Datorer och matematik hjälper oss att motverka sjukdomar

Storlek: px
Starta visningen från sidan:

Download "Datorer och matematik hjälper oss att motverka sjukdomar"

Transkript

1 GA N AT ION ALCTAC ATCA G ENOMI CSGT INFR A S T RU CTURE Datorer och matematik hjälper oss att motverka sjukdomar Adam Ameur Bioinformatiker SciLifeLab Uppsala, 13e Maj 2014

2 Introduktion till bioinformatik Bioinforma)k - en tvärvetenskaplig disciplin där algoritmer för analys av biologiska data utvecklas Begreppet myntades 1979 Biologiska data har ökat enormt senaste decennierna Bioinformatiken blir allt viktigare Är idag ett stort forskningsområde

3 Vad är bioinformatik? Matema)k/Sta)s)k Utvecklar modeller Skriver program Datavetenskap Använder verktygen Molekylärbiologi

4 Analys av DNA-sekvenser

5 Sekvenseringsrevolutionen HUGO-Projektet ( ) Kartläggning av människans DNA Stort internationellt projekt Kostnad: > 1,000,000,000$ Idag (år 2014) Nästa Generationens Sekvensering (NGS) Kan göras inom en vecka På ett enda instrument Kostnad: drygt 1000$

6 Snabb ökning av DNA-sekvensprojekt h:p://www.ebi.ac.uk/ena/about/sta?s?cs

7 Sekvensutrustning inom SciLifeLab E" av de ins+tut med flest instrument i Europa!

8 Resurser för dataanalys UPPNEX/UPPMAX Superdator för DNA-sekvensanalyser noder x 16 cores - Lagring av data: 7 PetaByte (1PB = 1000 TeraBytes)

9 Hur går DNA-sekvenseringen till? 1. Prov (tex från blod) 2. Extrahera DNA 3. Fragmentera DNA i små korta bitar ca bp 4. Läs DNA bitarna med ett sekvensinstrument 5. Analysera och tolka resultaten

10 Hur ser datat ut? Miljontals små korta läsningar (ca 100 baser långa) CTGTGGCTTAGCAGGATTGCTAGTCAGTCGATGCTGTGC CGTAGCTAGCTAGCTAGTCGAGGTGTGGACTGTTAGCA GCTGATCGATGCTGATGCGTAGATCGATGATCGATCGAT GTCGATGCTGATCGATCGATGGATAAAATAGCTAAGTCGA GTCGATGCTAGGATGATCGATCGATCGATCGATAGCTA GTCGATCGATGGAGGGCCCCAGGCCATAGATTTCTTATAT AATCGATGGCTGATCGATGCTAGTGATCGATAGCTAGAT GTCGATCGATGGAGGGCCCCAGGCCATAGATTTCTTATAT

11 Analys av mänskligt DNA (1) Steg 1: Inpassing av läsningar från en individ CTGATCGTGATGGGGGCTGACTAGCTAGCTAGCTA ACTAGCTAGCTAGCTAGCTAGGGATCGATGCTGACTGATC GGGGGCTGACTAGCTAGCTAGCTAGCTAGGGATCGAT CGTGATGGGGGCTGACTAGCTAGCTAGCTAGCTAGGGATCGATGCT CTGACTAGCTAGCTAGCTAGCTAGGGATCGAT TGGCTGATCGTGATGGGGGCTGACTAGCTAGCT AGCTAGGGATCGATGCTGACTGATCGATCGAT GGGGGCTGACTAGCTAGCTAGCTAGCTAGGGATCGAT CGTGATGGGGGCTGACTAGCTAGCTAGCTAGCTAGGGA..GTGGCTGATCGTGATGGGGGCTGACTAGCTAGCTAGCTAGCTAGGGATCGATGCTGACTGATCGATCGAT Humana referensen (ca 3 miljarder baser) - - -

12 Analys av mänskligt DNA (2) Steg 2: Detektion av genetisk variation CTGATCGTGATGGGGGCTGACTATCTAGCTAGCTA ACTATCTAGCTAGCTAGCTAGGGATCGATGCTGACTGATC GGGGGCTGACTATCTAGCTAGCTAGCTAGGGATCGAT CGTGATGGGGGCTGACTATCTAGCTAGCTAGCTAGGGATCGATGCT CTGACTATCTAGCTAGCTAGCTAGGGATCGAT TGGCTGATCGTGATGGGGGCTGACTATCTAGCT AGCTAGGGATCGATGCTGACTGATCGATCGAT GGGGGCTGACTATCTAGCTAGCTAGCTAGGGATCGAT CGTGATGGGGGCTGACTATCTAGCTAGCTAGCTAGGGA..GTGGCTGATCGTGATGGGGGCTGACTAGCTAGCTAGCTAGCTAGGGATCGATGCTGACTGATCGATCGAT Gene7sk varia7on jämfört med referenssekvensen!

13 DNA sekvensering inom sjukvården genomics- and- personalized- medicine- wrongly- downplayed

14 Sekvensering inom sjukvården Utvecklingen går snabbt framåt! - Nya och förbättrade sekvensinstrument - Metoderna blir snabbare och billigare NGS-metoderna kan snart användas inom vården - Ger svar på frågor som man inte kunde få förut Tre exempel följer på hur vi börjat med detta! - Exempel 1: Hitta orsaken till en ärftlig sjukdom - Exempel 2: Antibiotikaresistenta bakterier - Exempel 3: Analys av leukemiprover

15 Exempel 1 Welanders Distala Myopati Dominant, ärftlig sjukdom - En kopia av arvsanlaget räcker Niklas Dahl, Joakim Klar, mfl Inst för immunologi, genetik och patologi, Uppsala Univ. Muskeldystrofi - Progressiv försvagning av muskler i händer och fötter - Sjukdomen debuterar runt år - Prevalens i Sverige: ca 1 på Hög andel fall vissa regioner i Sverge och Finland Region på kromosom 2 bär orsaken till sjukdomen Ingen sjukdomsorsakande gen i regionen hittad

16 Hedesundasjukan En hypotes: - Gemensam anfader - Vallonerna från Belgien? år sedan?

17 Nästa Generations Sekvensering Strategi: - Två individer analyserades - Leta efter gemensamma varianter I regionen på kromosom 2 Som inte finns i 100-tals friska individer Resultat: En enda variant hittades! I en gen som heter TIA1 Hittades i samtliga patienter Dominant nedärvning i familjer

18 Beräkning av åldern på mutationen Hur många generationer? Uträkning baseras bla på haplotyp-storlek Beräknad ålder ca 42 generationer! dvs ungefär 1000 år sedan Innan Vallonerna kom till Sverige!

