En bioinformatisk genjakt

Storlek: px
Starta visningen från sidan:

Download "En bioinformatisk genjakt"

Transkript

1 En bioinformatisk genjakt Efter en ide från: CUSMOBIO, Milano, Italien. Hur man kan söka i databaser efter information om en gen som kan ge ökad risk för bröstcacer. Bakgrund Människor utan symptom men med en känd genetisk sjukdom i familjen kan få möjlighet att testa sig genetiskt för att se om de bär på anlaget för en genetisk sjukdom. I scenariot vi tänker oss här är det en kvinna med många fall av cancer i familjen som vill veta om hon löper större risk än normalt att utveckla en tumörsjukdom. Anna, 23 år, går till en gynekolog. När läkaren frågar henne om sjukdomar i familjen så lägger han märke till att flera kvinnliga medlemmar av släkten har haft cancer. Henes farmor dog vid 40 års ålder av bröstcancer och två fastrar dog i 50-årsåldern av livmodercancer. En tredje faster har precis vid 39 års ålder blivit diagnosticerad med bröstcancer. Gynekologen informerar om att det kan vara möjligt att det i familjen finns någon mutation i en av de två bröstcancergener som man har identifierat (BRCA1 or BRCA2). Under besöket hittar gynekologen också en misstänkt knöl i hennes högra bröst och gör en bioposi på den (tar ett vävnadsprov) för att se om det är en tumör. Gynekologen föreslår att Anna också skulle kunna göra ett DNA test, men informerar att det inte är meningsfullt att göra det om man inte vet huruvida det finns en muterad gen i familjen eller inte. Det visar sig att fastern med bröstcancer redan har testats positiv för en ganska ovanlig mutation i BRCA2-genen. Så gynekologen använder en del av provet från biopsin för att testa för en mutation i just den genen. När man diagnosticerar genetiska sjukdomar använder man ofta en teknik som heter Reverse Transcription Polymerase Chain Reaction (RT-PCR). RT-PCR är en teknik som gör det möjligt att kopiera upp en del av en mrna molekyl. Reverse betyder omvänd och det står för att det första man gör är att omvandla en RNA-sträng till DNA som man sedan multiplicerar genom en vanlig PCR-reaktion. PCR är en metod med vilken man kan kopiera upp stora mängder av ett visst DNAavsnitt och som också möjliggör att man i nästa steg kan ta reda på kvävebassekvensen för detta DNA. Fördelen är att RT-PCR använder mrna som mönster, vilket innebär att man kan studera den gen som verkligen uttrycks som ett protein i just den vävnad som man studerar, i det här fallet bröstet. En vanlig DNA undersökning är inte lika specifik. På Annas prov gör man nu en RTR-PCR som fångar in samma gen som hennes faster hade en mutation i och PCR-produkten man får sekvenseras för att ta reda på ordningen på kvävebaserna i DNA-sekvensen. Den sekvensen skall du nu använda för att identifiera mutationen som finns i Annas familj och för att se om den är närvarande i hennes prov. Mål 1: Identifiera vilken gen DNA-sekvensen tilhör och på vilken kromosom den sitter. Mål 2: Titta på hur proteinet som genen kodar för ser ut Mål 3: Ta fram information om den genen 1

2 Mål 1: Identifiera vilken gen Annas sekvens kommer från och se om den är muterad eller inte Sekvensen som kommer från sekvenseringen ser ut som följer: TGCACTAACAAGACAGCAAGTTCGTGCTTTGCAAGATGGTGCAGAGCTTTATGAAGCAGTGAAGAATGCA GCAGACCCAGCTTACCTTGAGTTATACTGAGTATTTGGCGTCCATCATCAGATTTATATTCTCTGTTAACAGA AGGAAAGAGATACAGAATTTATCATCTTGCAACTTCAAAATCTAAAAGTAAATCTGAAAGAGCTAACATAC AGTTAGCAGCGACAAAAAAAACTAGTATCAACAACTACCGGTTTCAGATGAAATTTTATTTCAGATTTACCA GCCACGGGAGCCCTTCACTTCAGCAAATTTTTAGATCCAGACTTTCAGCCATCTTGTTCTGA Du börjar med att använda BLAT (BLAST-Like Alignment Tool) som är en metod för att jämföra DNA-sekvenser. När du skickar in en sekvens till BLAT så jämför programmet din insända sekvens med alla andra som finns i databasen och ger dig sedan en lista över de sekvenser som är mest lik den du skickat in. Gå till sidan: cgi-bin/hgblat?db=mm2 Kopiera och klistra in sekvensen ovan i det vita fältet och tryck på submit. (Om du inte vet eller kommer på hur man kan väja och kopiera text i Acrobat reader kan du hämta sekvensen på min hemsida På adressen annas_sekvens.rtf) BLAT-resultatfönstret kommer att visa flera olika träffar i en lista. Du väljer den första, den som har störst antal träffar (score). Det fins också en del information här som att din sekvens var 350 baser lång och att den matchar en sekvens på kromosom 13. Sedan klickar du på browser för att få information om den kromosomala region som din sekvens befinner sig på. 2

3 På den bild som då dyker upp kan du se var på kromosomen din gen befinner sig. Den är rödmarkerad på översikten över kromosomen. Översikt över kromosomen Inskickade sekvensen Bästa träffen Jämförelse med samma sekvens från andra djur I fältet nedanför bilden på kromosomen ser du din sekvens och under den en alignment, en jämförelse mellan den sekvens du skickade in, med den bästa träff som fanns i databasen. För att förstå den här bilden är det viktigt att du kommer ihåg att gener bara är en liten del av arvsmassan. Man försöker fortfarande förstå vad resten egentligen är. Generna ligger utspridda bland långa strckor ickekodande DNA och en gen är oftast delad i olika delar, exoner, och emellan dem finns bitar av ickekodande DNA, introner. I figuren kan man se de alignade delarna som block (svarta eller röda) medan regioner utan DNA är en tunn linje. Eftersom det DNA som kom från Annas prov var från mrna så innehåller det bara exoner, bara uttryckt material. Som väntat är den gen som är närmast söksekvensen en känd bröstcancergen. Om man klickar på namnet för den kan man få information om den genen, vilket du skall göra i nästa steg. Men först: hur många exoner (svarta block) har BRCA2 i sökfönstret? Hur många har Annas sekvens? Kan du utifrån det dra någon slutsats om var mutationen i Annas och hennes fasters gen finns någonstans? 3

