En bioinformatisk genjakt

Storlek: px
Starta visningen från sidan:

Download "En bioinformatisk genjakt"

Transkript

1 En bioinformatisk genjakt Efter en ide från: CUSMOBIO, Milano, Italien. Hur man kan söka i databaser efter information om en gen som kan ge ökad risk för bröstcacer. Bakgrund Människor utan symptom men med en känd genetisk sjukdom i familjen kan få möjlighet att testa sig genetiskt för att se om de bär på anlaget för en genetisk sjukdom. I scenariot vi tänker oss här är det en kvinna med många fall av cancer i familjen som vill veta om hon löper större risk än normalt att utveckla en tumörsjukdom. Anna, 23 år, går till en gynekolog. När läkaren frågar henne om sjukdomar i familjen så lägger han märke till att flera kvinnliga medlemmar av släkten har haft cancer. Henes farmor dog vid 40 års ålder av bröstcancer och två fastrar dog i 50-årsåldern av livmodercancer. En tredje faster har precis vid 39 års ålder blivit diagnosticerad med bröstcancer. Gynekologen informerar om att det kan vara möjligt att det i familjen finns någon mutation i en av de två bröstcancergener som man har identifierat (BRCA1 or BRCA2). Under besöket hittar gynekologen också en misstänkt knöl i hennes högra bröst och gör en bioposi på den (tar ett vävnadsprov) för att se om det är en tumör. Gynekologen föreslår att Anna också skulle kunna göra ett DNA test, men informerar att det inte är meningsfullt att göra det om man inte vet huruvida det finns en muterad gen i familjen eller inte. Det visar sig att fastern med bröstcancer redan har testats positiv för en ganska ovanlig mutation i BRCA2-genen. Så gynekologen använder en del av provet från biopsin för att testa för en mutation i just den genen. När man diagnosticerar genetiska sjukdomar använder man ofta en teknik som heter Reverse Transcription Polymerase Chain Reaction (RT-PCR). RT-PCR är en teknik som gör det möjligt att kopiera upp en del av en mrna molekyl. Reverse betyder omvänd och det står för att det första man gör är att omvandla en RNA-sträng till DNA som man sedan multiplicerar genom en vanlig PCR-reaktion. PCR är en metod med vilken man kan kopiera upp stora mängder av ett visst DNAavsnitt och som också möjliggör att man i nästa steg kan ta reda på kvävebassekvensen för detta DNA. Fördelen är att RT-PCR använder mrna som mönster, vilket innebär att man kan studera den gen som verkligen uttrycks som ett protein i just den vävnad som man studerar, i det här fallet bröstet. En vanlig DNA undersökning är inte lika specifik. På Annas prov gör man nu en RTR-PCR som fångar in samma gen som hennes faster hade en mutation i och PCR-produkten man får sekvenseras för att ta reda på ordningen på kvävebaserna i DNA-sekvensen. Den sekvensen skall du nu använda för att identifiera mutationen som finns i Annas familj och för att se om den är närvarande i hennes prov. Mål 1: Identifiera vilken gen DNA-sekvensen tilhör och på vilken kromosom den sitter. Mål 2: Titta på hur proteinet som genen kodar för ser ut Mål 3: Ta fram information om den genen 1

2 Mål 1: Identifiera vilken gen Annas sekvens kommer från och se om den är muterad eller inte Sekvensen som kommer från sekvenseringen ser ut som följer: TGCACTAACAAGACAGCAAGTTCGTGCTTTGCAAGATGGTGCAGAGCTTTATGAAGCAGTGAAGAATGCA GCAGACCCAGCTTACCTTGAGTTATACTGAGTATTTGGCGTCCATCATCAGATTTATATTCTCTGTTAACAGA AGGAAAGAGATACAGAATTTATCATCTTGCAACTTCAAAATCTAAAAGTAAATCTGAAAGAGCTAACATAC AGTTAGCAGCGACAAAAAAAACTAGTATCAACAACTACCGGTTTCAGATGAAATTTTATTTCAGATTTACCA GCCACGGGAGCCCTTCACTTCAGCAAATTTTTAGATCCAGACTTTCAGCCATCTTGTTCTGA Du börjar med att använda BLAT (BLAST-Like Alignment Tool) som är en metod för att jämföra DNA-sekvenser. När du skickar in en sekvens till BLAT så jämför programmet din insända sekvens med alla andra som finns i databasen och ger dig sedan en lista över de sekvenser som är mest lik den du skickat in. Gå till sidan: cgi-bin/hgblat?db=mm2 Kopiera och klistra in sekvensen ovan i det vita fältet och tryck på submit. (Om du inte vet eller kommer på hur man kan väja och kopiera text i Acrobat reader kan du hämta sekvensen på min hemsida På adressen annas_sekvens.rtf) BLAT-resultatfönstret kommer att visa flera olika träffar i en lista. Du väljer den första, den som har störst antal träffar (score). Det fins också en del information här som att din sekvens var 350 baser lång och att den matchar en sekvens på kromosom 13. Sedan klickar du på browser för att få information om den kromosomala region som din sekvens befinner sig på. 2

3 På den bild som då dyker upp kan du se var på kromosomen din gen befinner sig. Den är rödmarkerad på översikten över kromosomen. Översikt över kromosomen Inskickade sekvensen Bästa träffen Jämförelse med samma sekvens från andra djur I fältet nedanför bilden på kromosomen ser du din sekvens och under den en alignment, en jämförelse mellan den sekvens du skickade in, med den bästa träff som fanns i databasen. För att förstå den här bilden är det viktigt att du kommer ihåg att gener bara är en liten del av arvsmassan. Man försöker fortfarande förstå vad resten egentligen är. Generna ligger utspridda bland långa strckor ickekodande DNA och en gen är oftast delad i olika delar, exoner, och emellan dem finns bitar av ickekodande DNA, introner. I figuren kan man se de alignade delarna som block (svarta eller röda) medan regioner utan DNA är en tunn linje. Eftersom det DNA som kom från Annas prov var från mrna så innehåller det bara exoner, bara uttryckt material. Som väntat är den gen som är närmast söksekvensen en känd bröstcancergen. Om man klickar på namnet för den kan man få information om den genen, vilket du skall göra i nästa steg. Men först: hur många exoner (svarta block) har BRCA2 i sökfönstret? Hur många har Annas sekvens? Kan du utifrån det dra någon slutsats om var mutationen i Annas och hennes fasters gen finns någonstans? 3