19 Sammanfattning, Hedesundasjukan Genetiska orsaken till sjukdomen hittad! Kan användas för att ge patienter rätt diagnos Finns ännu inget botemedel men kan hjälpa forskningen framåt

20 Exempel 2 Antibiotikaresistanta bakterier Beredskap för utbrott och svåra patientfall Åsa Melhus, mfl Akademiska Sjukh, Uppsala Mål: Utveckla snabb DNA-analys av resistenta bakterier - Resultat inom ett par dagar Har redan använts på riktiga fall från sjukhuset! DNA extrac7on, QC, sample prepara7on Library QC and amplifica7on Sequencing and primary data analysis In depth data analysis Dag 1 Dag 2 Dag 3 Dag 4

21 Hur ser resultaten ut? I princip fullständig kartläggning av bakteriens arvsmassa inklusive eventuella antibiotikaresistenta gener!

22 Sammanfattning, antibiotikaresistens Vi har möjlighet att snabbt analysera resistenta bakterier! I vilka fall är det användbart? Patienter med okänd, resistent bakterieinfektion Informationen kan användas för att välja behandling Spåra utbrott av resistenta bakterier! Hitta källan till utbrott tex på sjukhus

23 Exempel 3 - Kronisk Myeloid Leukemi Fusionsproteinet BCR-ABL ett mål för läkemedel Lucia Cavelier, Monica Hermansson, mfl Inst för immunologi, genetik och patologi, Uppsala Univ. Resistansmutationer i BCR- ABL kan utvecklas till följd av medicinering

24 Resultat - diagnosprov BCR ABL Patientprov vid tid för diagnos

25 Resutat för ett uppföljningsprov BCR ABL Prov 6 månader senare Mutationer hittas i BCR-ABL. Patienten är resistent, och läkemedlet behöver bytas ut!

26 Mutationer i 5 KML patienter

27 Mutationer mappade till proteinstrukturen

28 BCR-ABL Sammansatta mutationer P1 61m T315I P1 68.5m T315I 91.8% 93.7% F359C 4.2% 3.9% D276G 2.0% F359C 2.0% H396R 1.1% 1.1%

29 Sammanfattning, analys av BCR-ABL NGS-metoden känsligare än nuvarande metoder Möjliggör för tidigare detektion av resistensmutationer Läkaren kan tidigare göra ett byte av läkemedel! Bra för patienten (kan ev undvika transplantation) Kan spara kostnader för vården

30 Hur ser framtiden ut? Finns många fler användningsområden inom sjukvården och mängden data kommer fortsätta att växa Stort behov av bioinformatik även i framtiden!

31 Exempel på sekvensprojekt, NGI Uppsala

32 Frågor???

Datorer och matematik hjälper oss att motverka sjukdomar

Datorer och matematik hjälper oss att motverka sjukdomar Datorer och matematik hjälper oss att motverka sjukdomar Adam Ameur Bioinformatiker Lund, 26e November 2014 Introduktion till bioinformatik Bioinformatik - en tvärvetenskaplig disciplin där algoritmer

Läs mer

Sara Ekvall, doktorand Inst. för immunologi, genetik & patologi Uppsala universitet Handledare: Marie-Louise Bondeson & Göran Annerén

Sara Ekvall, doktorand Inst. för immunologi, genetik & patologi Uppsala universitet Handledare: Marie-Louise Bondeson & Göran Annerén Sara Ekvall, doktorand Inst. för immunologi, genetik & patologi Uppsala universitet Handledare: Marie-Louise Bondeson & Göran Annerén Celler & DNA Vår kropp är uppbyggd av ~100 000 miljarder celler I cellen

Läs mer

Är genetiken på väg att bota diabetes?

Är genetiken på väg att bota diabetes? Är genetiken på väg att bota diabetes? Simon Eklöv Populärvetenskaplig sammanfattning av Självständigt arbete i biologi 2013 Institutionen för biologisk grundutbildning, Uppsala universitet. Under början

Läs mer

HUGO-projektet. Kartläggningen av det mänskliga genomet

HUGO-projektet. Kartläggningen av det mänskliga genomet Vem är HUGO? HUGO-projektet Kartläggningen av det mänskliga genomet Kartläggning av genom Genom= allt DNA hos en organism. Kartläggningen sker genom att man bestämmer DNA-sekvensen för hela genomet och

Läs mer

Selektion av resistenta bakterier vid väldigt låga koncentrationer av antibiotika.

Selektion av resistenta bakterier vid väldigt låga koncentrationer av antibiotika. Selektion av resistenta bakterier vid väldigt låga koncentrationer av antibiotika. Linus Sandegren Uppsala Universitet Inst. för Medicinsk Biokemi och Mikrobiologi linus.sandegren@imbim.uu.se Hur påverkas

Läs mer

Sammanfattning Arv och Evolution

Sammanfattning Arv och Evolution Sammanfattning Arv och Evolution Genetik Ärftlighetslära Gen Information om ärftliga egenskaper. Från föräldrar till av komma. Tillverkar proteiner. DNA (deoxiribonukleinsyra) - DNA kan liknas ett recept

Läs mer

Regionala riktlinjer för utredning av patienter med misstänkt ärftlig demens i Region Skåne

Regionala riktlinjer för utredning av patienter med misstänkt ärftlig demens i Region Skåne Regionala riktlinjer för utredning av patienter med misstänkt ärftlig demens i Region Skåne Hemsida: www.skane.se/vardochriktlinjer Fastställt 2013-05-30 E-post: vardochriktlinjer@skane.se Giltigt till

Läs mer

Antibiotikaresistens uppkomst och spridning

Antibiotikaresistens uppkomst och spridning Antibiotikaresistens uppkomst och spridning Antibiotikaresistenskonsekvensen känner vi till Antibiotika är inte längre effektivt! Vad är det som har hänt? Bakterierna har förändrats så att de inte längre

Läs mer

Cystnjursjukdomar och genetik. Carina Frykholm Klinisk genetik Akademiska sjukhuset, Uppsala

Cystnjursjukdomar och genetik. Carina Frykholm Klinisk genetik Akademiska sjukhuset, Uppsala Cystnjursjukdomar och genetik Carina Frykholm Klinisk genetik Akademiska sjukhuset, Uppsala Njurcystor i frisk population Ålder En cysta Bilaterala 30-49 år 1.7 % 1 % 50-70 år 11.5 % 4 % >70 år 22.1 %

Läs mer

Använda kunskaper i biologi för att granska information, kommunicera och ta ställning i frågor som rör hälsa, naturbruk och ekologisk hållbarhet.