4 Mål 2: Ta reda på mer om BRCA2 1. Klicka på BRCA2 och läs om den. Hur tror man att BRCA2 fungerar? 2. Tryck på Treefam i den andra tabellen nedanför beskrivningen (under rubriken Sequence and Links to Tools and Databases). Nu kommer det upp en sida som bland annat innehåller en bild på ett släktskapsträd. Där har man räknat ut hur den mänskliga genen förhåller sig till samma gen hos andra djur. Om du pekar på BRAC2:s närmaste släkting så dyker det upp ett namn Pan troglodytes. Vad tror du att det är för djur? 3. Gå sedan till Den studie som beskrivs där handlade om en speciell folkgrupp. Hur kan det komma sig att man vill undersöka speciella folkgrupper på det här viset? 2. 4

5 Mål 2: Titta på BRAC2:s molekylära struktur Redan nu har du sett att molekylärbiologerna har en massa kraftfulla instrument på nätet som de kan använda sig av. Instrument som ligger öppna så att vem som helst som har intresse och kunskap kan använda sig av dem. Nu skall vi titta på en annan aspekt av detta. Många proteiner vet man inte bara hur de fungerar utan man har också bestämt genom röntgenkristallografi hur de ser ut. Den informationen finns också öppet på internet. Nu skall vi se om det finns någon struktur bestämd för BRCA2. Gå först till den stora databasen för proteiner Swissprot Skriv in BRCA2 human i sökrutan och tryck på Go. Sök upp BRCA2_HUMAN på den nya sidan som dyker upp och klicka på den länken. Nu dyker det upp ännu en sida. För att kuna se om det finns någon tredimensionell struktur så får vi leta oss ner på sidan till rubriken 3D structure databases (ganska långt ner på sidan). Under den rubriken tittar vi på raden som börjar med PDB och väljer länken längst till höger som ser ut så här: [>>]. Du hamnar nu på en sida med två bilder på proteinet. 1. Vad betyder de konstiga spiralerna och grejorna? 2. Vad kan man ha för nytta av att veta hur ett protein ser ut i 3D? Om du gör det här hemma kan du ladda hem programmet Rasmol och sedan när du installerat det titta på filen (som finns under view). Då kan du rotera molekylen som du vill och zooma obehindrat mm. Jag hoppas att detta har gett dig en förståelse av vilket stort forskningsområde molekylärbiologi är och vilka avancerade instrument som finns till hands för alla som har en dator med internet. 5

Människans genom Databaser ger kunskap om genetiska sjukdomar

Människans genom Databaser ger kunskap om genetiska sjukdomar Nationellt resurscentrum för biologi och bioteknik Övning i bioinformatik Människans genom Databaser ger kunskap om genetiska sjukdomar Många molekylärbiologiska databaser och program är fritt tillgängliga

Läs mer

Patientinformation ärftlig cancer

Patientinformation ärftlig cancer Patientinformation ärftlig cancer Ärftlig bröst- och äggstockscancer 1 MEFinfo_BC 1 Onkogenetiska mottagningen Universitetssjukhuset i Lund Adresser till onkogenetiska mottagningar i Sverige Lund Göteborg

Läs mer

Patientinformation ärftlig cancer

Patientinformation ärftlig cancer Patientinformation ärftlig cancer Misstänkt ärftlig bröstcancer 1 Universitetssjukhuset i Lund Adresser till onkogenetiska mottagningar i Sverige Lund Göteborg Linköping Stockholm Uppsala Umeå Genetiska

Läs mer

Vad händer i ett genetiskt laboratorium?

Vad händer i ett genetiskt laboratorium? 12 utveckla nya metoder eller låta sådana prover delta i kvalitetskontrollprogram, såvida inte patienten har uttryckt att man inte vill att ens prov ska vara del av sådan verksamhet. Som alla andra sparade

Läs mer

Övning i bioinformatik

Övning i bioinformatik Övning: Släktträd sid 1 Övning i bioinformatik Släktträd med hjälp av databaser och program från Internet Det finns databaser som är fritt tillgängliga och innehåller nukleotid- och amino-syrasekvenser

Läs mer

Klipp-och-klistra DNA: fixa mutationen med gen editering DNA, RNA och Protein

Klipp-och-klistra DNA: fixa mutationen med gen editering DNA, RNA och Protein Huntingtons sjukdom forsknings nyheter. I klartext Skriven av forskare För de globala HS medlemmarna. Klipp-och-klistra DNA: fixa mutationen med gen editering Forskare gör exakta ändringar av DNA i ett

Läs mer

CSI - Katte DNA-fingerprinting Välkänt från polisarbete. Metoden föddes 1985 i England. Från början krävdes stora mängder DNA, men nu funkar även mycket små mängder. DNA-sekvens Användning Metoden

Läs mer

Polymerase Chain Reaction

Polymerase Chain Reaction Polymerase Chain Reaction The Polymerase Chain Reaction Molekylärbiologisk metodik T3 ht 11 Märit Karls Kunskapsmål för detta avsnitt Från kursplan: Studenten skall kunna: förklara grundläggande principer

Läs mer

Du hittar en knöl vad händer sen?

Du hittar en knöl vad händer sen? Du hittar en knöl vad händer sen? Följ med på en resa från provtagning till provsvar. Vi har besökt punktionsmottagningen och patologiska/cytologiska kliniken vid Skånes universitetssjukhus i Lund. 1 På

Läs mer

Datorer och matematik hjälper oss att motverka sjukdomar

Datorer och matematik hjälper oss att motverka sjukdomar Datorer och matematik hjälper oss att motverka sjukdomar Adam Ameur Bioinformatiker Lund, 26e November 2014 Introduktion till bioinformatik Bioinformatik - en tvärvetenskaplig disciplin där algoritmer

Läs mer

FAKTABLAD Genetiskt provinsamling i rovdjursinventeringen

FAKTABLAD Genetiskt provinsamling i rovdjursinventeringen 1(5) FAKTABLAD Genetiskt provinsamling i rovdjursinventeringen Målsättning Syftet med detta faktablad är att ge en översikt av den genetiska provtagningen som tillämpas vid rovdjursinventeringen i Sverige

Läs mer

Skapa egna övningar med ProProfs

Skapa egna övningar med ProProfs IT-körkort för språklärare Modul 10 Skapa egna övningar med ProProfs ProProfs kan användas till mycket och finns i två olika versioner: en grundversion som är gratis och en mer avancerad som kostar pengar.