4 Mål 2: Ta reda på mer om BRCA2 1. Klicka på BRCA2 och läs om den. Hur tror man att BRCA2 fungerar? 2. Tryck på Treefam i den andra tabellen nedanför beskrivningen (under rubriken Sequence and Links to Tools and Databases). Nu kommer det upp en sida som bland annat innehåller en bild på ett släktskapsträd. Där har man räknat ut hur den mänskliga genen förhåller sig till samma gen hos andra djur. Om du pekar på BRAC2:s närmaste släkting så dyker det upp ett namn Pan troglodytes. Vad tror du att det är för djur? 3. Gå sedan till Den studie som beskrivs där handlade om en speciell folkgrupp. Hur kan det komma sig att man vill undersöka speciella folkgrupper på det här viset? 2. 4

5 Mål 2: Titta på BRAC2:s molekylära struktur Redan nu har du sett att molekylärbiologerna har en massa kraftfulla instrument på nätet som de kan använda sig av. Instrument som ligger öppna så att vem som helst som har intresse och kunskap kan använda sig av dem. Nu skall vi titta på en annan aspekt av detta. Många proteiner vet man inte bara hur de fungerar utan man har också bestämt genom röntgenkristallografi hur de ser ut. Den informationen finns också öppet på internet. Nu skall vi se om det finns någon struktur bestämd för BRCA2. Gå först till den stora databasen för proteiner Swissprot Skriv in BRCA2 human i sökrutan och tryck på Go. Sök upp BRCA2_HUMAN på den nya sidan som dyker upp och klicka på den länken. Nu dyker det upp ännu en sida. För att kuna se om det finns någon tredimensionell struktur så får vi leta oss ner på sidan till rubriken 3D structure databases (ganska långt ner på sidan). Under den rubriken tittar vi på raden som börjar med PDB och väljer länken längst till höger som ser ut så här: [>>]. Du hamnar nu på en sida med två bilder på proteinet. 1. Vad betyder de konstiga spiralerna och grejorna? 2. Vad kan man ha för nytta av att veta hur ett protein ser ut i 3D? Om du gör det här hemma kan du ladda hem programmet Rasmol och sedan när du installerat det titta på filen (som finns under view). Då kan du rotera molekylen som du vill och zooma obehindrat mm. Jag hoppas att detta har gett dig en förståelse av vilket stort forskningsområde molekylärbiologi är och vilka avancerade instrument som finns till hands för alla som har en dator med internet. 5

Ärftliga sjukdomar och egenskaper hos hund

Ärftliga sjukdomar och egenskaper hos hund Engelsk bulldog Tibetansk terrier Västgötaspets Dvärgpinscher Chow chow Foto: Pleple2000 Foto: Flickr user skaty222 Foto: Sören T Eriksson Foto: Entheta Foto:Jurriaan Schulman Alla bilder Wikimedia commons

Läs mer

Människans genom Databaser ger kunskap om genetiska sjukdomar

Människans genom Databaser ger kunskap om genetiska sjukdomar Nationellt resurscentrum för biologi och bioteknik Övning i bioinformatik Människans genom Databaser ger kunskap om genetiska sjukdomar Många molekylärbiologiska databaser och program är fritt tillgängliga

Läs mer

En bioinformatisk genjakt I

En bioinformatisk genjakt I En bioinformatisk genjakt I -jämförelser av olika arters genom I den här aktiviteten kan en elev självständigt undersöka det mänskliga genomet genom att hämta information från en databas på nätet. Målet

Läs mer

Henrik Brändén. bioscience explained Vol 3 No 1. Undersökning av influensavirus med hjälp av släktträd. Vetenskapsrådet 103 78 Stockholm Sverige

Henrik Brändén. bioscience explained Vol 3 No 1. Undersökning av influensavirus med hjälp av släktträd. Vetenskapsrådet 103 78 Stockholm Sverige Henrik Brändén Vetenskapsrådet 103 78 Stockholm Sverige Undersökning av influensavirus med hjälp av släktträd Introduktion Influensavirus delas in i olika stammar beroende på vilka varianter viruset bär

Läs mer

Släktträd med hjälp av databaser och program från Internet

Släktträd med hjälp av databaser och program från Internet Övning: Släktträd sid 1 Övning i bioinformatik Släktträd med hjälp av databaser och program från Internet Det finns databaser som är fritt tillgängliga och innehåller nukleotid- och amino-syrasekvenser

Läs mer

Stamträd med hjälp av databaser och program från Internet

Stamträd med hjälp av databaser och program från Internet Övning: Stamträd sid 1 Övning Stamträd med hjälp av databaser och program från Internet Det finns databaser som är fritt tillgängliga och innehåller nukleotid- och aminosyrasekvenser från ett stort antal

Läs mer

Patientinformation ärftlig cancer

Patientinformation ärftlig cancer Patientinformation ärftlig cancer Ärftlig bröst- och äggstockscancer 1 MEFinfo_BC 1 Onkogenetiska mottagningen Universitetssjukhuset i Lund Adresser till onkogenetiska mottagningar i Sverige Lund Göteborg

Läs mer

Sammanfattning Arv och Evolution

Sammanfattning Arv och Evolution Sammanfattning Arv och Evolution Genetik Ärftlighetslära Gen Information om ärftliga egenskaper. Från föräldrar till av komma. Tillverkar proteiner. DNA (deoxiribonukleinsyra) - DNA kan liknas ett recept

Läs mer

Patientinformation ärftlig cancer

Patientinformation ärftlig cancer Patientinformation ärftlig cancer Misstänkt ärftlig bröstcancer 1 Universitetssjukhuset i Lund Adresser till onkogenetiska mottagningar i Sverige Lund Göteborg Linköping Stockholm Uppsala Umeå Genetiska

Läs mer

Från gen till protein. Niklas Dahrén

Från gen till protein. Niklas Dahrén Från gen till protein Niklas Dahrén Innehållet i denna undervisningsfilm: Vad är skillnaden mellan kromosom, DNA- molekyl, gen och protein? Hur kan vårt DNA avgöra hur vi ser ut och fungerar? Proteinernas

Läs mer

Övning i bioinformatik

Övning i bioinformatik Övning: Släktträd sid 1 Övning i bioinformatik Släktträd med hjälp av databaser och program från Internet Det finns databaser som är fritt tillgängliga och innehåller nukleotid- och amino-syrasekvenser

Läs mer

Vad händer i ett genetiskt laboratorium?

