Hundar hjälper oss att förstå människans sjukdomar. Kerstin Lindblad-Toh

Storlek: px
Starta visningen från sidan:

Download "Hundar hjälper oss att förstå människans sjukdomar. Kerstin Lindblad-Toh"


1 Hundar hjälper oss att förstå människans sjukdomar Kerstin Lindblad-Toh

2 Målsättning med min forskning Att hitta människors sjukdomsgener via: - djurmodeller - en bättre förståelse av arvsmassan - storskalig teknologi och nya strategier Att utveckla ny diagnostik och behandlingsmetoder som bygger på kunskap om sjukdomsgener.

3 Hundars historia hjälper oss hitta sjukdomsgener Stora skillnader i utseende och beteende mellan raser Vi har valt egenskaper och anlag med stor effekt Anrikning av sjukdom inom raser Lättare hitta generna!! x x x x x Egenskap Sjukdom

4 Hund och människan har samma sjukdomar 1. Cancer 2. Epilepsi 3. Thyroidea sjukdomar 4. Allergier 5. Hjärtsjukdomar 6. Autoimmuna sjukdomar 7. Prog. Retinal Atrofi 8. Katarakter 9. Tvångsyndrom Tillgängliga sjukjournaler och stamtavlor

5 Människans och hundens gener i par 99% av hundens genom har sekvenserats Lätt hitta motsvarande människogen Regler signaler också likadana

6 Hur letar vi sjukdomsgener? Markörer i genomet varierar mellan olika hundar C A C G A T T C G A T G G A C G T C A C G A T A C G A T G G A C G T SNP (Single Nucleotide Polymorphism)

7 2.5 miljoner SNPar identifierade = 1 SNP/kb

8 Sjukdomsmappning med markörer och haplotyper Chromosome A / G C / G C / G A / T T / C A / T

9 SNP antal beror på längden av haplotypblock Korta haplotyper: fler SNPs behövs Långa haplotyper: färre SNPs behövs

10 Hundars historia gynnsam p.10 Domesticering ( ~ 30,000 år sedan)) Rasbildning (< 200 år sedan) Stora kromosombitar nedärvs tillsammans Lätt att hitta rätt region Raser är nära släkt -> samma mutationer

11 500 kb Fas 1: Genmappning inom en ras Leta igenom hela genomet efter en region associerad med sjukdom Långa haplotyper: färre SNPar behövs

12 Fas 2: Finmappning med FLERA raser Addera andra raser och hitta liten region med få gener

13 Sammanfattning av vit färg mappning 2,400,000,000 bases (hela hundgenomet) Genom-vid mappning i 20 boxer 1,000,000 bases Fin mappning i Boxer & Bullterrier 100,000 bases Del av gen är misstänkt

14 Studieupplägg -> signifikanta resultat Markörer: > 15,000 SNPs testar >95% av genomet Hundar: Trait Dogs Power (LOD>5) Recessive % Dominant % 5-fold risk % Mycker mera effektivt än hos människa - tiotusentals patienter behövs hos människa

15 Med nya verktyg har vi hittat gener Nature Genetics, 2007 Nature Genetics, 2007 Vit färg Hårkam & & dövhet neuraltubsdefekt boxer R. Ridgeback MITF FGF3, FGF4, FGF19 Science, 2007 Genome Research, 2008 Hårlös & Dagblindhet tandproblem Strävhårig Tax Kinesisk nakenhund NPHP4 FOXI2 PNAS, 2009 Nature Genetics, 2007 PLOS Genetics, 2011 Human Genetics, 2007 ALS SLE Familjär Feber Kardiomyopati P. W. Corgi N. S. D. T. Retrievers Shar-Peis Boxers SOD1 Flera gener HAS2 Flera gener

16 Olika mutationstyper i monogena egenskaper Vit färg Hårkam Hårlöshet Indel i promotor ändrat uttryck? Repetitiv sekvens adderad Duplikation - (CNV?) - överuttryck? kort indel: kodande - felaktigt protein Dagblindhet Deletion av exon - kortare protein Komplexa sjukdomar: många typer av reglerande mutationer?