Läs mer

Tidiga erfarenheter av arvets mysterier

Tidiga erfarenheter av arvets mysterier Cellens genetik Cellen Växtcellen Växtcellen Tidiga erfarenheter av arvets mysterier Artförädling genom riktad avel Religiösa förbud mot syskongiftemål Redan de gamla grekerna.. Aristoteles ~350 år före

Läs mer

Hundar hjälper oss att förstå människans sjukdomar. Kerstin Lindblad-Toh

Hundar hjälper oss att förstå människans sjukdomar. Kerstin Lindblad-Toh Hundar hjälper oss att förstå människans sjukdomar Kerstin Lindblad-Toh Målsättning med min forskning Att hitta människors sjukdomsgener via: - djurmodeller - en bättre förståelse av arvsmassan - storskalig

Läs mer

En sax för gener kan få Nobelpris

En sax för gener kan få Nobelpris En utskrift från Dagens Nyheters nätupplaga, DN.se, 2015 09 28 11:56:30 Artikelns ursprungsadress: http://www.dn.se/nyheter/vetenskap/en sax for gener kan fa nobelpris/ En sax för gener kan få Nobelpris

Läs mer

Onkogenetisk regionmottagning i Linköping. Marie Stenmark Askmalm Sigrun Liedgren Lilianne Ferraud Madelene Jansson Ann-Charlotte Isaksson

Onkogenetisk regionmottagning i Linköping. Marie Stenmark Askmalm Sigrun Liedgren Lilianne Ferraud Madelene Jansson Ann-Charlotte Isaksson Onkogenetisk regionmottagning i Linköping Marie Stenmark Askmalm Sigrun Liedgren Lilianne Ferraud Madelene Jansson Ann-Charlotte Isaksson Dagordning Organisation Mål för onkogenetiska mottagningen Definition

Läs mer

Kursvärdering. Denna manual beskriver hur du kan skapa en mapp i Fronter som heter Kursvärdering där du ladda upp reslutat från kursutvärderingar.

Kursvärdering. Denna manual beskriver hur du kan skapa en mapp i Fronter som heter Kursvärdering där du ladda upp reslutat från kursutvärderingar. Kursvärdering Denna manual beskriver hur du kan skapa en mapp i Fronter som heter Kursvärdering där du ladda upp reslutat från kursutvärderingar. Här finns även tips på några olika sätt att skapa en kursvärdering

Läs mer

DNA-labb / Plasmidlabb

DNA-labb / Plasmidlabb Översikt DNA-labb Plasmidlabb Preparation och analys av -DNA från Escherichia coli Varför är vi här idag? Kort introduktion till biokemi och rekombinant DNA- teknologi Vad skall vi göra idag? Genomgång

Läs mer

Moodle2 STUDENTMANUAL

Moodle2 STUDENTMANUAL Moodle2 STUDENTMANUAL Moodle är en lärplattform med hjälp av vilket du kan kommunicera, dela med dig av information och upprätthålla kontakten med lärarna, handledarna och de andra kursdeltagarna. För

Läs mer

IT-körkort för språklärare. Modul 2: Blogg

IT-körkort för språklärare. Modul 2: Blogg IT-körkort för språklärare Modul 2: Blogg Innehåll Gloslista 2 Logga in på bloggen (punkt 1-3) 3 Skapa och redigera sidor och undersidor (punkt 4 och 5) 4 Infoga dokument (punkt 6 och 7) 7 Skapa inlägg

Läs mer

Erik Eriksson VMD Enheten för Bakteriologi

Erik Eriksson VMD Enheten för Bakteriologi Diagnostik VTEC/EHEC Erik Eriksson VMD Enheten för Bakteriologi SVA Tänker prata om VTEC / EHEC Sjukdomsframkallande faktorer PCR Magnetiska kulor (Immunomagnetisk separation) Diagnostik de vanligaste

Läs mer

Kommentar [k1]: Behöver vi kommentera det som finns till höger ovanför schematyp?

Kommentar [k1]: Behöver vi kommentera det som finns till höger ovanför schematyp? Webbklienten Webben är uppbyggd med hjälp av flikar. När du öppnar lärosätets schemasida finns ett antal flikar som syns på webben för alla. Om du loggar in får du ytterligare flikar och möjligheter till

Läs mer

Läkemedelsprövningar och slutsatser

Läkemedelsprövningar och slutsatser Huntingtons sjukdom forsknings nyheter. I klartext Skriven av forskare För de globala HS medlemmarna. TRACK-HD avslöjar betydande förändringar hos pre-symtomatiska mutationsbärare och personer med HS Ettårsrapporten

Läs mer

Kom igång. Readyonet Lathund för enkelt admin. Logga in Skriv in adressen till din webbsida följt av /login. Exempel: www.minsajt.