Använda kunskaper i biologi för att granska information, kommunicera och ta ställning i frågor som rör hälsa, naturbruk och ekologisk hållbarhet. Arvet och DNA Lokal pedagogisk planering årkurs 9 Syfte Naturvetenskapen har sitt ursprung i människans nyfikenhet och behov av att veta mer om sig själv och om sin omvärld. Kunskaper i biologi har stor

Läs mer

En bioinformatisk genjakt

En bioinformatisk genjakt En bioinformatisk genjakt Efter en ide från: CUSMOBIO, Milano, Italien. Hur man kan söka i databaser efter information om en gen som kan ge ökad risk för bröstcacer. Bakgrund Människor utan symptom men

Läs mer

Next Generation Sequencing. Anna Gréen, Klinisk Genetik, Linköping

Next Generation Sequencing. Anna Gréen, Klinisk Genetik, Linköping Next Generation Sequencing Anna Gréen, Klinisk Genetik, Linköping Vad är Next Generation sequencing? First Generation sequencing- ex Sanger och pyrosekvensering 2005-massiv parallell sekvensering Stora

Läs mer

Genetisk testning av medicinska skäl

Genetisk testning av medicinska skäl Genetisk testning av medicinska skäl NÄR KAN DET VARA AKTUELLT MED GENETISK TESTNING? PROFESSIONELL GENETISK RÅDGIVNING VAD LETAR MAN EFTER VID GENETISK TESTNING? DITT BESLUT Genetisk testning av medicinska

Läs mer

X-bunden nedärvning. Information för patienter och föräldrar. Genetiska patientföreningars paraplyorganisation: Sällsynta diagnoser

X-bunden nedärvning. Information för patienter och föräldrar. Genetiska patientföreningars paraplyorganisation: Sällsynta diagnoser 12 Uppsala Örebroregionen: Klinisk Genetik Rudbecklaboratoriet Akademiska barnsjukhuset 751 85 Uppsala Tel: 018-611 59 40 ; Fax: 018-55 40 25 X-bunden nedärvning Norra sjukvårdsregionen: Klinisk Genetik

Läs mer

Demenssjukdomar och ärftlighet

Demenssjukdomar och ärftlighet Demenssjukdomar och ärftlighet SveDem Årsmöte 141006 Caroline Graff Professor, Överläkare caroline.graff@ki.se Forskningsledare vid Karolinska Institutet Centrum för Alzheimerforskning, Huddinge Chef för

Läs mer

Fakta om akut lymfatisk leukemi (ALL) sjukdom och behandling

Fakta om akut lymfatisk leukemi (ALL) sjukdom och behandling Fakta om akut lymfatisk leukemi (ALL) sjukdom och behandling Fakta om leukemier Av de mellan 900 och 1 000 personer i Sverige som varje år får diagnosen leukemi får ett 100-tal akut lymfatisk leukemi.

Läs mer

Fakta om kronisk myeloisk leukemi (KML) sjukdom och behandling

Fakta om kronisk myeloisk leukemi (KML) sjukdom och behandling Fakta om kronisk myeloisk leukemi (KML) sjukdom och behandling Om leukemier Kronisk myeloisk leukemi (KML) är en form av leukemi ett samlande begrepp för flera cancersjukdomar som angriper de blodbildande

Läs mer

Centrum för kardiovaskulär genetik med familjen i fokus

Centrum för kardiovaskulär genetik med familjen i fokus Centrum för kardiovaskulär genetik Norrlands universitetssjukhus Information till patienter och anhöriga Centrum för kardiovaskulär genetik med familjen i fokus Centrum för kardiovaskulär genetik (CKG)

Läs mer

Vad händer i ett genetiskt laboratorium?

Vad händer i ett genetiskt laboratorium? 12 utveckla nya metoder eller låta sådana prover delta i kvalitetskontrollprogram, såvida inte patienten har uttryckt att man inte vill att ens prov ska vara del av sådan verksamhet. Som alla andra sparade

Läs mer

Hur påverkar strålning celler och organismer?

Hur påverkar strålning celler och organismer? Hur påverkar strålning celler och organismer? Bo Stenerlöw Inst. f. immunologi, genetik och patologi Rudbecklaboratoriet Uppsala universitet bo.stenerlow@igp.uu.se Joniserande strålning Dos: Gray (Gy =

Läs mer

Ärftliga sjukdomar och egenskaper hos hund

Ärftliga sjukdomar och egenskaper hos hund Engelsk bulldog Tibetansk terrier Västgötaspets Dvärgpinscher Chow chow Foto: Pleple2000 Foto: Flickr user skaty222 Foto: Sören T Eriksson Foto: Entheta Foto:Jurriaan Schulman Alla bilder Wikimedia commons

Läs mer

Lärarhandledning gällande sidorna 6-27 Inledning: (länk) Läromedlet har sju kapitel: 5. Celler och bioteknik

Lärarhandledning gällande sidorna 6-27 Inledning: (länk) Läromedlet har sju kapitel: 5. Celler och bioteknik Senast uppdaterad 2012-12-09 55 Naturkunskap 1b Lärarhandledning gällande sidorna 6-27 Inledning: (länk) Celler och bioteknik C apensis Förlag AB Läromedlet har sju kapitel: 1. Ett hållbart samhälle 2.

Läs mer

Genetik vid polyneuropatier. Christina Jern

Genetik vid polyneuropatier. Christina Jern Genetik vid polyneuropatier Christina Jern Information lagras i DNA 2 m DNA i varje cell Bara 3 cm kodar för protein Det humana genomet februari 2001 The International Human Genome Mapping Consortium

Läs mer

UVIS. Ett nationellt center för avbildning med tyngdpunkt inom translationell medicin. Jan Grawé. Uppsala Universitet

UVIS. Ett nationellt center för avbildning med tyngdpunkt inom translationell medicin. Jan Grawé. Uppsala Universitet UVIS Ett nationellt center för avbildning med tyngdpunkt inom translationell medicin Jan Grawé Rudbecklaboratoriet b t Uppsala Universitet Science For Life Laboratory (SciLifeLab) En satsning på storskalig

Läs mer

Vad är en genetisk undersökning?