17 Hur läser vi av arvsmassan? Cirka 3 miljarder bokstäver: acggtggtctatttvargaggctatgafinnstttcgcctgattaggtagctagc tagcgenernagcgttttacggtggtctatttgaggctatgatttcgcctgatta ggtagctahurgctagcgcgtgagsättsgctatgatttdecgcctgapåtta ggtagjämförctagctagcgcgagcgdjurencgttttacattctttgcaga gagcatgatggasåaattgttgttsynstatttaattgggctdetctgagattt gtcgttagtcgattviktigatagggattccgatcgcgatcgcgatcgatcgct Hur tyder vi arvsmassan?

18 Hur läser vi av arvsmassan? Cirka 3 miljarder bokstäver: acggtggtctatttvargaggctatgafinnstttcgcctgattaggtagctagc tagcgenernagcgttttacggtggtctatttgaggctatgatttcgcctgatta ggtagctahurgctagcgcgtgagsättsgctatgatttdecgcctgapåtta ggtagjämförctagctagcgcgagcgdjurencgttttacattctttgcaga gagcatgatggasåaattgttgttsynstatttaattgggctdetctgagattt gtcgttagtcgattviktigatagggattccgatcgcgatcgcgatcgatcgct human armadillo elefant kanin igelkott katt delfin Områden med få skillnader är de viktiga

19 Hur läser vi av arvsmassan? Cirka 3 miljarder bokstäver: acggtggtctatttvargaggctatgafinnstttcgcctgattaggtagctagc tagcgenernagcgttttacggtggtctatttgaggctatgatttcgcctgatta ggtagctahurgctagcgcgtgagsättsgctatgatttdecgcctgapåtta ggtagjämförctagctagcgcgagcgdjurencgttttacattctttgcaga gagcatgatggasåaattgttgttsynstatttaattgggctdetctgagattt gtcgttagtcgattviktigatagggattccgatcgcgatcgcgatcgatcgct human armadillo elefant kanin igelkott katt delfin Områden med få skillnader är de viktiga

20 Komparativ genomik ger förståelse av människans arvsmassa >5 % av däggdjursgenom har en funktion ~1.5 % ger upphov till proteiner >3.5 % reglersignaler (när, var, hur bilda proteiner) ~20,000 gener hos däggdjur Genfamiljer expanderar hos vissa djurarter De flesta och starkaste reglersignalerna sitter vid gener som styr bl a fosterutvecklingen ~20% av reglersignaler är nya hos däggdjur Skräp-DNA ger upphov till nya signaler.

21 29 däggdjur förklarar människans arvsmassa Lindblad-Toh, Nature in press > 3 miljoner signaler

22 Vi hittar både fler gener och många fler reglersignaler Bättre upplösning Nya signaler HÄRNÄST: däggdjur för att förstå varje bokstav

23 Pågående projekt När sjukdomsgener hittats, undersöker vi samma gener hos människor.

24 Tvångsyndrom hos Dobermann Pinschers Slickar kudden (startar vid ~4.8 månader) Slickar flanken (startar vid ~8.5 månader) Sår och ärr av allt slickande Människor med liknande sjukdom tvättar händerna allt för ofta

25 Jämför 92 sjuka och 68 friska Doberman p raw = 8x10-7 p genome = ,500 SNP with MAF > 0.05

26 Zoomar in (fin-mappar) på kromosom 7 Bara en gen:

27 Hur fungerar CDH2? Neuronal cadherin Binder ihop celler Under embryo utvecklingen: ger höger vänster symmetri I hjärnan: binder ihop celler vid synapserna så att de kan interagera Ger plasticitet (inlärning och minne)

28 Vad går fel i tvångsyndrom? 28

29 Leta fler mutationer i flera raser Resekvensera alla top regioner i arvsmassan Sjuka & friska i varje ras

30 Mutationer finns i vissa regioner av gener

31 Många genes påverkar synaptisk plasticitet Hur synapsen sitter ihop cadherin Hur synapser förändras dynamiskt Hur glutamat frisläpps