Kom igång. Readyonet Lathund för enkelt admin. Logga in Skriv in adressen till din webbsida följt av /login. Exempel: www.minsajt. Kom igång Logga in Skriv in adressen till din webbsida följt av /login. Exempel: www.minsajt.se/login Nu dyker en ruta upp på skärmen. Fyll i ditt användarnamn och lösenord och klicka på "logga in". Nu

Läs mer

Medicin A, Medicinsk temakurs 2, 30 högskolepoäng, Tema reproduktion och utveckling. Skriftlig tentamen 10 oktober 2011

Medicin A, Medicinsk temakurs 2, 30 högskolepoäng, Tema reproduktion och utveckling. Skriftlig tentamen 10 oktober 2011 Medicin A, Medicinsk temakurs 2, 30 högskolepoäng, Tema reproduktion och utveckling Skriftlig tentamen 10 oktober 2011 1. DNA:t i arvsmassan lagrar informationen om de RNA och proteiner som cellen behöver

Läs mer

AIF:arens guide till cyberrymden

AIF:arens guide till cyberrymden AIF:arens guide till cyberrymden www.andrarumsif.se Reviderad 2008-04-14 1 Välkommen till www.andrarumsif.se:s användarmanual! Denna manual ska inte ses som en fullständig manual till hemsidan utan snarare

Läs mer

Kromosomer, celldelning och förökning

Kromosomer, celldelning och förökning Kromosomer, celldelning och förökning Kromosomen Hur ligger DNA lagrat? DNA 2 nm Prokaryota celler har vanligtvis endast en kromosom. I eukaryota celler finns alltid mer än en DNA-molekyl som bildar olika

Läs mer

3. Hämta och infoga bilder

3. Hämta och infoga bilder Sida 1 av 8 Lektion 1: sida 4 av 4 «Sida 3 av 4 Till kursens framsida 3. Hämta och infoga bilder Nu vet vi ju hur man sätter in text i sin sida. Men hur gör man med bilder? Det är inte svårt alls! Det

Läs mer

Facit tds kapitel 18

Facit tds kapitel 18 Facit tds kapitel 18 Testa dig själv 18.1 1. Arvsanlagen finns i cellkärnan. Inför celldelningen samlas de i kromosomer. 2. Det kemiska ämne som bär på arvet kallas DNA. 3. Instruktionerna i DNA är ritningar,

Läs mer

DNA- analyser kan användas för att

DNA- analyser kan användas för att Genteknik DNA- analyser kan användas för att -identifiera och koppla misstänkta till brottsplats -fria oskyldigt utpekade och oskyldigt fällda -personidentifiering vid masskatastrofer, krig, massgravar

Läs mer

Manual för lokalredaktörer villaagarna.se

Manual för lokalredaktörer villaagarna.se Manual för lokalredaktörer villaagarna.se Version 2 Villaägarnas Riksförbund Sollentuna 2011 Innehåll Redigera befintlig sida... 3 Skriva text eller klistra in kopierad text... 5 Rubriker i brödtext...

Läs mer

Skapa innehåll. Logga in och administrera hemsidan. Inloggningslänk: www.alvsbyn.se/wp-admin. Byta lösenord

Skapa innehåll. Logga in och administrera hemsidan. Inloggningslänk: www.alvsbyn.se/wp-admin. Byta lösenord Sidan 1 av 9 Logga in och administrera hemsidan Inloggningslänk: www.alvsbyn.se/wp-admin Byta lösenord 2. Klicka på Profil 3. Längst nere hittar du två fält: Nytt lösenord och Bekräfta nytt lösenord. Fyll

Läs mer

Välkommen till live broadcasting med Bambuser via nätet. skaffa eget konto (gratis) genom att gå till: http://bambuser.com

Välkommen till live broadcasting med Bambuser via nätet. skaffa eget konto (gratis) genom att gå till: http://bambuser.com Välkommen till live broadcasting med Bambuser via nätet. skaffa eget konto (gratis) genom att gå till: http://bambuser.com 1 2 3 Manual gjord av Liv Zetterling 2010 Har du gjort 1-3 så har du också gjort

Läs mer

Installera din WordPress med 9 enkla steg

Installera din WordPress med 9 enkla steg Installera din WordPress med 9 enkla steg Den här artikeln förutsätter att du har satt upp en webbserver eller har köpt ett webbhotell där du kan placera din nya WordPress hemsida. Om du inte har det,

Läs mer

Guide till Mynewsdesk Hosted Newsroom - Kom igång och spegla ditt pressrum!

Guide till Mynewsdesk Hosted Newsroom - Kom igång och spegla ditt pressrum! Guide till Mynewsdesk Hosted Newsroom - Kom igång och spegla ditt pressrum! Hur du implementerar ditt Hosted Newsroom I den här guiden kan du läsa hur du skapar ert Hosted Newsroom ert pressrum på er egna

Läs mer

VÄGLEDNING Hur man fyller i Excel-bladet

VÄGLEDNING Hur man fyller i Excel-bladet Europeiska kommissionen GENERALDIREKTORAT GD MILJÖ GD KLIMATPOLITIK VÄGLEDNING Hur man fyller i Excel-bladet Europeiska kommissionen, B-1049 Bryssel Belgien, tfn: 32 22991111 1 INNEHÅLLSFÖRTECKNING 1 INNEHÅLLSFÖRTECKNING...

Läs mer

Lärarhandledning gällande sidorna 6-27 Inledning: (länk) Läromedlet har sju kapitel: 5. Celler och bioteknik

Lärarhandledning gällande sidorna 6-27 Inledning: (länk) Läromedlet har sju kapitel: 5. Celler och bioteknik Senast uppdaterad 2012-12-09 55 Naturkunskap 1b Lärarhandledning gällande sidorna 6-27 Inledning: (länk) Celler och bioteknik C apensis Förlag AB Läromedlet har sju kapitel: 1. Ett hållbart samhälle 2.

Läs mer

Daniel Clarhed 2006-06-22

Daniel Clarhed 2006-06-22 Avdelningen för Byggnadsmekanik Daniel Clarhed PM för Byggnadsmekaniks nya hemsida 2006-06-22 Byggnadsmekaniks nya hemsida I juli kommer Byggnadsmekanik få en ny hemsida, stöpt i det LTH-gemensamma utseendet.

Läs mer

FrontPage Express. Ämne: Datorkunskap (Internet) Handledare: Thomas Granhäll

FrontPage Express. Ämne: Datorkunskap (Internet) Handledare: Thomas Granhäll FrontPage Express I programpaketet Internet Explorer 4.0 och 5.0 ingår också FrontPage Express som installeras vid en fullständig installation. Det är ett program som man kan använda för att skapa egna

Läs mer

Visma Proceedo. Att logga in - Manual. Version 1.3 / 140414 1

Visma Proceedo. Att logga in - Manual. Version 1.3 / 140414 1 Visma Proceedo Att logga in - Manual Version 1.3 / 140414 1 Innehållsförteckning 1) INLOGGNING VIA VERKTYG OCH SYSTEM... 3 2) INTERNET EXPLORER... 6 2.1 Java... 6 2.2 Popup-fönster... 8 2.3 Browser, 32-

Läs mer

Vad är en genetisk undersökning?