Vad är en genetisk undersökning? 12 Vad är en genetisk undersökning? Originalet framtaget av Guy s and St Thomas Hospital, London, UK, och London IDEAS Genetic Knowledge Park, januari 2007. Detta arbete är finansierat av EuroGentest,

Läs mer

Förbättrad bekämpning av HIV resistens i Afrika och Sverige. Professor Anders Sönnerborg

Förbättrad bekämpning av HIV resistens i Afrika och Sverige. Professor Anders Sönnerborg Förbättrad bekämpning av HIV resistens i Afrika och Sverige Professor Anders Sönnerborg 2 MSB:s kontaktpersoner: Sara Brunnberg 010-240 4087 Publikationsnummer: MSB1000 - april 2016 3 Förord Humant immunbrist

Läs mer

Diagnosticera sicklecellsanemi med DNA-analys. Niklas Dahrén

Diagnosticera sicklecellsanemi med DNA-analys. Niklas Dahrén Diagnosticera sicklecellsanemi med DNA-analys Niklas Dahrén Sicklecellsanemi Erytrocyterna ser ut som skäror : Sjukdomen innebär a0 de röda blodkropparna (erytrocyterna) ser ut som skäror (eng. sickle)

Läs mer

Information och samtyckesformulär inför genomisk utredning av ovanliga sjukdomar och syndrom med metoderna genomisk array och exomanalys

Information och samtyckesformulär inför genomisk utredning av ovanliga sjukdomar och syndrom med metoderna genomisk array och exomanalys Information och samtyckesformulär inför genomisk utredning av ovanliga sjukdomar och syndrom med metoderna genomisk array och exomanalys Detta informationsblad och samtyckesformulär är riktat till dig

Läs mer

Vad är Klinisk forskning

Vad är Klinisk forskning Vad är Klinisk forskning Geografiskt nära sjukhusmiljöer och patienter Sjukdomsproblem eller förlopp i fokus Läkare/vårdpersonal inblandade Nyttan för patienterna tydlig Utmaningen: + Laboratorium Patienter

Läs mer

Vad är en genetisk undersökning? Information för patienter och föräldrar

Vad är en genetisk undersökning? Information för patienter och föräldrar Vad är en genetisk undersökning? Information för patienter och föräldrar 2 Vad är en Genetisk Undersökning? Denna informationsskrift berättar vad en genetisk undersökning är, varför Du skall överväga en

Läs mer

CRISPR - revolutionerande genteknik. Magnus Lundgren Uppsala Universitet

CRISPR - revolutionerande genteknik. Magnus Lundgren Uppsala Universitet CRISPR - revolutionerande genteknik Magnus Lundgren Uppsala Universitet magnus.lundgren@icm.uu.se Magnus Lundgren Född 1975 i Malmö Uppväxt i Malmö, Ockelbo, Gävle Bor med sambo & barn i Uppsala Studerat

Läs mer

Vad kan vi lära om sambandet mellan skolelever miljö och psykisk hälsa med hjälp av epigenetik?

Vad kan vi lära om sambandet mellan skolelever miljö och psykisk hälsa med hjälp av epigenetik? Vad kan vi lära om sambandet mellan skolelever miljö och psykisk hälsa med hjälp av epigenetik? Catharina Lavebratt Centrum för Molekylär Medicin Karolinska Institutet Yvonne Forsell Modell Miljö Stress

Läs mer

Erik Eriksson VMD Enheten för Bakteriologi

Erik Eriksson VMD Enheten för Bakteriologi Diagnostik VTEC/EHEC Erik Eriksson VMD Enheten för Bakteriologi SVA Tänker prata om VTEC / EHEC Sjukdomsframkallande faktorer PCR Magnetiska kulor (Immunomagnetisk separation) Diagnostik de vanligaste

Läs mer

TENTAMEN. 18 januari 2006. APEX och BVLP, ht 05

TENTAMEN. 18 januari 2006. APEX och BVLP, ht 05 TENTAMEN 18 januari 2006 APEX och BVLP, ht 05 Block III: Integrativ biomedicin med farmakologisk inriktning Delkurs 5: Immunologi, infektion, tumörbiologi, och hematologi Kod: Max poäng: 77 Gränser (G/VG):

Läs mer

Mitokondriella sjukdomar. Gittan Kollberg Avd för klinisk kemi Sahlgrenska Sjukhuset Göteborg

Mitokondriella sjukdomar. Gittan Kollberg Avd för klinisk kemi Sahlgrenska Sjukhuset Göteborg Mitokondriella sjukdomar Gittan Kollberg Avd för klinisk kemi Sahlgrenska Sjukhuset Göteborg Mitokondriell sjukdom Definition Oxidativ fosforylering Genetik och ärftlighet Biokemisk utredning av mitokondriefunktion

Läs mer

Genetik en sammanfattning

Genetik en sammanfattning Genetik en sammanfattning Pär Leijonhufvud $\ BY: 3 februari 2015 C Innehåll Inledning 2 Klassisk genentik 2 Gregor Mendel munken som upptäckte ärftlighetens lagar....... 2 Korsningsrutor, ett sätt att

Läs mer

Arvet och DNA. Genetik och genteknik

Arvet och DNA. Genetik och genteknik Arvet och DNA Genetik och genteknik Genetik Du är inte en kopia utav någon av dina föräldrar utan en unik blandning av egenskaper från båda dina föräldrar. Genetik är den del av biologin som handlar om

Läs mer

Arytmogen högerkammarkardiomyopati

Arytmogen högerkammarkardiomyopati Centrum för kardiovaskulär genetik Norrlands universitetssjukhus Information till patienter och anhöriga Arytmogen högerkammarkardiomyopati Den här informationen riktar sig till dig som har sjukdomen arytmogen

Läs mer

Genetik, Gen-etik och Genteknik

Genetik, Gen-etik och Genteknik Genetik, Gen-etik och Genteknik Syfte och innehåll Att utveckla kunskap om det genetiska arvet och genteknikens möjligheter. Arbetssätt Vi kommer att varva föreläsningar, diskussioner, arbetsuppgifter

Läs mer

Biologi breddning (mikrobiologi och immunologi) Kurskod: BI 1203-A Poäng: 50 Program: Förkunskapskrav: Biologi A och Biologi B

Biologi breddning (mikrobiologi och immunologi) Kurskod: BI 1203-A Poäng: 50 Program: Förkunskapskrav: Biologi A och Biologi B KURSBESKRIVNING Ämne: Biologi Kurs: Biologi breddning (mikrobiologi och immunologi) Kurskod: BI 1203-A Poäng: 50 Program: NV Förkunskapskrav: Biologi A och Biologi B Mål Kurserna Biologi breddning A och

Läs mer

Tack. Eira-studien. Vi vill med denna broschyr tacka Dig för Din medverkan i vår studie över orsaker till ledgångsreumatism!