32 När vi hittat gener: dags att omsätta i praktiken! + Diagnostik Behandlingar Människan 32 Personalized medicine

Hundar hjälper oss att förstå människans sjukdomar. Kerstin Lindblad-Toh

Hundar hjälper oss att förstå människans sjukdomar. Kerstin Lindblad-Toh Hundar hjälper oss att förstå människans sjukdomar Kerstin Lindblad-Toh Målsättning med min forskning Att hitta människors sjukdomsgener via: - djurmodeller - en bättre förståelse av arvsmassan - storskalig

Läs mer

Genetik vid polyneuropatier. Christina Jern

Genetik vid polyneuropatier. Christina Jern Genetik vid polyneuropatier Christina Jern Information lagras i DNA 2 m DNA i varje cell Bara 3 cm kodar för protein Det humana genomet februari 2001 The International Human Genome Mapping Consortium

Läs mer

Metoder för att identifiera genetisk sjukdomar

Metoder för att identifiera genetisk sjukdomar Hunden människans sjukaste vän Olof Vadell Populärvetenskaplig sammanfattning av Självständigt arbete i biologi 2012 Institutionen för biologisk grundutbildning, Uppsala universitet Hunden har varit en

Läs mer

Genomic Era. Vad är autism? Tvillingstudier. Genetiska Riskfaktorer för neuropsykiatriska funktionshinder

Genomic Era. Vad är autism? Tvillingstudier. Genetiska Riskfaktorer för neuropsykiatriska funktionshinder Genomic Era Genetiska Riskfaktorer för neuropsykiatriska funktionshinder MaiBritt Giacobini PRIMA Järva 50tal Watson Crick double helix 2003 Humana genomet 3 miljarder baspar kartlagt Stor implikation

Läs mer

Erik Eriksson VMD Enheten för Bakteriologi

Erik Eriksson VMD Enheten för Bakteriologi Diagnostik VTEC/EHEC Erik Eriksson VMD Enheten för Bakteriologi SVA Tänker prata om VTEC / EHEC Sjukdomsframkallande faktorer PCR Magnetiska kulor (Immunomagnetisk separation) Diagnostik de vanligaste

Läs mer

Beteendegenetik. Vårt genetiska kod. Koden överförs vid celldelning. Handlar om hur psykologiska förmågor och möjliga beteenden ärvs i DNA

Beteendegenetik. Vårt genetiska kod. Koden överförs vid celldelning. Handlar om hur psykologiska förmågor och möjliga beteenden ärvs i DNA Beteendegenetik Handlar om hur psykologiska förmågor och möjliga beteenden ärvs i DNA Handlar också om samspelet mellan arv och miljö Viktigt att skilja på Genotyp den specifika genetiska koden vi har

Läs mer

Sara Ekvall, doktorand Inst. för immunologi, genetik & patologi Uppsala universitet Handledare: Marie-Louise Bondeson & Göran Annerén

Sara Ekvall, doktorand Inst. för immunologi, genetik & patologi Uppsala universitet Handledare: Marie-Louise Bondeson & Göran Annerén Sara Ekvall, doktorand Inst. för immunologi, genetik & patologi Uppsala universitet Handledare: Marie-Louise Bondeson & Göran Annerén Celler & DNA Vår kropp är uppbyggd av ~100 000 miljarder celler I cellen

Läs mer

En bioinformatisk genjakt

En bioinformatisk genjakt En bioinformatisk genjakt Efter en ide från: CUSMOBIO, Milano, Italien. Hur man kan söka i databaser efter information om en gen som kan ge ökad risk för bröstcacer. Bakgrund Människor utan symptom men

Läs mer

Genetisk testning av medicinska skäl

Genetisk testning av medicinska skäl Genetisk testning av medicinska skäl NÄR KAN DET VARA AKTUELLT MED GENETISK TESTNING? PROFESSIONELL GENETISK RÅDGIVNING VAD LETAR MAN EFTER VID GENETISK TESTNING? DITT BESLUT Genetisk testning av medicinska