Vad är en genetisk undersökning? 12 Vad är en genetisk undersökning? Originalet framtaget av Guy s and St Thomas Hospital, London, UK, och London IDEAS Genetic Knowledge Park, januari 2007. Detta arbete är finansierat av EuroGentest,

Läs mer

Rening av proteiner: hur och varför?

Rening av proteiner: hur och varför? Rening av proteiner: hur och varför? (och lite biologiska grunder) Joakim Norbeck! norbeck@chalmers.se! Grunder! Plasmider! Protein-rening! Detektion!!!!! Mest relevanta sidor i "Cell" är 510-518 & 532-552!

Läs mer

Anvisningar om etwinning-platsen

Anvisningar om etwinning-platsen Välkommen Anvisningar om etwinning-platsen Den här vägledningen har gjorts för Läraradministratörer som är nya på etwinning-platsen. Den är till hjälp för dig att: - Få tillgång din etwinning-plats - Redigera

Läs mer

JANINA WARENHOLT Molekylär patologi LUND

JANINA WARENHOLT Molekylär patologi LUND MPCR Multiplex Polymerase Chain Reaktion JANINA WARENHOLT Molekylär patologi LUND Vad är multiplex PCR Variant av PCR Möjliggör samtidigt att amplifiera (masskopiera) många målsekvenser i en enda reaktion.

Läs mer

Manual för lokalredaktörer villaagarna.se

Manual för lokalredaktörer villaagarna.se Manual för lokalredaktörer villaagarna.se Version 1 Villaägarnas Riksförbund Sollentuna 2011 Postadress Besöksdress Telefon Fax E-post Hemsida Box 7118, 192 07 Sollentuna Johan Berndes väg 8-10 010-750

Läs mer

Manual, Etikett- & Faktabladsgenerator

Manual, Etikett- & Faktabladsgenerator Manual, Etikett- & Faktabladsgenerator http://www.easylabelcreator.se/customer/lantmannen/ Innehållsförteckning Om tjänsten... 2 Snabbguide... 3 Inloggning... 5 Skapa konto... 5 Glömt användarnamn... 6

Läs mer

Administration av asrp.se

Administration av asrp.se Administration av asrp.se Inloggning sker från: http://www.asrp.se/cms/admin_login.php Avdelningar/rubriker: - Sidor - Användare - Galleri - Övrigt - Annonser - Hästar - Faktablad - Logga ut SIDOR Under

Läs mer

Tentamen Introduktion till Bioteknik och Bioinformatik 5hp 1MB101. 23 oktober, 2008 Kl. 9-14 Uppsala universitet

Tentamen Introduktion till Bioteknik och Bioinformatik 5hp 1MB101. 23 oktober, 2008 Kl. 9-14 Uppsala universitet Tentamen Introduktion till Bioteknik och Bioinformatik 5hp 1MB101 23 oktober, 2008 Kl. 9-14 Uppsala universitet Svara på svenska eller engelska. Skriv ditt namn på varje sida För resultat, kontakta Ylva

Läs mer

ANVÄNDARMANUAL FÖR WORDPRESS

ANVÄNDARMANUAL FÖR WORDPRESS FÖR WORDPRESS Surfa in på http://klubb.seko.se/< din sida >/wp-admin/ vet du inte vad < din sida > är kan du logga in direkt på http://klubb.seko.se/wp-admin 3. Fyll i ert användarnamn 3. Fyll även i ert

Läs mer

Biologi breddning (mikrobiologi och immunologi) Kurskod: BI 1203-A Poäng: 50 Program: Förkunskapskrav: Biologi A och Biologi B

Biologi breddning (mikrobiologi och immunologi) Kurskod: BI 1203-A Poäng: 50 Program: Förkunskapskrav: Biologi A och Biologi B KURSBESKRIVNING Ämne: Biologi Kurs: Biologi breddning (mikrobiologi och immunologi) Kurskod: BI 1203-A Poäng: 50 Program: NV Förkunskapskrav: Biologi A och Biologi B Mål Kurserna Biologi breddning A och

Läs mer

Lathund FE-edit i Typo3

Lathund FE-edit i Typo3 1(6) Lathund Front-end-editing (FE-edit) i Typo3 Front-end-editing (FE-edit) är ett förenklat sätt att redigera innehåll med Typo3. Helt kort går det ut på att man redigerar innehållet medan man surfar

Läs mer

Att få. är inte en. Vad sa de? Cancer? Vad händer nu?

Att få. är inte en. Vad sa de? Cancer? Vad händer nu? Det krävs ett test Att få diagnosen bröstcancer Bröstcancer är inte en sjukdom Vad sa de? Cancer? Vad händer nu? Det går nog inte att vara förberedd på hur man kommer att reagera när man får beskedet att

Läs mer

Vad är en genetisk undersökning? Information för patienter och föräldrar

Vad är en genetisk undersökning? Information för patienter och föräldrar Vad är en genetisk undersökning? Information för patienter och föräldrar 2 Vad är en Genetisk Undersökning? Denna informationsskrift berättar vad en genetisk undersökning är, varför Du skall överväga en

Läs mer

Lycka till! Omtentamen. Kursens namn: Medicin C, Tumörbiologi Kursens kod: MC1728 Kursansvarig: Anna Göthlin Eremo

Lycka till! Omtentamen. Kursens namn: Medicin C, Tumörbiologi Kursens kod: MC1728 Kursansvarig: Anna Göthlin Eremo Omtentamen Kursens namn: Medicin C, Tumörbiologi Kursens kod: MC1728 Kursansvarig: Anna Göthlin Eremo Datum: 2012-11-24 Skrivtid: 4 timmar Poängfördelning: Karin Franzén Sabina Davidsson Pia Wegman Marike

Läs mer

Epigenetikens biokemi, eller Kemisk modifiering av DNA och histonproteiner för att styra genuttryck