Tack. Eira-studien. Vi vill med denna broschyr tacka Dig för Din medverkan i vår studie över orsaker till ledgångsreumatism! Eira-studien a r i E Tack Vi vill med denna broschyr tacka Dig för Din medverkan i vår studie över orsaker till ledgångsreumatism! Du är en av de drygt 5 000 personer i Sverige som under de senaste 10

Läs mer

Med hopp om framtiden transposoner, DNA som flyttar sig själv

Med hopp om framtiden transposoner, DNA som flyttar sig själv Med hopp om framtiden transposoner, DNA som flyttar sig själv Jessica Bergman Populärvetenskaplig sammanfattning av Självständigt arbete i biologi VT 2008 Institutionen för biologisk grundutbildning, Uppsala

Läs mer

Ärftliga sjukdomar i perifera nerver-klinik och konsekvenser Barbro Westerberg 10 05 10 Tylösand HMSN - CMT CMT Charcot-Marie och Tooth HMSN hereditär motorisk-sensorisk sensorisk neuropati CMT används

Läs mer

Cirkulerande tumör-dna för cancerdiagnostik

Cirkulerande tumör-dna för cancerdiagnostik Cirkulerande tumör-dna för cancerdiagnostik -Behandlingsstyrande tester av EGFR hos patienter med icke småcellig lungcancer Gisela Helenius Laboratoriemedicinska kliniken Universitetssjukhuset Örebro Sökning

Läs mer

Medicinska fakulteten UTBILDNING, FORSKNING OCH INNOVATION SEDAN 1666

Medicinska fakulteten UTBILDNING, FORSKNING OCH INNOVATION SEDAN 1666 Medicinska fakulteten UTBILDNING, FORSKNING OCH INNOVATION SEDAN 1666 Tillsammans skapar vi morgondagens Hälsa Politisk känslig verksamhet Topp 100-listan Ca 17 000 lärosäten i världen. Ca 23 i Sverige

Läs mer

Karl Holm Ekologi och genetik, EBC, UU. ebc.uu.se. Nick Brandt. Populationsgenetik

Karl Holm Ekologi och genetik, EBC, UU. ebc.uu.se. Nick Brandt. Populationsgenetik Karl Holm Ekologi och genetik, EBC, UU karl.holm@ ebc.uu.se Nick Brandt Populationsgenetik Kursens upplägg Föreläsningar 24/4, 10:15-16:00 Friessalen Introduktion, HWE 27/4, 10:15-16:00 Inavel 28/4, 10:15-16:00

Läs mer

Facit tds kapitel 18

Facit tds kapitel 18 Facit tds kapitel 18 Testa dig själv 18.1 1. Arvsanlagen finns i cellkärnan. Inför celldelningen samlas de i kromosomer. 2. Det kemiska ämne som bär på arvet kallas DNA. 3. Instruktionerna i DNA är ritningar,

Läs mer

ESSENCE-dag 2. Läkarens arbete. /Elisabeth Fernell. Utvecklingsneurologiska enheten, Barnkliniken, Skaraborgs sjukhus, Mariestad

ESSENCE-dag 2. Läkarens arbete. /Elisabeth Fernell. Utvecklingsneurologiska enheten, Barnkliniken, Skaraborgs sjukhus, Mariestad ESSENCE-dag 2 Läkarens arbete /Elisabeth Fernell Utvecklingsneurologiska enheten, Barnkliniken, Skaraborgs sjukhus, Mariestad Gillbergcentrum, Göteborgs universitet Innehåll Läkarens del i: Funktionsutredning

Läs mer

Planering i genetik och evolution för Så 9 Lag Öst. (Planeringen är preliminär och vissa lektionspass kan ändras)

Planering i genetik och evolution för Så 9 Lag Öst. (Planeringen är preliminär och vissa lektionspass kan ändras) Planering i genetik och evolution för Så 9 Lag Öst (Planeringen är preliminär och vissa lektionspass kan ändras) Lokal Pedagogisk Planering i Biologi Ansvarig lärare: Janne Wåhlin Ämnesområde: Genetik

Läs mer

Genomic Era. Vad är autism? Tvillingstudier. Genetiska Riskfaktorer för neuropsykiatriska funktionshinder

Genomic Era. Vad är autism? Tvillingstudier. Genetiska Riskfaktorer för neuropsykiatriska funktionshinder Genomic Era Genetiska Riskfaktorer för neuropsykiatriska funktionshinder MaiBritt Giacobini PRIMA Järva 50tal Watson Crick double helix 2003 Humana genomet 3 miljarder baspar kartlagt Stor implikation

Läs mer

LPP Nervsystemet, hormoner och genetik

LPP Nervsystemet, hormoner och genetik LPP Nervsystemet, hormoner och genetik Det är bara hormonerna och han är full av hormoner är två vanliga uttryck med ordet hormon, men vad är egentligen hormoner och hur påverkar de kroppen? Vi har ett

Läs mer

Pedagogisk planering Bi 1 - Individens genetik

Pedagogisk planering Bi 1 - Individens genetik Centralt innehåll Genetik Arvsmassans uppbyggnad samt ärftlighetens lagar och mekanismer. Celldelning, dnareplikation och mutationer. Genernas uttryck. Proteinsyntes, monogena och polygena egenskaper,

Läs mer

Lokal pedagogisk planering för arbetsområdet genetik i årskurs 9

Lokal pedagogisk planering för arbetsområdet genetik i årskurs 9 Lokal pedagogisk planering för arbetsområdet genetik i årskurs 9 Syfte: Använda biologins begrepp, modeller och teorier för att beskriva och förklara biologiska samband i människokroppen och samhället.

Läs mer

Innehåll. Förord... 7. Inledning... 11. Tack... 195 Vidare läsning... 197 Illustrationer... 203 Register... 205. kapitel 1 Ursprung...

Innehåll. Förord... 7. Inledning... 11. Tack... 195 Vidare läsning... 197 Illustrationer... 203 Register... 205. kapitel 1 Ursprung... Innehåll Förord.... 7 Inledning.... 11 kapitel 1 Ursprung... 13 kapitel 2 Evolution.... 21 kapitel 3 Upptäckt... 33 kapitel 4 Miljö och civilisation... 49 kapitel 5 Bakteriell patogenes... 69 kapitel 6

Läs mer

Screening av fetalt RHD i maternell plasma. Åsa Hellberg BMA, PhD Klinisk immunologi och transfusionsmedicin Labmedicin Skåne

Screening av fetalt RHD i maternell plasma. Åsa Hellberg BMA, PhD Klinisk immunologi och transfusionsmedicin Labmedicin Skåne Screening av fetalt RHD i maternell plasma Åsa Hellberg BMA, PhD Klinisk immunologi och transfusionsmedicin Labmedicin Skåne När används blodgruppsgenomisk typning? oberoende analys vid oklara serologiska

Läs mer

Ackrediteringens omfattning

Ackrediteringens omfattning Akondroplasi FGFR3 BCR/ABL,ETV6/RUNX1,MLL, CDKN2A(9p21), PML/RARA, RUNX1-CBFA2T1, CBFB,TCF3/PBX1 TCF3-PBX1 ABL BCR-ABL ETV6-RUNX1 MLL/AF4, kronisk myeloisk leukemi (KML) ABL p.[t315i] CEBPA FLT3 NPM1 PML-RARA

Läs mer

Denna pdf-fil är nedladdad från Illustrerad Vetenskaps webbplats (www.illvet.com) och får ej lämnas vidare till tredjepart.