Vad händer i ett genetiskt laboratorium? 12 utveckla nya metoder eller låta sådana prover delta i kvalitetskontrollprogram, såvida inte patienten har uttryckt att man inte vill att ens prov ska vara del av sådan verksamhet. Som alla andra sparade

Läs mer

Kap 26 Nukleinsyror och proteinsyntes. Bilder från McMurry

Kap 26 Nukleinsyror och proteinsyntes. Bilder från McMurry Kap 26 Nukleinsyror och proteinsyntes Bilder från McMurry Namn Efternamn 26 februari 2011 2 Varje DNA molekyl är uppbyggd av många gener induviduella DNA segmant som innehåller instruktioner för syntes

Läs mer

GENETIK - Läran om arvet

GENETIK - Läran om arvet GENETIK - Läran om arvet Kroppens minsta levande enheter är cellerna I cellkärnorna finns vår arvsmassa - DNA (DNA - Deoxiribonukleinsyra) Proteiner Transportproteiner Strukturproteiner Enzymer Reglerande

Läs mer

Tentamen Reproduktion och utveckling, 2011-12- 10. Åke Strids frågor:

Tentamen Reproduktion och utveckling, 2011-12- 10. Åke Strids frågor: Tentamen Reproduktion och utveckling, 2011-12- 10 Åke Strids frågor: Inför celldelning måste DNA:t kopieras. 1. Redogör för hur kopieringen går till och vilka huvudkomponenter som ingår i kopieringsmaskineriet

Läs mer

Datorer och matematik hjälper oss att motverka sjukdomar

Datorer och matematik hjälper oss att motverka sjukdomar Datorer och matematik hjälper oss att motverka sjukdomar Adam Ameur Bioinformatiker Lund, 26e November 2014 Introduktion till bioinformatik Bioinformatik - en tvärvetenskaplig disciplin där algoritmer

Läs mer

Klipp-och-klistra DNA: fixa mutationen med gen editering DNA, RNA och Protein

Klipp-och-klistra DNA: fixa mutationen med gen editering DNA, RNA och Protein Huntingtons sjukdom forsknings nyheter. I klartext Skriven av forskare För de globala HS medlemmarna. Klipp-och-klistra DNA: fixa mutationen med gen editering Forskare gör exakta ändringar av DNA i ett

Läs mer

Information och samtyckesformulär inför genomisk utredning av ovanliga sjukdomar och syndrom med metoderna genomisk array och exomanalys

Information och samtyckesformulär inför genomisk utredning av ovanliga sjukdomar och syndrom med metoderna genomisk array och exomanalys Information och samtyckesformulär inför genomisk utredning av ovanliga sjukdomar och syndrom med metoderna genomisk array och exomanalys Detta informationsblad och samtyckesformulär är riktat till dig

Läs mer

CSI - Katte DNA-fingerprinting Välkänt från polisarbete. Metoden föddes 1985 i England. Från början krävdes stora mängder DNA, men nu funkar även mycket små mängder. DNA-sekvens Användning Metoden

Läs mer

Genetisk testning av medicinska skäl

Genetisk testning av medicinska skäl Genetisk testning av medicinska skäl NÄR KAN DET VARA AKTUELLT MED GENETISK TESTNING? PROFESSIONELL GENETISK RÅDGIVNING VAD LETAR MAN EFTER VID GENETISK TESTNING? DITT BESLUT Genetisk testning av medicinska

Läs mer

Du hittar en knöl vad händer sen?

Du hittar en knöl vad händer sen? Du hittar en knöl vad händer sen? Följ med på en resa från provtagning till provsvar. Vi har besökt punktionsmottagningen och patologiska/cytologiska kliniken vid Skånes universitetssjukhus i Lund. 1 På

Läs mer

Vad är Klinisk forskning

Vad är Klinisk forskning Vad är Klinisk forskning Geografiskt nära sjukhusmiljöer och patienter Sjukdomsproblem eller förlopp i fokus Läkare/vårdpersonal inblandade Nyttan för patienterna tydlig Utmaningen: + Laboratorium Patienter

Läs mer

Hämta via databaser Pröva några olika databaser. Se Hämta referenser från databaser.

Hämta via databaser Pröva några olika databaser. Se Hämta referenser från databaser. RefWorks Miniguide Skapa ett RefWorks-konto 1. Gå till bibliotekets webbplats: www.bibl.liu.se 2. Citera och referera 3. RefWorks 4. Skapa ett konto/logga in 5. Gå till RefWorks login center 6. Sign up

Läs mer

Hundar hjälper oss att förstå människans sjukdomar. Kerstin Lindblad-Toh

Hundar hjälper oss att förstå människans sjukdomar. Kerstin Lindblad-Toh Hundar hjälper oss att förstå människans sjukdomar Kerstin Lindblad-Toh Målsättning med min forskning Att hitta människors sjukdomsgener via: - djurmodeller - en bättre förståelse av arvsmassan - storskalig

Läs mer

Skapa egna övningar med ProProfs

Skapa egna övningar med ProProfs IT-körkort för språklärare Modul 10 Skapa egna övningar med ProProfs ProProfs kan användas till mycket och finns i två olika versioner: en grundversion som är gratis och en mer avancerad som kostar pengar.

