggande?

Typ 1- diabetes i e; livslångt perspek>v hur arbetar vi förebyggande? Typ 1- diabetes i e; livslångt perspek>v hur arbetar vi förebyggande? ÅKE LERNMARK LUNDS UNIVERSITETS DIABETESCENTRUM (LUDC) LUNDS UNIVERSITET /CRC MALMÖ The Environmental Determinants TEDDY STUDIENS MÅLSÄTTNING

Läs mer

Livsviktiga och livsfarliga fettsyror!

Livsviktiga och livsfarliga fettsyror! TREE Livsstilsdesign Tree Livsstilsdesign 23 oktober 2014 Livsviktiga och livsfarliga fettsyror En guide till att välja bra fetter och omega3 tillskott Omega3 och omega6 är olika fleromättade fettsyror

Läs mer

Har storleken betydelse?

Har storleken betydelse? Emma Carlén är utbildad Husdjursagronom. Hon har forskat inom ämnet husdjursgenek om hur man på bästa sä kan hia tjurar och kor som nedärver resistens mot juverinflammaon. Emma började på Svensk Mjölk

Läs mer

Fett, Dieter och Myter

Fett, Dieter och Myter Fett, Dieter och Myter Matvanor spelar roll Hjärt- och kärlsjukdom kan förebyggas med bra mat och inte för mycket alkohol (Ref: WHO,O Flaherty et al 2012) Upp till 30 procent av cancerfallen skulle kunna

Läs mer

PMS/PMDD. Inger Sundström Poromaa Dept of Women s and Children s Health Uppsala University

PMS/PMDD. Inger Sundström Poromaa Dept of Women s and Children s Health Uppsala University PMS/PMDD Inger Sundström Poromaa Dept of Women s and Children s Health Uppsala University Prevalence De barnafödande åren Humörbiverkan av p-piller Postpartum depression Barnlöshet kris Perimenopausal

Läs mer

Bo Selander Neonatalkliniken, Lund Bo.Selander@skane.se

Bo Selander Neonatalkliniken, Lund Bo.Selander@skane.se Bo Selander Neonatalkliniken, Lund Bo.Selander@skane.se EXPRESS Extremely Preterm Infant Study in Sweden Samtliga levande födda barn < graviditetsvecka 27 Dödfödda graviditetsvecka 22+0 26+6 1 april 2004

Läs mer

Hört och lärt på NES2012 Session: Visual ergonomics

Hört och lärt på NES2012 Session: Visual ergonomics Ergonomisektionen/LSR Hört och lärt på NES2012 Session: Visual ergonomics Frukostseminarie I samverkan med Mousetrapper 2 oktober, 2012 08.30-09.30 Susanne Glimne Leg. Optiker/Universitetsadjunkt Optikerprogrammet

Läs mer

AMOS (Adolescents Morbid Obesity Surgery study)

AMOS (Adolescents Morbid Obesity Surgery study) AMOS (Adolescents Morbid Obesity Surgery study) Carl-Erik Flodmark Barnöverviktsenheten Region Skåne Stockholm 18 mars 213 Vad var AMOS? Kirugisk interventionsstudie med svår fetma Syfte Finns det några

Läs mer

33:e Svenska perinatalmötet

33:e Svenska perinatalmötet Svensk Förening för Perinatalmedicin 33:e Svenska perinatalmötet 24-25 oktober, 2013 Svenska Läkaresällskapet Klara Östra Kyrkogata 10 Stockholm Preliminärt program Onsdag 24 oktober, kl 17-19 Årsmöte

Läs mer

Intag av mättat fett och risken att drabbas av hjärt- och kärlsjukdom

Intag av mättat fett och risken att drabbas av hjärt- och kärlsjukdom Intag av mättat fett och risken att drabbas av hjärt- och kärlsjukdom En litteraturstudie Tobias Jonsson GYMNASTIK- OCH IDROTTSHÖGSKOLAN Examensarbete 12: 2010 Hälsopedagogprogrammet: 2007-2010 Handledare:

Läs mer

2015-04-22. Syfte. Arbetslöshet vid ung ålder och samband med senare hälsa och arbete. Studiedesign. Studiedesign. Publicerade artiklar