Epigenetikens biokemi, eller Kemisk modifiering av DNA och histonproteiner för att styra genuttryck Epigenetikens biokemi, eller Kemisk modifiering av DNA och histonproteiner för att styra genuttryck Astrid Gräslund Inst. för biokemi och biofysik Stockholms Universitet Föreläsning, Värnamo, 131016 Epigenetik

Läs mer

Skapa aktivitet för nätverksmotorer

Skapa aktivitet för nätverksmotorer Skapa aktivitet för nätverksmotorer För att skapa en aktivitet behöver du vara inloggad på nätverkets hemsida. När du skapar en aktivitet måste du som motor ansöka om att få visa den i gemensamma På Gångkalendern

Läs mer

Import från databaser till RefWorks

Import från databaser till RefWorks 2014-10-13 Linköpings universitetsbibliotek Import från databaser till RefWorks Instruktioner för att importera referenser från fler databaser är tillgängliga när du är inloggad i RefWorks under menyvalet:

Läs mer

Instruktion för Betanias Kundportal

Instruktion för Betanias Kundportal Instruktion för Betanias Kundportal Att bli användare När er organisation godkänt att bli användare av systemet får du ett välkomstmeddelande första gången vi skickar en rekvisition till dig. Klicka eller

Läs mer

Personalsupport. Medicinska fakulteten, Lunds universitet. Textredigeraren. Moodle version 2.7.1

Personalsupport. Medicinska fakulteten, Lunds universitet. Textredigeraren. Moodle version 2.7.1 Personalsupport Medicinska fakulteten, Lunds universitet Textredigeraren Moodle version 2.7.1 Lars Rundgren, 2012-2014 Moodle 2.7.1 Textredigeraren Textredigeraren... 3 Nya ikoner i textredigeraren...

Läs mer

Patientinformation ärftlig cancer

Patientinformation ärftlig cancer Patientinformation ärftlig cancer Hereditär Nonpolyposis Colorektal Cancer HNPCC Tjocktarms- och livmodercancer 1 Onkogenetiska mottagningen Universitetssjukhuset i Lund Adresser till onkogenetiska mottagningar

Läs mer

Regionala riktlinjer för utredning av patienter med misstänkt ärftlig demens i Region Skåne

Regionala riktlinjer för utredning av patienter med misstänkt ärftlig demens i Region Skåne Regionala riktlinjer för utredning av patienter med misstänkt ärftlig demens i Region Skåne Hemsida: www.skane.se/vardochriktlinjer Fastställt 2013-05-30 E-post: vardochriktlinjer@skane.se Giltigt till

Läs mer

tisdag 8 oktober 13 Carl Von Linné

tisdag 8 oktober 13 Carl Von Linné Carl Von Linné Carl Von Linné Svensk Botanikprofessor. Carl Von Linné Svensk Botanikprofessor. Utformade ett taxonomi system. Carl Von Linné Svensk Botanikprofessor. Utformade ett taxonomi system. Taxonomi:

Läs mer

Arvet och DNA. Genetik och genteknik

Arvet och DNA. Genetik och genteknik Arvet och DNA Genetik och genteknik Genetik Du är inte en kopia utav någon av dina föräldrar utan en unik blandning av egenskaper från båda dina föräldrar. Genetik är den del av biologin som handlar om

Läs mer

Kom igång med TIS-Office

Kom igång med TIS-Office Kom igång med TIS-Office Denna guide hjälper dig att komma igång med TIS-Office, mer information om hur man använder programmet finns i manualer på TIS-Office CD-skivan och i den inbyggda hjälpfunktionen

Läs mer

Guide : Skapa en publik kurshemsida i Mondo

Guide : Skapa en publik kurshemsida i Mondo Guide : Skapa en publik kurshemsida i Mondo Denna guide förklarar hur du skapar en publik kurshemsida i Mondo. En publik kurshemsida i Mondo är i princip inget mer än en vanlig Mondosajt med undantaget

Läs mer

Juni 2003 PlanCon Viewer Handledning PlanCon PROJEKT

Juni 2003 PlanCon Viewer Handledning PlanCon PROJEKT PlanCon Viewer Med PlanCon Viewer kan du som inte har PlanCon öppna PlanCon projekt (*.prj) och skriva ut dessa. Inga ändringar i projektet kan göras. Filtreringar, sorteringar och vissa ändringar i utseendet

Läs mer

Google apps for education Classroom - Pedagoger. Lathund 2015 fritt omarbetad av Martin Andersson efter grund av Niklas Nord från Arvika kommun

Google apps for education Classroom - Pedagoger. Lathund 2015 fritt omarbetad av Martin Andersson efter grund av Niklas Nord från Arvika kommun Google apps for education Classroom - Pedagoger Lathund 2015 fritt omarbetad av Martin Andersson efter grund av Niklas Nord från Arvika kommun Google Classroom i Österåker Sida 2 Google Classroom länk

Läs mer

TENTAMEN för KMB056 - Molekylär Bioteknik

TENTAMEN för KMB056 - Molekylär Bioteknik TENTAMEN för KMB056 - Molekylär Bioteknik 2013-01-15 em (V-salar) Totalt 60 poäng (Frågor 1-8: Joakim Norbeck, totalt 45 poäng; Frågor 9-12: Lisbeth Olsson, totalt 15 poäng). Betygsgränser: 30-38.5 poäng

Läs mer

Lathund: Skapa egna ansökningsformulär

Lathund: Skapa egna ansökningsformulär INFORMATION TILL FOLKHÖGSKOLORNA Lathund: Skapa egna ansökningsformulär Folkhögskola.nu har utvecklat en funktion där skoladministratörer kan skapa unika digitala ansökningsformulär för olika kurser. Genom

Läs mer

Schemalätt 6.0 Installationsanvisning

Schemalätt 6.0 Installationsanvisning Schemalätt 6.0 Installationsanvisning Inledning Här följer en kort instruktion över hur du som ny kund installerar och aktiverar Schemalätt 6.0. Observera att Schemalätt 6.0 är ett Windows program och

Läs mer

5HVLVWHQVWDEHOO 'DWD3DUWQHU. Er partner inom data

5HVLVWHQVWDEHOO 'DWD3DUWQHU. Er partner inom data 5HVLVWHQVWDEHOO Tack för att du valde programmet 5HVLVWHQVWDEHOO! Vi hoppas att programmet ska vara till stor hjälp i ditt arbete. Har du synpunkter på programmet är du mycket välkommen att höra av dig

Läs mer

Grundläggande funktioner i CMS ifrån Argonova Systems, 2011.