Läs mer

Datorer och matematik hjälper oss att motverka sjukdomar

Datorer och matematik hjälper oss att motverka sjukdomar GA N AT ION ALCTAC ATCA G ENOMI CSGT INFR A S T RU CTURE Datorer och matematik hjälper oss att motverka sjukdomar Adam Ameur Bioinformatiker SciLifeLab Uppsala, 13e Maj 2014 Introduktion till bioinformatik

Läs mer

52 onkologi i sverige nr 5 13

52 onkologi i sverige nr 5 13 52 onkologi i sverige nr 5 13 Genreglerande DNA-element EN OUTFORSKAD ORSAK TILL CANCER Utvecklingen av cancer är starkt kopplad till uppkomsten av genetiska förändringar. Dessa förändringar omfattar allt

Läs mer

FAKTABLAD Genetiskt provinsamling i rovdjursinventeringen

FAKTABLAD Genetiskt provinsamling i rovdjursinventeringen 1(5) FAKTABLAD Genetiskt provinsamling i rovdjursinventeringen Målsättning Syftet med detta faktablad är att ge en översikt av den genetiska provtagningen som tillämpas vid rovdjursinventeringen i Sverige

Läs mer

En sax för gener kan få Nobelpris

En sax för gener kan få Nobelpris En utskrift från Dagens Nyheters nätupplaga, DN.se, 2015 09 28 11:56:30 Artikelns ursprungsadress: http://www.dn.se/nyheter/vetenskap/en sax for gener kan fa nobelpris/ En sax för gener kan få Nobelpris

Läs mer

HUGO-projektet. Kartläggningen av det mänskliga genomet

HUGO-projektet. Kartläggningen av det mänskliga genomet Vem är HUGO? HUGO-projektet Kartläggningen av det mänskliga genomet Kartläggning av genom Genom= allt DNA hos en organism. Kartläggningen sker genom att man bestämmer DNA-sekvensen för hela genomet och

Läs mer

RNA-syntes och Proteinsyntes

RNA-syntes och Proteinsyntes RNA-syntes och Proteinsyntes Jenny Flygare (jenny.flygare@ki.se) Genexpression - översikt 5 (p) A T G T C A G A G G A A T G A 3 (OH) T A C A G T C T C C T T A C T 3 (OH) 5 (p) VAD TRANSLATERAS DEN HÄR

Läs mer

Släktskap mellan människa och några ryggradsdjur

Släktskap mellan människa och några ryggradsdjur Övning: Släktskap mellan människa och några ryggradsdjur sid 1 Övning Släktskap mellan människa och några ryggradsdjur En manuell jämförelse mellan hemoglobinets aminosyrasekvenser hos några organismer

Läs mer

Välkommen till live broadcasting med Bambuser via nätet. skaffa eget konto (gratis) genom att gå till: http://bambuser.com

Välkommen till live broadcasting med Bambuser via nätet. skaffa eget konto (gratis) genom att gå till: http://bambuser.com Välkommen till live broadcasting med Bambuser via nätet. skaffa eget konto (gratis) genom att gå till: http://bambuser.com 1 2 3 Manual gjord av Liv Zetterling 2010 Har du gjort 1-3 så har du också gjort

Läs mer

Genetik en sammanfattning

Genetik en sammanfattning Genetik en sammanfattning Pär Leijonhufvud $\ BY: 3 februari 2015 C Innehåll Inledning 2 Klassisk genentik 2 Gregor Mendel munken som upptäckte ärftlighetens lagar....... 2 Korsningsrutor, ett sätt att

Läs mer

[ HUR DU UPPDATERAR FÖRSTASIDAN PÅ OTHELLO.NU ]

[ HUR DU UPPDATERAR FÖRSTASIDAN PÅ OTHELLO.NU ] Logga in på backend www.othello.nu/admin Välj Site för att få upp trädvyn över alla sidor Uppdatera Nyheter Klicka på sidan nyheter i trädvyn och tryck Edit Väl inne på kan du Skapa, Uppdatera och Radera

Läs mer

AIF:arens guide till cyberrymden

AIF:arens guide till cyberrymden AIF:arens guide till cyberrymden www.andrarumsif.se Reviderad 2008-04-14 1 Välkommen till www.andrarumsif.se:s användarmanual! Denna manual ska inte ses som en fullständig manual till hemsidan utan snarare

Läs mer

Tidiga erfarenheter av arvets mysterier

Tidiga erfarenheter av arvets mysterier Cellens genetik Cellen Växtcellen Växtcellen Tidiga erfarenheter av arvets mysterier Artförädling genom riktad avel Religiösa förbud mot syskongiftemål Redan de gamla grekerna.. Aristoteles ~350 år före

Läs mer

Polymerase Chain Reaction

Polymerase Chain Reaction Polymerase Chain Reaction The Polymerase Chain Reaction Molekylärbiologisk metodik T3 ht 11 Märit Karls Kunskapsmål för detta avsnitt Från kursplan: Studenten skall kunna: förklara grundläggande principer

Läs mer

Mer information om RefWorks, andra referenshanteringsprogram och hur man refererar hittar du på Linköpings universitetsbiblioteks webbsidor.

Mer information om RefWorks, andra referenshanteringsprogram och hur man refererar hittar du på Linköpings universitetsbiblioteks webbsidor. Guide till RefWorks För att förenkla hanteringen av referenser och referenslistor finns det flera olika verktyg, s.k. referenshanteringsprogram. Med dem kan du samla, organisera och presentera dina referenser.

Läs mer

Molekylärbiologins centrala dogma

Molekylärbiologins centrala dogma Molekylärbiologins centrala dogma m Replikation:Bassekvensen i DNA står för den genetiska informationen. När en cell ska delas måste DNA:tdupliceras man måste få nytt DNA med exakt samma bassekvens som

Läs mer

Miljön i Windows Vista

Miljön i Windows Vista 1 Miljön i Windows Vista Windows Aero Windows Aero (Aero Glass), som det nya utseendet eller gränssnittet heter i Vista, påminner mycket om glas och har en snygg genomskinlig design. Det är enklare att

Läs mer

DNA-molekylen. 1869 upptäcktes DNA - varken protein, kolhydrat eller lipid.

DNA-molekylen. 1869 upptäcktes DNA - varken protein, kolhydrat eller lipid. Genetik Ärftlighetslära - hur går det till när egenskaper går i arv? Molekylär genetik - information i DNA och RNA Klassisk genetik - hur olika egenskaper ärvs Bioteknik - Hur DNA flyttas mellan olika

Läs mer

Hämta via databaser Se Hämta referenser från databaser.