Läs mer

Ärftliga sjukdomar och egenskaper hos hund

Ärftliga sjukdomar och egenskaper hos hund Engelsk bulldog Tibetansk terrier Västgötaspets Dvärgpinscher Chow chow Foto: Pleple2000 Foto: Flickr user skaty222 Foto: Sören T Eriksson Foto: Entheta Foto:Jurriaan Schulman Alla bilder Wikimedia commons

Läs mer

Fragil X. Genetik, diagnostik och symptom. A marker X chromosome Am J Hum Genet. 1969 May;21(3):231-44. Fragilt X - Historik. Förekomst av fragilt X

Fragil X. Genetik, diagnostik och symptom. A marker X chromosome Am J Hum Genet. 1969 May;21(3):231-44. Fragilt X - Historik. Förekomst av fragilt X Förekomst av fragilt Fragil Genetik, diagnostik och symptom MaiBritt Giacobini Helena Malmgren Karolinska Universitetssjukhuset 1/ 4-5000 pojkar 1 /6-8000 flickor Ungefär 500 personer har diagnosen i Sverige

Läs mer

Genetik II. Jessica Abbott

Genetik II. Jessica Abbott Genetik II Jessica Abbott Nukleosid Sockergrupp + kvävebas Kvävebaser: Puriner (adenin, guanin) Pyrimidiner (cytosin, thymin i DNA, uracil i RNA) Basparning A=T G C Packning av DNA i eukaryot cellkärna

Läs mer

Studier av ärftlig bakgrund till livmoderinflammation hos hundar

Studier av ärftlig bakgrund till livmoderinflammation hos hundar Delrapport år 2 av 3, till Svenska Kennelklubbens och Försäkringsbolaget Agrias Forskningsfond, september 2012, samt ansökan om utökat anslag för år 3. Studier av ärftlig bakgrund till livmoderinflammation

Läs mer

Människans genom Databaser ger kunskap om genetiska sjukdomar

Människans genom Databaser ger kunskap om genetiska sjukdomar Nationellt resurscentrum för biologi och bioteknik Övning i bioinformatik Människans genom Databaser ger kunskap om genetiska sjukdomar Många molekylärbiologiska databaser och program är fritt tillgängliga

Läs mer

Evolution i molekylärbiologiskt perspektiv

Evolution i molekylärbiologiskt perspektiv Nutidens upptäcktsfärder går till organismernas minsta beståndsdelar. Evolution i molekylärbiologiskt perspektiv En viktig milstolpe i vetenskapens historia är sekvenseringen av det mänskliga genomet.

Läs mer

Genetik en sammanfattning

Genetik en sammanfattning Genetik en sammanfattning Pär Leijonhufvud $\ BY: 3 februari 2015 C Innehåll Inledning 2 Klassisk genentik 2 Gregor Mendel munken som upptäckte ärftlighetens lagar....... 2 Korsningsrutor, ett sätt att

Läs mer

En bioinformatisk genjakt I

En bioinformatisk genjakt I En bioinformatisk genjakt I -jämförelser av olika arters genom I den här aktiviteten kan en elev självständigt undersöka det mänskliga genomet genom att hämta information från en databas på nätet. Målet

Läs mer

Information och samtyckesformulär inför genomisk utredning av ovanliga sjukdomar och syndrom med metoderna genomisk array och exomanalys

Information och samtyckesformulär inför genomisk utredning av ovanliga sjukdomar och syndrom med metoderna genomisk array och exomanalys Information och samtyckesformulär inför genomisk utredning av ovanliga sjukdomar och syndrom med metoderna genomisk array och exomanalys Detta informationsblad och samtyckesformulär är riktat till dig

Läs mer

Genetik. Så förs arvsanlagen vidare från föräldrar till avkomma. Demokrati och struktur inom och mellan anlagspar