2015-04-22. Syfte. Arbetslöshet vid ung ålder och samband med senare hälsa och arbete. Studiedesign. Studiedesign. Publicerade artiklar 5-- Syfte Arbetslöshet vid ung ålder och samband med senare hälsa och arbete Finns det samband mellan exponering för arbetslöshet och senare sjukfrånvaro, förtidspension, död och arbetslöshet, bland infödda

Läs mer

Laboratorienytt. Innehåll: 2 Klinisk kemi. - Apolipoprotein - Analys av Takrolimus under påskhelgen - Metodbyte. 8 Klinisk mikrobiologi

Laboratorienytt. Innehåll: 2 Klinisk kemi. - Apolipoprotein - Analys av Takrolimus under påskhelgen - Metodbyte. 8 Klinisk mikrobiologi Version 1.0 LABORATORIEMEDICIN Laboratorienytt Nr 6, mars 2013 Innehåll: 2 Klinisk kemi - Apolipoprotein - Analys av Takrolimus under påskhelgen - Metodbyte 8 Klinisk mikrobiologi - Remissinformation 9

Läs mer

Grav övervikt och knäproteskirurgi, ortopedens handlande för individ och samhälle. Roger Olsson, Östersund

Grav övervikt och knäproteskirurgi, ortopedens handlande för individ och samhälle. Roger Olsson, Östersund Grav övervikt och knäproteskirurgi, ortopedens handlande för individ och samhälle. Roger Olsson, Östersund OBESITAS OCH KNÄPROTESKIRURGI Extremt ökad risk för artros i knäled vid högre grader av obesitas.

Läs mer

Inkvarteringsstatistik. Göteborg & Co

Inkvarteringsstatistik. Göteborg & Co Inkvarteringsstatistik Göteborg & Co April 2012 FoU/ Marknad & Försäljning Gästnätter storstadsregioner April 2012, hotell och vandrarhem Gästnattsutveckling storstadsregioner April 2012, hotell och vandrarhem

Läs mer

Samband mellan diabetes och den fettsnåla kosten

Samband mellan diabetes och den fettsnåla kosten Samband mellan diabetes och den fettsnåla kosten Den fettsnåla kosten riskerar att göra oss fetare och sjukare Se artikeln nedan ur Independent News Runt om i världen uppmärksammas nu hur vi i värsta fall

Läs mer

2013-11-26. Evidensbaserade råd om hälsosam mat och vid fetma. Disposition. Dietary Guidelines for Americans, 2010

2013-11-26. Evidensbaserade råd om hälsosam mat och vid fetma. Disposition. Dietary Guidelines for Americans, 2010 2013-11-26 Disposition Vad ingår i hälsosam mat? Evidensbaserade råd om hälsosam mat och vid fetma Den aktuella evidensen - vilka effekter har denna mat på hälsan? Mat vid fetma en systematisk litteraturöversikt,

Läs mer

Tradi&onell kunskap om växter och naturbruk Hur dokumentera, bruka och skydda?

Tradi&onell kunskap om växter och naturbruk Hur dokumentera, bruka och skydda? Tradi&onell kunskap om växter och naturbruk Hur dokumentera, bruka och skydda? Håkan Tunón Centrum för biologisk mångfald Sveriges lantbruksuniversitet, Uppsala UN Conven&on on biological diversity ar&cle

Läs mer

Välj Bregott framför Becel för kärl och hjärta

Välj Bregott framför Becel för kärl och hjärta Göran Petersson Hälsodebatt Professor i Kemisk Miljövetenskap Januari 2006 Kemi- och Bioteknik, Chalmers 41296 Göteborg goranp@chalmers.se Välj Bregott framför Becel för kärl och hjärta - Myten att hjärt-kärlsjukdomar

Läs mer

Utmaningar vid långtidsbehandling efter akuta koronara syndrom Intressekonflikt: Arvode för föreläsning

Utmaningar vid långtidsbehandling efter akuta koronara syndrom Intressekonflikt: Arvode för föreläsning Utmaningar vid långtidsbehandling efter akuta koronara syndrom Intressekonflikt: Arvode för föreläsning Tomas Jernberg Karolinska Universitetssjukhuset Stockholm Disclaimer AstraZeneca is dedicated to

Läs mer