Hämta via databaser Se Hämta referenser från databaser. Guide till RefWorks Denna guide beskriver kort hur du kommer igång med RefWorks, hur du importerar referenser till RefWorks, delar dina referenser med andra samt hur du refererar och skapar referenslistor.

Läs mer

Instuderingsfrågor avsnitten Molekylär genetik och Rekombinant DNA tekniker, MCB

Instuderingsfrågor avsnitten Molekylär genetik och Rekombinant DNA tekniker, MCB Instuderingsfrågor avsnitten Molekylär genetik och Rekombinant DNA tekniker, MCB Molekylärgenetikdelen 1. Vad är DNA? 2. Vad heter byggstenarna i DNA? 3. Vad är RNA? 4. Vad är en bas, nukleosid, nukleotid

Läs mer

Manual: Skapa egna ansökningsformulär

Manual: Skapa egna ansökningsformulär INFORMATION TILL FOLKHÖGSKOLORNA Manual: Skapa egna ansökningsformulär Alla folkhögskolor kan skapa egna digitala ansökningsformulär genom en funktion på Folkhögskola.nu. Genom att logga in på www.folkhogskola.nu/admin

Läs mer

DNA-labb / Plasmidlabb

DNA-labb / Plasmidlabb Översikt DNA-labb Plasmidlabb Preparation och analys av -DNA från Escherichia coli Varför är vi här idag? Kort introduktion till biokemi och rekombinant DNA- teknologi Vad skall vi göra idag? Genomgång

Läs mer

Kopiera DNA med hjälp av PCR-metoden. Niklas Dahrén

Kopiera DNA med hjälp av PCR-metoden. Niklas Dahrén Kopiera DNA med hjälp av PCR-metoden Niklas Dahrén Först lite allmän kunskap om kromosomer, DNA, gener etc. Varje kromosom består av en lång DNAmolekyl som är lindad runt histoner En gen är en liten del

Läs mer

Kom igång. Readyonet Lathund för enkelt admin. Logga in Skriv in adressen till din webbsida följt av /login. Exempel: www.minsajt.

Kom igång. Readyonet Lathund för enkelt admin. Logga in Skriv in adressen till din webbsida följt av /login. Exempel: www.minsajt. Kom igång Logga in Skriv in adressen till din webbsida följt av /login. Exempel: www.minsajt.se/login Nu dyker en ruta upp på skärmen. Fyll i ditt användarnamn och lösenord och klicka på "logga in". Nu

Läs mer

Läkemedelsprövningar och slutsatser

Läkemedelsprövningar och slutsatser Huntingtons sjukdom forsknings nyheter. I klartext Skriven av forskare För de globala HS medlemmarna. TRACK-HD avslöjar betydande förändringar hos pre-symtomatiska mutationsbärare och personer med HS Ettårsrapporten

Läs mer

Moodle2 STUDENTMANUAL

Moodle2 STUDENTMANUAL Moodle2 STUDENTMANUAL Moodle är en lärplattform med hjälp av vilket du kan kommunicera, dela med dig av information och upprätthålla kontakten med lärarna, handledarna och de andra kursdeltagarna. För

Läs mer

FC-kurs Röbäcks skolområde, åk 5-6

FC-kurs Röbäcks skolområde, åk 5-6 FC-kurs Röbäcks skolområde, åk 5-6 En kortfattad manual för följande funktioner: 1. Hur det ser ut i FC (repetition) 2. Hur man skickar och läser mail i FC (repetition) 3. Att skicka och ta emot en bilaga

Läs mer

Erik Eriksson VMD Enheten för Bakteriologi

Erik Eriksson VMD Enheten för Bakteriologi Diagnostik VTEC/EHEC Erik Eriksson VMD Enheten för Bakteriologi SVA Tänker prata om VTEC / EHEC Sjukdomsframkallande faktorer PCR Magnetiska kulor (Immunomagnetisk separation) Diagnostik de vanligaste

Läs mer

Diagnosticera sicklecellsanemi med DNA-analys. Niklas Dahrén

Diagnosticera sicklecellsanemi med DNA-analys. Niklas Dahrén Diagnosticera sicklecellsanemi med DNA-analys Niklas Dahrén Sicklecellsanemi Erytrocyterna ser ut som skäror : Sjukdomen innebär a0 de röda blodkropparna (erytrocyterna) ser ut som skäror (eng. sickle)

Läs mer

Visma Proceedo. Att logga in - Manual. Version 1.3 / 140414 1

Visma Proceedo. Att logga in - Manual. Version 1.3 / 140414 1 Visma Proceedo Att logga in - Manual Version 1.3 / 140414 1 Innehållsförteckning 1) INLOGGNING VIA VERKTYG OCH SYSTEM... 3 2) INTERNET EXPLORER... 6 2.1 Java... 6 2.2 Popup-fönster... 8 2.3 Browser, 32-

Läs mer

Skapa aktivitet för nätverksmotorer

Skapa aktivitet för nätverksmotorer Skapa aktivitet för nätverksmotorer För att skapa en aktivitet behöver du vara inloggad på nätverkets hemsida. När du skapar en aktivitet måste du som motor ansöka om att få visa den i gemensamma På Gångkalendern

Läs mer

Transkription och translation = Översättning av bassekvensen till aminosyrasekvens

Transkription och translation = Översättning av bassekvensen till aminosyrasekvens Transkription och translation = Översättning av bassekvensen till aminosyrasekvens OBS! Grova drag för prokaryota system! Mycket mer komplicerat i eukaryota system! RNA: Tre huvudtyper: trna transfer RNA

Läs mer

FrontPage Express. Ämne: Datorkunskap (Internet) Handledare: Thomas Granhäll

FrontPage Express. Ämne: Datorkunskap (Internet) Handledare: Thomas Granhäll FrontPage Express I programpaketet Internet Explorer 4.0 och 5.0 ingår också FrontPage Express som installeras vid en fullständig installation. Det är ett program som man kan använda för att skapa egna

Läs mer

Onkogenetisk regionmottagning i Linköping. Marie Stenmark Askmalm Sigrun Liedgren Lilianne Ferraud Madelene Jansson Ann-Charlotte Isaksson

Onkogenetisk regionmottagning i Linköping. Marie Stenmark Askmalm Sigrun Liedgren Lilianne Ferraud Madelene Jansson Ann-Charlotte Isaksson Onkogenetisk regionmottagning i Linköping Marie Stenmark Askmalm Sigrun Liedgren Lilianne Ferraud Madelene Jansson Ann-Charlotte Isaksson Dagordning Organisation Mål för onkogenetiska mottagningen Definition

Läs mer

FC-kurs Röbäcks skolområde femmor och sexor ---------------

FC-kurs Röbäcks skolområde femmor och sexor --------------- FC-kurs Röbäcks skolområde femmor och sexor En kortfattad manual för följande funktioner: 1. Besvara brev på olika sätt 2. Läsa och skicka bifogade filer 3. Byta lösenord 4. Lägga in en presentation 5.