Denna pdf-fil är nedladdad från Illustrerad Vetenskaps webbplats (www.illvet.com) och får ej lämnas vidare till tredjepart. Käre användare! Denna pdf-fil är nedladdad från Illustrerad Vetenskaps webbplats (www.illvet.com) och får ej lämnas vidare till tredjepart. Av hänsyn till copyright innehåller den inga foton. Med vänlig

Läs mer

Vad är repetitionslängd?

Vad är repetitionslängd? Huntingtons sjukdom forsknings nyheter. I klartext Skriven av forskare För de globala HS medlemmarna. Ny analys visar att den korta CAG-längden inte spelar roll Storleken är inte allt: forskning tyder

Läs mer

Hälsosamma levnadsvanor är även viktigt för patienter med cancer, men hur når vi dit?

Hälsosamma levnadsvanor är även viktigt för patienter med cancer, men hur når vi dit? Hälsosamma levnadsvanor är även viktigt för patienter med cancer, men hur når vi dit? Hans Hägglund Överläkare, docent Verksamhetschef Akademiska Sjukhuset Hemsjukvård efter benmärgstransplantation har

Läs mer

Hereditär nefrit Alport syndrom

Hereditär nefrit Alport syndrom Bosön 2015-11-03 Alport syndrom 1 Hereditär nefrit Alport syndrom Per Brandström Bosön 2015-11-03 Alport syndrom 2 Mikroskopisk hematuri Varifrån kommer blodet? Blödningskälla glomerulär, post-glomerulär,

Läs mer

Kopiera DNA med hjälp av PCR-metoden. Niklas Dahrén

Kopiera DNA med hjälp av PCR-metoden. Niklas Dahrén Kopiera DNA med hjälp av PCR-metoden Niklas Dahrén Först lite allmän kunskap om kromosomer, DNA, gener etc. Varje kromosom består av en lång DNAmolekyl som är lindad runt histoner En gen är en liten del

Läs mer

Vaccinera barn mot bakterier förhindra antibiotikaresistens

Vaccinera barn mot bakterier förhindra antibiotikaresistens Vaccinera barn mot bakterier förhindra antibiotikaresistens Bakterier som har utvecklat resistens mot antibiotika blir ett allt större hot mot vår hälsa. information från Barnplantorna Foto: Karim Hatoum

Läs mer

Betygskriterier DNA/Genetik

Betygskriterier DNA/Genetik Betygskriterier DNA/Genetik Godkänd Du skall Känna till hur DNA molekylen är uppbyggd, vilka de genetiska språket(bokstäverna) är och hur de formar sig i DNA- molekylen Känna till begreppen Gen, Kromosom,

Läs mer

Del 3. Totalt 16p. Vilken diagnos misstänker Du (1p) Nämn tre relevanta frågor du ställer till patienten, om hon inte spontant besvarar dom.

Del 3. Totalt 16p. Vilken diagnos misstänker Du (1p) Nämn tre relevanta frågor du ställer till patienten, om hon inte spontant besvarar dom. Totalt 16p. Du är AT-läkare och primär jour på kirurgakuten vid Hudiksvalls sjukhus. Din AT-kollega på medicin vill konsultera dig om en patient som är mamma till Du är förstås kollegial och tar hand om

Läs mer

Hundar hjälper oss att förstå människans sjukdomar. Kerstin Lindblad-Toh

Hundar hjälper oss att förstå människans sjukdomar. Kerstin Lindblad-Toh Hundar hjälper oss att förstå människans sjukdomar Kerstin Lindblad-Toh Målsättning med min forskning Att hitta människors sjukdomsgener via: - djurmodeller - en bättre förståelse av arvsmassan - storskalig

Läs mer

Allmänt om bakterier

Allmänt om bakterier Bakterier Allmänt om bakterier Bakterier är varken djur eller växter De saknar cellvägg och klorofyll De är viktiga nedbrytare - bryter ner döda växter och djur En matsked jord = 10 miljarder bakterier

Läs mer

Medfött långt QT syndrom ärftlig svimning

Medfött långt QT syndrom ärftlig svimning Centrum för kardiovaskulär genetik Norrlands universitetssjukhus Information till patienter och anhöriga Medfött långt QT syndrom ärftlig svimning Den här informationen riktar sig till dig som har sjukdomen

Läs mer

Generell detektion av patogen med metagenomik

Generell detektion av patogen med metagenomik Generell detektion av patogen med metagenomik Maria Lind Karlberg Björn Hallström Avdelningen för mikrobiologi Enheten för laboratorieutveckling Hur identifieras en patogen hos en patient med infektion?

Läs mer

Gene$sk diagnos$k av AML. Thoas Fioretos, professor, överläkare Genetiska kliniken och Avd för klinisk genetik

Gene$sk diagnos$k av AML. Thoas Fioretos, professor, överläkare Genetiska kliniken och Avd för klinisk genetik Gene$sk diagnos$k av AML Thoas Fioretos, professor, överläkare Genetiska kliniken och Avd för klinisk genetik 2016-10- 03 WHO klassifikationen Major principle: Classification relies on a combination of

Läs mer

Omentamen 3p mikrobiologi inom biologi 45p,

Omentamen 3p mikrobiologi inom biologi 45p, Omentamen 3p mikrobiologi inom biologi 45p, 050621 Fråga 1 Markera vilka av nedanstående alternativ som är Sanna eller Falska. För varje felaktigt alternativ ges 0.4p avdrag, dock kan frågan ej ge mindre

Läs mer

NGS i sjukvård next generation sequencing. Jan Söderman Medicinsk diagnostik Länssjukhuset Ryhov Jönköping

NGS i sjukvård next generation sequencing. Jan Söderman Medicinsk diagnostik Länssjukhuset Ryhov Jönköping NGS i sjukvård next generation sequencing Jan Söderman Medicinsk diagnostik Länssjukhuset Ryhov Jönköping CREDIT: Peter & Maria Hoey / www.peterhoey.com The ultimate genetic test, Science 336: 1110-1112,

Läs mer

Hur verkar Fludara. En informativ guide för patienter och sjukvårdspersonal. There s more to life with Fludara

Hur verkar Fludara. En informativ guide för patienter och sjukvårdspersonal. There s more to life with Fludara Hur verkar Fludara En informativ guide för patienter och sjukvårdspersonal There s more to life with Fludara Innehåll Sidan Introduktion 4 Vad är kronisk lymfatisk leukemi (KLL)? 4 Hur verkar Fludara?