Grundläggande funktioner i CMS ifrån Argonova Systems, 2011. Grundläggande funktioner i CMS ifrån Argonova Systems, 2011. Syfte Detta dokument tar upp grundläggande funktioner i Argonova Systems CMS i syfte att förbereda och stödja användaren, vid sidan av och inför

Läs mer

Tumörbiologi. Michael Mints, MD Institutionen för onkologi-patologi, KI

Tumörbiologi. Michael Mints, MD Institutionen för onkologi-patologi, KI Tumörbiologi Michael Mints, MD Institutionen för onkologi-patologi, KI Mål Förstå vad som skiljer cancerceller från normala celler Förstå idéer bakom aktuella och framtida behandlingar Carcinogenes Initiatormutation

Läs mer

Manual: Skapa egna ansökningsformulär

Manual: Skapa egna ansökningsformulär INFORMATION TILL FOLKHÖGSKOLORNA Manual: Skapa egna ansökningsformulär Alla folkhögskolor kan skapa egna digitala ansökningsformulär genom en funktion på Folkhögskola.nu. Genom att logga in på www.folkhogskola.nu/admin

Läs mer

För att öppna galleriet, ange adressen http://www.galleri.storsjobygdensfotoklubb.se

För att öppna galleriet, ange adressen http://www.galleri.storsjobygdensfotoklubb.se Använda Bildgalleriet För att öppna galleriet, ange adressen http://www.galleri.storsjobygdensfotoklubb.se Logga in För att skapa och administrera album för galleriet ska du logga in. Användarnamn är användarens

Läs mer

IMS-manual för Netpub

IMS-manual för Netpub IMS-manual för Netpub * IMS = image management system = på klar och (nästan) redig svenska bildhanteringssystem för Svenska Yles webbpubliceringsverktyg Netpub Innehåll: Sidan: 1. För vem är manualen?

Läs mer

Le Bureau.se - WordPress manual

Le Bureau.se - WordPress manual Le Bureau.se - WordPress manual Logga in i WordPress för att administrera hemsidan. Skapa ett inlägg inlägg i nyhetsbloggen. Skapa ett nytt case till portfolion. Redigera en sida. Redigera sidfoten. Byt

Läs mer

TENTAMEN för KMB056 - Molekylär Bioteknik

TENTAMEN för KMB056 - Molekylär Bioteknik TENTAMEN för KMB056 - Molekylär Bioteknik 2012-10-23 em (V-salar) Totalt 60 poäng (Frågor 1-9: Joakim Norbeck, totalt 45 poäng; Frågor 10-11: Lisbeth Olsson, totalt 15 poäng). Betygsgränser: 30 poäng =

Läs mer

Lathund för publicering i KI Commons wikitjänst

Lathund för publicering i KI Commons wikitjänst 1 Lathund för publicering i KI Commons wikitjänst (juni 2013) Skapa ett konto 1. Gå till webbplatsen: http://www.kicommons.wikispaces.net/ och klicka på Join längst upp till höger i webbläsarfönstret.

Läs mer

JAN/2015 ALLT OM DÖRRAR. TEMA: Mått & Fakta

JAN/2015 ALLT OM DÖRRAR. TEMA: Mått & Fakta JAN/2015 ALLT OM DÖRRAR TEMA: Mått & Fakta TEMA: MÅTT & FAKTA För professionella användare, såsom återförsäljare, arkitekter och ingenjörer har vi en egen avdelning på vår hemsida som heter just Professionella.

Läs mer

HANDBOK NYHETER (inkl. logga och pdf) I OEW

HANDBOK NYHETER (inkl. logga och pdf) I OEW DEN HÄR INSTRUKTIONEN BEHANDLAR; Att skapa en nyhet - använda en logga i nyheten - använda en pdf-fil i nyheten ATT SKAPA EN NYHET 1. Logga in i OEW 2. Om du ska använda en logga eller en pdf-fil i nyheten

Läs mer

Manual. Att skapa lokala Facebooksidor

Manual. Att skapa lokala Facebooksidor Manual Att skapa lokala Facebooksidor Skapa en Facebooksida 1. Logga in på Facebook med din vanliga, privata inloggning. När du har skapat sidan kommer du alltid att publicera på sidan som just sida, och

Läs mer

Genteknikens utveckling 2012

Genteknikens utveckling 2012 Dnr 022/2013-3.1.1. Genteknikens utveckling 2012 Sammanställd av kanslichef Marie Nyman och vetenskapsjournalisten Natalie von der Lehr Referaten bygger på vetenskapliga artiklar som publicerats i följande

Läs mer

Innehållsförteckning. Användaradministration 2. Notiser 10. Nyheter 11. Meddelande 12. Annonsering 14. Design 15. Inställningar 18.

Innehållsförteckning. Användaradministration 2. Notiser 10. Nyheter 11. Meddelande 12. Annonsering 14. Design 15. Inställningar 18. Innehållsförteckning Avdelning Sida Användaradministration 2 Notiser 10 Nyheter 11 Meddelande 12 Annonsering 14 Design 15 Inställningar 18 Profilsida 19 1 Användaradministration Under Användaradministration

Läs mer

Hur man skapa en Wiki.

Hur man skapa en Wiki. Hur man skapa en Wiki. Ordet wiki (i t.e.x Wikipedia) kommer från Hawaiian och betyder snabbt. Kortfattat kan man säga att en wik i är en webbplats där alla enkelt kan publicera och redigera material när

Läs mer

Manual Attestering av fakturor på webb

Manual Attestering av fakturor på webb Manual Attestering av fakturor på webb Förutsättningar...2 Beställningsreferens...3 Mail och inloggning...3 Sakattestera...5 Alternativ 1 Fakturan betalas av 1 projekt... 9 Alternativ 2- Fakturan betalas

Läs mer

En värld på nätet Facebook ht 2010

En värld på nätet Facebook ht 2010 En värld på nätet Facebook ht 2010 Under det här kurstillfället ska vi bekanta oss närmare med Facebook. Alla har fått en första grundläggande manual till Facebook. Med hjälp av den och det här dokumentet

Läs mer

GUIDE REGISTRERA ETT EVENEMANG PÅ EVENEMANGSGUIDEN Gå in på www.eskilstuna.se/evenemang och klicka på knappen Registrera ett evenemang.