Läs mer

Hundar hjälper oss att förstå människans sjukdomar. Kerstin Lindblad-Toh

Hundar hjälper oss att förstå människans sjukdomar. Kerstin Lindblad-Toh Hundar hjälper oss att förstå människans sjukdomar Kerstin Lindblad-Toh Målsättning med min forskning Att hitta människors sjukdomsgener via: - djurmodeller - en bättre förståelse av arvsmassan - storskalig

Läs mer

Simulering av evolutionär anpassing En studie om hur arters anpassningsförmåga varierar med mutationsfrekvens.

Simulering av evolutionär anpassing En studie om hur arters anpassningsförmåga varierar med mutationsfrekvens. Simulering av evolutionär anpassing En studie om hur arters anpassningsförmåga varierar med mutationsfrekvens. Christian Lie NV3C Polhemsgymnasiet Göteborg 1 Innehållsförteckning: Sammanfattning Inledning

Läs mer

Lathund: Skapa egna ansökningsformulär

Lathund: Skapa egna ansökningsformulär INFORMATION TILL FOLKHÖGSKOLORNA Lathund: Skapa egna ansökningsformulär Folkhögskola.nu har utvecklat en funktion där skoladministratörer kan skapa unika digitala ansökningsformulär för olika kurser. Genom

Läs mer

Transkriptionen. Niklas Dahrén

Transkriptionen. Niklas Dahrén Transkriptionen Niklas Dahrén Innehållet i denna undervisningsfilm: Översikt över proteinsyntesen Transkrip1onen Modifiering (bearbetning) av mrna Fler filmer på samma tema: Från gen 1ll protein Den gene1ska

Läs mer

DNA- analyser kan användas för att

DNA- analyser kan användas för att Genteknik DNA- analyser kan användas för att -identifiera och koppla misstänkta till brottsplats -fria oskyldigt utpekade och oskyldigt fällda -personidentifiering vid masskatastrofer, krig, massgravar

Läs mer

3. Hämta och infoga bilder

3. Hämta och infoga bilder Sida 1 av 8 Lektion 1: sida 4 av 4 «Sida 3 av 4 Till kursens framsida 3. Hämta och infoga bilder Nu vet vi ju hur man sätter in text i sin sida. Men hur gör man med bilder? Det är inte svårt alls! Det

Läs mer

Medicin A, Medicinsk temakurs 2, 30 högskolepoäng, Tema reproduktion och utveckling. Skriftlig tentamen 10 oktober 2011

Medicin A, Medicinsk temakurs 2, 30 högskolepoäng, Tema reproduktion och utveckling. Skriftlig tentamen 10 oktober 2011 Medicin A, Medicinsk temakurs 2, 30 högskolepoäng, Tema reproduktion och utveckling Skriftlig tentamen 10 oktober 2011 1. DNA:t i arvsmassan lagrar informationen om de RNA och proteiner som cellen behöver

Läs mer

Lycka till! Tentamen. Kursens namn: Medicin C, Tumörbiologi Kursens kod: MC1728 Kursansvarig: Anna Göthlin Eremo

Lycka till! Tentamen. Kursens namn: Medicin C, Tumörbiologi Kursens kod: MC1728 Kursansvarig: Anna Göthlin Eremo Tentamen Kursens namn: Medicin C, Tumörbiologi Kursens kod: MC1728 Kursansvarig: Anna Göthlin Eremo Datum: 2012-06-01 Skrivtid: 4 timmar 08:15-12:15 (P245) Poängfördelning: Karin Franzén Pia Wegman Sabina

Läs mer

Evolution i molekylärbiologiskt perspektiv

Evolution i molekylärbiologiskt perspektiv Nutidens upptäcktsfärder går till organismernas minsta beståndsdelar. Evolution i molekylärbiologiskt perspektiv En viktig milstolpe i vetenskapens historia är sekvenseringen av det mänskliga genomet.

Läs mer

Sara Ekvall, doktorand Inst. för immunologi, genetik & patologi Uppsala universitet Handledare: Marie-Louise Bondeson & Göran Annerén

Sara Ekvall, doktorand Inst. för immunologi, genetik & patologi Uppsala universitet Handledare: Marie-Louise Bondeson & Göran Annerén Sara Ekvall, doktorand Inst. för immunologi, genetik & patologi Uppsala universitet Handledare: Marie-Louise Bondeson & Göran Annerén Celler & DNA Vår kropp är uppbyggd av ~100 000 miljarder celler I cellen

Läs mer

IT-körkort för språklärare. Modul 2: Blogg

IT-körkort för språklärare. Modul 2: Blogg IT-körkort för språklärare Modul 2: Blogg Innehåll Gloslista 2 Logga in på bloggen (punkt 1-3) 3 Skapa och redigera sidor och undersidor (punkt 4 och 5) 4 Infoga dokument (punkt 6 och 7) 7 Skapa inlägg

Läs mer

Lägga in ett protokoll i en Dokumentlista i SharePoint

Lägga in ett protokoll i en Dokumentlista i SharePoint Lägga in ett protokoll i en Dokumentlista i SharePoint Så här loggar du in protokoll i SharePoint dokumenthanteringssystem Den röda texten tillsammans med de röda pilarna på bilderna visar vad du ska fylla

Läs mer

Daniel Clarhed 2006-06-22

Daniel Clarhed 2006-06-22 Avdelningen för Byggnadsmekanik Daniel Clarhed PM för Byggnadsmekaniks nya hemsida 2006-06-22 Byggnadsmekaniks nya hemsida I juli kommer Byggnadsmekanik få en ny hemsida, stöpt i det LTH-gemensamma utseendet.