Läs mer

Skrivning för biolog- och molekylärbiologlinjen, genetik 5p.

Skrivning för biolog- och molekylärbiologlinjen, genetik 5p. Skrivning för biolog- och molekylärbiologlinjen, genetik 5p. Namn: Adress: Resultat: Betyg: Hjälpmedel: Miniräknare. Formelblad med tabell. Skrivtid: 9.00-13.00. Beräkningar och svar ska vara motiverade.

Läs mer

Landstingsstyrelsens förslag till beslut

Landstingsstyrelsens förslag till beslut FÖRSLAG 2011:36 LS 0910-0865 1 (3) Landstingsstyrelsens förslag till beslut Motion 2009:29 av Lena-Maj Anding m fl (MP) om inrättande av ett resurscentrum för forskning och behandling av patienter med

Läs mer

Kromosom translokationer

Kromosom translokationer 12 Uppsala Örebroregionen: Klinisk Genetik Rudbecklaboratoriet Akademiska barnsjukhuset 751 85 Uppsala Tel: 018-611 59 40 Fax: 018-55 40 25 http://www.scilifelab.uu.se/ Genetiska patientföreningars paraplyorganisation:

Läs mer

Fakta om GIST (gastrointestinala stromacellstumörer) sjukdom och behandling

Fakta om GIST (gastrointestinala stromacellstumörer) sjukdom och behandling Fakta om GIST (gastrointestinala stromacellstumörer) sjukdom och behandling GIST en ovanlig magtumör GIST (gastrointestinala stromacellstumörer) är en ovanlig form av cancer i mag-tarmkanalen. I Sverige

Läs mer

Innovationsplattform för framtidens vård

Innovationsplattform för framtidens vård Innovationsplattform för framtidens vård Sammanfattning av Innovationsplattform för framtidens vård Etapp ett. Det forskande läkemedelsföretaget Celgene har initierat arbetet Innovationsplattform för framtidens

Läs mer

Onkogenetisk regionmottagning i Linköping. Marie Stenmark Askmalm Sigrun Liedgren Lilianne Ferraud Madelene Jansson Ann-Charlotte Isaksson

Onkogenetisk regionmottagning i Linköping. Marie Stenmark Askmalm Sigrun Liedgren Lilianne Ferraud Madelene Jansson Ann-Charlotte Isaksson Onkogenetisk regionmottagning i Linköping Marie Stenmark Askmalm Sigrun Liedgren Lilianne Ferraud Madelene Jansson Ann-Charlotte Isaksson Dagordning Organisation Mål för onkogenetiska mottagningen Definition

Läs mer

V47 Måndag 16/11 Tisdag 17/11 Onsdag 18/11 Torsdag 19/11 Fredag 20/11

V47 Måndag 16/11 Tisdag 17/11 Onsdag 18/11 Torsdag 19/11 Fredag 20/11 BMA programmet, Termin3, Patologi med klinisk genetik 2015 V47 Måndag 16/11 Tisdag 17/11 Onsdag 18/11 Torsdag 19/11 Fredag 20/11 Tumörbiologi 1 Tumörbiologi 2 Mikrodemonstration tumör Bröstets patologi

Läs mer

Klinisk genetik en introduktion

Klinisk genetik en introduktion Klinisk genetik en introduktion Ulf Kristoffersson Överläkare, docent Genetiska kliniken Labmedicin Skåne, Lund Vad ska en sjuksköterska kunna om ärftlighet? Ta en familjeanamnes och rita ett enkelt släktträd

Läs mer

Har ni frågor om detta är ni välkomna att kontakta: Ingrid Lidström, telefon 090-785 12 34 alternativt 070-568 77 05.

Har ni frågor om detta är ni välkomna att kontakta: Ingrid Lidström, telefon 090-785 12 34 alternativt 070-568 77 05. LABORATORIEMEDICIN Laboratorienytt Nr 8, december 2010 Innehåll: 1 Innehållsförteckning 1 Påminnelse om kundkoder/streckkoder 2-4 Klinisk Genetik Amnionprover och CVS till Klinisk Genetik under Jul och

Läs mer

Samtycke angående sparande av biobanksprov. Uppgifter om inkomna nej-talonger år 2013 i Uppsala Örebro sjukvårdsregion

Samtycke angående sparande av biobanksprov. Uppgifter om inkomna nej-talonger år 2013 i Uppsala Örebro sjukvårdsregion Samtycke angående sparande av biobanksprov Uppgifter om inkomna nej-talonger år 2013 i Uppsala Örebro sjukvårdsregion Kommentar: Samtliga tabeller med undantag för tabell 3, som baseras på uppgifter från

Läs mer

Lycka till! Omtentamen. Kursens namn: Medicin C, Tumörbiologi Kursens kod: MC1728 Kursansvarig: Anna Göthlin Eremo

Lycka till! Omtentamen. Kursens namn: Medicin C, Tumörbiologi Kursens kod: MC1728 Kursansvarig: Anna Göthlin Eremo Omtentamen Kursens namn: Medicin C, Tumörbiologi Kursens kod: MC1728 Kursansvarig: Anna Göthlin Eremo Datum: 2012-08-20 Skrivtid: 4 timmar Poängfördelning: Karin Franzén Sabina Davidsson Pia Wegman Marike

Läs mer

CENTRUM FÖR KARDIOVASKULÄR GENETIK

CENTRUM FÖR KARDIOVASKULÄR GENETIK I trygga händer. Familjemottagningen. Min släkts DNA! Agnes 47 år, patient på CKG. CENTRUM FÖR KARDIOVASKULÄR GENETIK VÅRT SJUKHUS. EN VÄRLD FÖR DIG. Varje steg räknas! Avancerad teknik PATIENTENS RESA

Läs mer

DNA- analyser kan användas för att

DNA- analyser kan användas för att Genteknik DNA- analyser kan användas för att -identifiera och koppla misstänkta till brottsplats -fria oskyldigt utpekade och oskyldigt fällda -personidentifiering vid masskatastrofer, krig, massgravar