GUIDE REGISTRERA ETT EVENEMANG PÅ EVENEMANGSGUIDEN Gå in på www.eskilstuna.se/evenemang och klicka på knappen Registrera ett evenemang. GUIDE REGISTRERA ETT EVENEMANG PÅ EVENEMANGSGUIDEN Gå in på www.eskilstuna.se/evenemang och klicka på knappen Registrera ett evenemang. OBS!! Viktig information innan du börjar att fylla i registreringsformuläret!

Läs mer

Vid problem med programmet kontakta alltid C/W Cadware AB på telefon 08-522 04 640

Vid problem med programmet kontakta alltid C/W Cadware AB på telefon 08-522 04 640 Installation av CW KeyDesign/DoorDesign Detta program görs och underhålls av C/W CadWare AB. CW KeyDesign/Doordesign säljs alltid med underhållsavtal med telefonsupport samt programuppdateringar på websidan:

Läs mer

PROJEKTDIREKTIV. Genomizer. Dokumenthistorik version datum utförda förändringar utförda av granskad

PROJEKTDIREKTIV. Genomizer. Dokumenthistorik version datum utförda förändringar utförda av granskad PROJEKTDIREKTIV Genomizer Dokumenthistorik version datum utförda förändringar utförda av granskad 1.1 20140410 Formulerat om kraven på leverabeln Teknisk dokumentation, samt ändrat formateringen av punkterna

Läs mer

Användarmanual 1.x. RIW Software Techn AB info@riwsoftware.com telefon: 08-766 70 20 fax: 08-766 70 05 www.riwsoftware.com

Användarmanual 1.x. RIW Software Techn AB info@riwsoftware.com telefon: 08-766 70 20 fax: 08-766 70 05 www.riwsoftware.com Användarmanual 1.x Page 2 of 18 Innehållsförteckning BookitWise... 3 Systemkrav... 3 Logga in... 4 Kalenderförklaring... 5 Enkelt bokningsformulär... 6 Anvancerat bokningsformulär... 7 Avancerat Lägg till

Läs mer

Förbered och planera bildmanuset

Förbered och planera bildmanuset Del av Kapitel 4: Förbered och planera bildmanuset I detta kapitel kommer du att: Omvandla ditt manus till ett bildmanus Lägga till bildmanusguider Planera för de bilder som ska visas på skärmen Skriva

Läs mer

I valfri objektlista börjar du med att markera det objekt du vill arbeta med. Klicka på Utför, välj Matrix och därefter Skicka order.

I valfri objektlista börjar du med att markera det objekt du vill arbeta med. Klicka på Utför, välj Matrix och därefter Skicka order. Matrix Order Med den kostnadsfria tilläggsmodulen Matrix Order kan du enkelt beställa 2D- och 3D-planritningar samt virtuella visningar från Matrix direkt i Capitex Säljstöd. Välj objekt och bilder att

Läs mer

Mitokondriella sjukdomar. Gittan Kollberg Avd för klinisk kemi Sahlgrenska Sjukhuset Göteborg

Mitokondriella sjukdomar. Gittan Kollberg Avd för klinisk kemi Sahlgrenska Sjukhuset Göteborg Mitokondriella sjukdomar Gittan Kollberg Avd för klinisk kemi Sahlgrenska Sjukhuset Göteborg Mitokondriell sjukdom Definition Oxidativ fosforylering Genetik och ärftlighet Biokemisk utredning av mitokondriefunktion

Läs mer

Manual Attestering av fakturor på webb

Manual Attestering av fakturor på webb Manual Attestering av fakturor på webb Förutsättningar...2 Beställningsreferens...3 Mail och inloggning...3 Sakattestera...5 Alternativ 1 Fakturan betalas av 1 projekt... 9 Alternativ 2- Fakturan betalas

Läs mer

Manual för webbpublicering. Enköpings kommun

Manual för webbpublicering. Enköpings kommun Manual för webbpublicering Enköpings kommun Innehåll ATT LOGGA IN I SWWWING 3 Inloggningsrutan 3 GRÄNSSNITTET 4 Filhanteraren 4 Content Management 4 Verktyget Notify - Dags att uppdatera 4 SKAPA OCH REDIGERA

Läs mer

Manual - rekryterare

Manual - rekryterare Manual - rekryterare Version 1.0 Innehållsförteckning Innehållsförteckning... 1 Skapa annons & Hantera kandidater/cv:n... 2 Ditt skrivbord - förstasidan... 2 Snabbsökning av CV eller rekrytering... 3 Skapa

Läs mer

FC-kurs Röbäcks skolområde, åk 5-6

FC-kurs Röbäcks skolområde, åk 5-6 FC-kurs Röbäcks skolområde, åk 5-6 En kortfattad manual för följande funktioner: 1. Hur det ser ut i FC (repetition) 2. Hur man skickar och läser mail i FC (repetition) 3. Att skicka och ta emot en bilaga

Läs mer

BASÅRET KEMI B BIOKEMI VT 2012. GENETISK INFORMATION 191-210 (sid. 157-177)

BASÅRET KEMI B BIOKEMI VT 2012. GENETISK INFORMATION 191-210 (sid. 157-177) BASÅRET KEMI B BIOKEMI GENETISK INFORMATION 191-210 (sid. 157-177) DNA/RNA, Transkription, Translation VAR I CELLEN SKER DETTA? Replikation - kopiering av DNA, sker i cellkärnan Transkription - avläsa

Läs mer

Medioteket. Introduktion till sli.se/medioteket för elever

Medioteket. Introduktion till sli.se/medioteket för elever Medioteket Introduktion till sli.se/medioteket för elever Innehåll 4 Aktivera konto 5 Söka Sök Boxar Filter Samsök 6 Strömma media 6 Dela/Skapa klipp 7 Favoriter 7 Inställningar 7 Glömt lösenordet? 7

Läs mer