Läs mer

Skapa innehåll. Logga in och administrera hemsidan. Inloggningslänk: www.alvsbyn.se/wp-admin. Byta lösenord

Skapa innehåll. Logga in och administrera hemsidan. Inloggningslänk: www.alvsbyn.se/wp-admin. Byta lösenord Sidan 1 av 9 Logga in och administrera hemsidan Inloggningslänk: www.alvsbyn.se/wp-admin Byta lösenord 2. Klicka på Profil 3. Längst nere hittar du två fält: Nytt lösenord och Bekräfta nytt lösenord. Fyll

Läs mer

Totalt finns det alltså 20 individer i denna population. Hälften, dvs 50%, av dem är svarta.

Totalt finns det alltså 20 individer i denna population. Hälften, dvs 50%, av dem är svarta. EVOLUTION Tänk dig att det på en liten ö i skärgården finns 10 st honor av den trevliga insekten långvingad muslus. Fem av dessa är gula med svarta fläckar och fem är helsvarta. Det är samma art, bara

Läs mer

I.site Webbsidesverktyg handledning

I.site Webbsidesverktyg handledning I.site Webbsidesverktyg handledning Ingela Ek IT-pedagogisk utveckling Barn- och ungdomsförvaltningen Botkyrka kommun Senast uppdaterad 2007 Välkommen som webbredaktör till Botkyrka kommuns hemsidor Logga

Läs mer

Facit tds kapitel 18

Facit tds kapitel 18 Facit tds kapitel 18 Testa dig själv 18.1 1. Arvsanlagen finns i cellkärnan. Inför celldelningen samlas de i kromosomer. 2. Det kemiska ämne som bär på arvet kallas DNA. 3. Instruktionerna i DNA är ritningar,

Läs mer

Syfte? Naturliga populationer i Trollsvattnen. Otoliter för åldersbestämning. Vävnadsprover för genetisk analys

Syfte? Naturliga populationer i Trollsvattnen. Otoliter för åldersbestämning. Vävnadsprover för genetisk analys Syfte? Inblick i vanlig genotypbestämningsmetod Allozymer har ofta använts som genetisk markör vid populationsgenetiska studier Studera genetisk variation inom och mellan populationer används inom bevarandebiologin

Läs mer

Guide till Mynewsdesk Hosted Newsroom - Kom igång och spegla ditt pressrum!

Guide till Mynewsdesk Hosted Newsroom - Kom igång och spegla ditt pressrum! Guide till Mynewsdesk Hosted Newsroom - Kom igång och spegla ditt pressrum! Hur du implementerar ditt Hosted Newsroom I den här guiden kan du läsa hur du skapar ert Hosted Newsroom ert pressrum på er egna

Läs mer

Guide till RefWorks Skapa ett RefWorks-konto Under Citera och referera > RefWorks Hjälp funktioner i RefWorks Help Tutorial Help

Guide till RefWorks Skapa ett RefWorks-konto Under Citera och referera > RefWorks Hjälp funktioner i RefWorks Help Tutorial Help Guide till RefWorks Denna guide beskriver kort hur du kommer igång med RefWorks, hur du importerar referenser till RefWorks, delar dina referenser med andra samt hur du refererar och skapar referenslistor.

Läs mer

Hur man skapa en Wiki.

Hur man skapa en Wiki. Hur man skapa en Wiki. Ordet wiki (i t.e.x Wikipedia) kommer från Hawaiian och betyder snabbt. Kortfattat kan man säga att en wik i är en webbplats där alla enkelt kan publicera och redigera material när

Läs mer

Installera din WordPress med 9 enkla steg

Installera din WordPress med 9 enkla steg Installera din WordPress med 9 enkla steg Den här artikeln förutsätter att du har satt upp en webbserver eller har köpt ett webbhotell där du kan placera din nya WordPress hemsida. Om du inte har det,

Läs mer

IT-körkort för språklärare. Modul 3: Ljud, del 1

IT-körkort för språklärare. Modul 3: Ljud, del 1 IT-körkort för språklärare Modul 3: Ljud, del 1 Innehåll Ladda ner Audacity och hjälpprogrammet LAME 3 Installera Audacity och LAME 7 Spela in med Audacity 9 Spara och exportera i MP3-format 11 Ladda upp

Läs mer

Kursvärdering. Denna manual beskriver hur du kan skapa en mapp i Fronter som heter Kursvärdering där du ladda upp reslutat från kursutvärderingar.

Kursvärdering. Denna manual beskriver hur du kan skapa en mapp i Fronter som heter Kursvärdering där du ladda upp reslutat från kursutvärderingar. Kursvärdering Denna manual beskriver hur du kan skapa en mapp i Fronter som heter Kursvärdering där du ladda upp reslutat från kursutvärderingar. Här finns även tips på några olika sätt att skapa en kursvärdering

Läs mer

Namn: Det här är jag (Här kan du rita eller skriva)

Namn: Det här är jag (Här kan du rita eller skriva) Min värld Namn: Det här är jag (Här kan du rita eller skriva) Gramse, Mallo och mamma Gramse är ganska liten med långa öron och bor i en skog i landet Hittapou. Gramse brukar vara lila men byter färg ibland,

Läs mer

Patientinformation Misstänkt ärftlig bröst- och äggstockscancer. Familjeutredning. Södra sjukvårdsregionen

Patientinformation Misstänkt ärftlig bröst- och äggstockscancer. Familjeutredning. Södra sjukvårdsregionen Patientinformation Misstänkt ärftlig bröst- och äggstockscancer Familjeutredning Södra sjukvårdsregionen Ord Anlag Ordlista Förklaring Se under gen BRCA1 Bröstcancergen 1 BRCA2 Bröstcancergen 2 DNA Gen

Läs mer

Kommentar [k1]: Behöver vi kommentera det som finns till höger ovanför schematyp?