Läs mer

Sammanställning av prov som inte sparas p.g.a. ändrat samtycke. Uppgifter om inkomna nej-talonger år 2014 i Uppsala Örebro sjukvårdsregion

Sammanställning av prov som inte sparas p.g.a. ändrat samtycke. Uppgifter om inkomna nej-talonger år 2014 i Uppsala Örebro sjukvårdsregion Sammanställning av prov som inte sparas p.g.a. ändrat samtycke Uppgifter om inkomna nej-talonger år 2014 i Uppsala Örebro sjukvårdsregion 1 Kommentarer Samtliga tabeller och figurer är uppgifter inhämtade

Läs mer

2 Symptom 8 Komplikationer och symtom Vilka symtom ser man vid essentiell trombocytos?

2 Symptom 8 Komplikationer och symtom Vilka symtom ser man vid essentiell trombocytos? Innehåll Förord 3 Inledning 4 1 Essentiell trombocytos 5 Bakgrund Vad betyder essentiell trombocytos (ET)? Hur vanlig är essentiell trombocytos? I vilka andra situationer kan trombocytantalet vara förhöjt?

Läs mer

Genetik. Gregor Mendel onsdag 12 september 12

Genetik. Gregor Mendel onsdag 12 september 12 Gregor Mendel 1822-1884 1 Mendel valde ärtor för att undersöka hur arvet förs vidare från föräldrar till avkomma, alltså hur exempelvis utseende ärvs mellan generationer. Med ärtorna kunde han styra sina

Läs mer

Verksamhetsplan 2014 Bilaga 1: NULÄGES- ANALYS

Verksamhetsplan 2014 Bilaga 1: NULÄGES- ANALYS 2014 01 20 Verksamhetsplan 2014 Bilaga 1: NULÄGES- ANALYS 1. Antal föreningarna, Den 1 januari hade de 26 patientföreningarna 8 200. Målet för helåret 2013 var att nå 8 000 och det målet överträffades

Läs mer

Hur bioinformatiker arbetar med lagring och delning av data

Hur bioinformatiker arbetar med lagring och delning av data Hur bioinformatiker arbetar med lagring och delning av data Lars Arvestad Numerisk analys och datalogi Swedish e-science Research Centre Science for Life Laboratory ? e c n e i c S e f Li Bioinformatik:

Läs mer

Nytt fosterprov utmanar

Nytt fosterprov utmanar Forskning & Framsteg Nr 12/2010 s. 14-16 http://www.fof.se/tidning/2011/1/nytt-fosterprov-utmanar Nytt fosterprov utmanar AV PER SNAPRUD UR F&F 1/2011. Ett enkelt blodprov från en gravid kvinna kan avslöja

Läs mer

Ny analyskatalog 15 oktober

Ny analyskatalog 15 oktober 1 (9) 2014-10-06 Till TakeCare-användare CSTC Ny analyskatalog 15 oktober Nedanstående förändringar från Karolinska Universitetslaboratoriet införs den 15 oktober i analyskatalog för elektroniska beställningar

Läs mer

Naturvetenskaplig fakultetsnämnd

Naturvetenskaplig fakultetsnämnd Naturvetenskaplig fakultetsnämnd BIR200, Cellbiologi; biokemi, genetik, mikrobiologi och cellfysiologi, 15 högskolepoäng Cell biology; biochemistry, genetics, microbiology and cell physiology, 15 higher

Läs mer

Läkemedelsverket publicerade i oktober 2012 nya rekommendationer avseende

Läkemedelsverket publicerade i oktober 2012 nya rekommendationer avseende Läkemedelsverket publicerade i oktober 2012 nya rekommendationer avseende antibiotikaprofylax inför tandbehandling, rekommendationer som i princip innebär att de flesta patienter med hjärtfel relaterat

Läs mer

Dokumentnamn PM leukemier Utfärdare Martin Höglund/Kerstin Hamberg. Version 2.0. Granskare Leukemi-Lymfom diagnosgrupp.

Dokumentnamn PM leukemier Utfärdare Martin Höglund/Kerstin Hamberg. Version 2.0. Granskare Leukemi-Lymfom diagnosgrupp. Dokumentnamn PM leukemier Utfärdare Martin Höglund/Kerstin Hamberg Granskare Leukemi-Lymfom diagnosgrupp Version 2.0 Datum 2015-03-21 Syftet med U-CAN, är att bygga upp en biobank med blod-, tumör- och

Läs mer

Utveckling av läkemedelsbehandlingar av cancer kräver en dialog inom hela sektorn

Utveckling av läkemedelsbehandlingar av cancer kräver en dialog inom hela sektorn Page 1 of 8 PUBLICERAD I NUMMER 3/2015 TEMAN Utveckling av läkemedelsbehandlingar av cancer kräver en dialog inom hela sektorn Tiia Talvitie, Päivi Ruokoniemi Kimmo Porkka (foto: Kai Widell) Målsökande

Läs mer

Next generation sequencing hur kan hygienläkare använda detta? Anders Johansson

Next generation sequencing hur kan hygienläkare använda detta? Anders Johansson Next generation sequencing hur kan hygienläkare använda detta? Anders Johansson 2016-11-11 Många användningsområden några få är färdiga för kliniskt bruk Inom klinisk genetik och klinisk patologi används

Läs mer

NMiS Workshop. Örebro 14 november 2013

NMiS Workshop. Örebro 14 november 2013 NMiS Workshop Örebro 14 november 2013 Program NMiS syfte och bakgrund NMiS aktuell statistik Genomgång av det nya registret Hur går vi vidare? Nationell screening av LGMD Nytt om FSHD Rapport från TREAT-NMD

Läs mer

Familjär hyperkolesterolemi (FH) När skall man misstänka? Christer Lundin

Familjär hyperkolesterolemi (FH) När skall man misstänka? Christer Lundin Familjär hyperkolesterolemi (FH) När skall man misstänka? Christer Lundin 160511 Mona Lisa (1506) Leonardo da Vinci Madonna Lisa Maria de Gherardini (1479 1506) Död vid 27 års ålder Xantelasmata Senxantom

Läs mer

Pilotstudie NGS: E. coli ESBL från patienter med misstänkt sepsis

Pilotstudie NGS: E. coli ESBL från patienter med misstänkt sepsis Pilotstudie NGS: E. coli ESBL från patienter med misstänkt sepsis Helena Enroth, Med Dr (PhD), Klinisk molekylärbiologi, Unilabs, Skövde och Adj. Professor, Systems Biology Research Group, Inst. för biovetenskap,

Läs mer