Kommentar [k1]: Behöver vi kommentera det som finns till höger ovanför schematyp? Webbklienten Webben är uppbyggd med hjälp av flikar. När du öppnar lärosätets schemasida finns ett antal flikar som syns på webben för alla. Om du loggar in får du ytterligare flikar och möjligheter till

Läs mer

Kliniskt forskningscentrum. Laborativ verksamhet

Kliniskt forskningscentrum. Laborativ verksamhet Kliniskt forskningscentrum Laborativ verksamhet Vid Kliniskt forskningscentrum (KFC) finns möjlighet att få laborativ hjälp i olika forskningsprojekt samt möjlighet för egen laborativ verksamhet. Laboratoriet

Läs mer

En bioinformatorisk genjakt!

En bioinformatorisk genjakt! En bioinformatorisk genjakt - En jämförelse av olika arters genom I den här aktiviteten kan en elev självständigt undersöka det mänskliga genomet genom att hämta information från en databas på nätet. Målet

Läs mer

Lärarhandledning gällande sidorna 6-27 Inledning: (länk) Läromedlet har sju kapitel: 5. Celler och bioteknik

Lärarhandledning gällande sidorna 6-27 Inledning: (länk) Läromedlet har sju kapitel: 5. Celler och bioteknik Senast uppdaterad 2012-12-09 55 Naturkunskap 1b Lärarhandledning gällande sidorna 6-27 Inledning: (länk) Celler och bioteknik C apensis Förlag AB Läromedlet har sju kapitel: 1. Ett hållbart samhälle 2.

Läs mer

Kromosomer, celldelning och förökning

Kromosomer, celldelning och förökning Kromosomer, celldelning och förökning Kromosomen Hur ligger DNA lagrat? DNA 2 nm Prokaryota celler har vanligtvis endast en kromosom. I eukaryota celler finns alltid mer än en DNA-molekyl som bildar olika

Läs mer

Myndigheten för samhällsskydd och beredskap 1 (10) Datum 2012-03-16 0.7. Installationsguide ROPA

Myndigheten för samhällsskydd och beredskap 1 (10) Datum 2012-03-16 0.7. Installationsguide ROPA samhällsskydd och beredskap 1 (10) Installationsguide ROPA samhällsskydd och beredskap 2 (10) Installationsguide ROPA ROPA version Myndigheten för samhällsskydd och beredskap Avdelningen för utbildning,

Läs mer

GUIDE REGISTRERA ETT EVENEMANG PÅ EVENEMANGSGUIDEN Gå in på www.eskilstuna.se/evenemang och klicka på knappen Registrera ett evenemang.

GUIDE REGISTRERA ETT EVENEMANG PÅ EVENEMANGSGUIDEN Gå in på www.eskilstuna.se/evenemang och klicka på knappen Registrera ett evenemang. GUIDE REGISTRERA ETT EVENEMANG PÅ EVENEMANGSGUIDEN Gå in på www.eskilstuna.se/evenemang och klicka på knappen Registrera ett evenemang. OBS!! Viktig information innan du börjar att fylla i registreringsformuläret!

Läs mer

2009-08-20. Manual för Typo3 version 4.2

2009-08-20. Manual för Typo3 version 4.2 2009-08-20 Manual för Typo3 version 4.2 1 2 Innehåll: 1. Allmänt 4 2. Grunderna i Typo3 5 2.1 Knappar 5 2.2 Inloggning 5 2.3 Den inledande vyn 6 2.4 Sidträdet 7 3. Sidor 8 3.1 Skapa en ny sida 8 3.1.1

Läs mer

VÄGLEDNING Hur man fyller i Excel-bladet

VÄGLEDNING Hur man fyller i Excel-bladet Europeiska kommissionen GENERALDIREKTORAT GD MILJÖ GD KLIMATPOLITIK VÄGLEDNING Hur man fyller i Excel-bladet Europeiska kommissionen, B-1049 Bryssel Belgien, tfn: 32 22991111 1 INNEHÅLLSFÖRTECKNING 1 INNEHÅLLSFÖRTECKNING...

Läs mer

Skapa mappar, spara och hämta dokument

Skapa mappar, spara och hämta dokument Skapa mappar, spara och hämta dokument Övningen görs på hårddisken i mappen Mina dokument 1a Starta programmet utforskaren 1 b Huvudgrupper i utforskaren 1c Expandera huvudgrupper, enheter och mappar Skapa

Läs mer

Att få. är inte en. Vad sa de? Cancer? Vad händer nu?

Att få. är inte en. Vad sa de? Cancer? Vad händer nu? Det krävs ett test Att få diagnosen bröstcancer Bröstcancer är inte en sjukdom Vad sa de? Cancer? Vad händer nu? Det går nog inte att vara förberedd på hur man kommer att reagera när man får beskedet att

Läs mer

Administration av asrp.se

Administration av asrp.se Administration av asrp.se Inloggning sker från: http://www.asrp.se/cms/admin_login.php Avdelningar/rubriker: - Sidor - Användare - Galleri - Övrigt - Annonser - Hästar - Faktablad - Logga ut SIDOR Under

Läs mer

XXX. Bokningslista. FAQ v. 5. Bokningslista v. 5, FAQ B & IKT, Lunds universitet

XXX. Bokningslista. FAQ v. 5. Bokningslista v. 5, FAQ B & IKT, Lunds universitet XXX Bokningslista FAQ v. 5 1 Frågeställningar... 3 1.1 Allmänt:... 3 1.2 Student:... 3 1.3 Listadministratör:... 4 1 Frågeställningar 1.1 Allmänt: Jag kan inte logga in? Kontrollera om du kan logga in

Läs mer

RNA och den genetiska koden

RNA och den genetiska koden RNA och den genetiska koden Table of Contents Struktur... 1 DNA och RNA... 2 Puriner och Pyrimidiner... 2 Watson-Crick baspar... 2 RNA som molekyl... 2 Primär struktur... 2 Sekundära strukturer... 2 Typer

Läs mer

Vad är repetitionslängd?

Vad är repetitionslängd? Huntingtons sjukdom forsknings nyheter. I klartext Skriven av forskare För de globala HS medlemmarna. Ny analys visar att den korta CAG-längden inte spelar roll Storleken är inte allt: forskning tyder

Läs mer