Genetik. Så förs arvsanlagen vidare från föräldrar till avkomma. Demokrati och struktur inom och mellan anlagspar Genetik Så förs arvsanlagen vidare från föräldrar till avkomma Hunden har 78st kromosomer i varje cellkärna, förutom i könscellerna (ägg och spermier) där antalet är hälften, dvs 39st. Då en spermie och

Läs mer

GENETIK - Läran om arvet

GENETIK - Läran om arvet GENETIK - Läran om arvet Kroppens minsta levande enheter är cellerna I cellkärnorna finns vår arvsmassa - DNA (DNA - Deoxiribonukleinsyra) Proteiner Transportproteiner Strukturproteiner Enzymer Reglerande

Läs mer

Sammanfattning Arv och Evolution

Sammanfattning Arv och Evolution Sammanfattning Arv och Evolution Genetik Ärftlighetslära Gen Information om ärftliga egenskaper. Från föräldrar till av komma. Tillverkar proteiner. DNA (deoxiribonukleinsyra) - DNA kan liknas ett recept

Läs mer

Bestämning av antalet aktiva CYP2D6 genkopior (CNV) med Pyrosequencing. Anna-Lena Zackrisson PhD.

Bestämning av antalet aktiva CYP2D6 genkopior (CNV) med Pyrosequencing. Anna-Lena Zackrisson PhD. Bestämning av antalet aktiva CYP2D6 genkopior (CNV) med Pyrosequencing Anna-Lena Zackrisson PhD INTRODUKTION LINKÖPINGSENHETEN RÄTTSMEDICIN RÄTTSKEMI RÄTTSGENETIK INTRODUKTION Sammanställa genetisk information

Läs mer

Mitos - vanlig celldelning

Mitos - vanlig celldelning Mitos - vanlig celldelning Interfas Cellens normala tillstånd kopiering sker. Enskilda kromosomer kan inte urskiljas Profas DNA molekylerna packar ihop sig i tydliga kromosomer Metafas Cellkärnans membran

Läs mer

Cystnjursjukdomar och genetik. Carina Frykholm Klinisk genetik Akademiska sjukhuset, Uppsala

Cystnjursjukdomar och genetik. Carina Frykholm Klinisk genetik Akademiska sjukhuset, Uppsala Cystnjursjukdomar och genetik Carina Frykholm Klinisk genetik Akademiska sjukhuset, Uppsala Njurcystor i frisk population Ålder En cysta Bilaterala 30-49 år 1.7 % 1 % 50-70 år 11.5 % 4 % >70 år 22.1 %

Läs mer

När stamcellerna kommer till klassrummet

När stamcellerna kommer till klassrummet När stamcellerna kommer till klassrummet Klas Blomgren Översikt Hjärnans utveckling Plasticitet och stamceller Fysisk aktivitet Psykisk aktivitet berikad miljö 1 Huvudet och hjärnan Pannloben Hjässloben

Läs mer

Vad händer i ett genetiskt laboratorium?

Vad händer i ett genetiskt laboratorium? 12 utveckla nya metoder eller låta sådana prover delta i kvalitetskontrollprogram, såvida inte patienten har uttryckt att man inte vill att ens prov ska vara del av sådan verksamhet. Som alla andra sparade

Läs mer

Facit tds kapitel 18

Facit tds kapitel 18 Facit tds kapitel 18 Testa dig själv 18.1 1. Arvsanlagen finns i cellkärnan. Inför celldelningen samlas de i kromosomer. 2. Det kemiska ämne som bär på arvet kallas DNA. 3. Instruktionerna i DNA är ritningar,

Läs mer

Arytmogen högerkammarkardiomyopati

Arytmogen högerkammarkardiomyopati Centrum för kardiovaskulär genetik Norrlands universitetssjukhus Information till patienter och anhöriga Arytmogen högerkammarkardiomyopati Den här informationen riktar sig till dig som har sjukdomen arytmogen

Läs mer

Demenssjukdomar och ärftlighet

Demenssjukdomar och ärftlighet Demenssjukdomar och ärftlighet SveDem Årsmöte 141006 Caroline Graff Professor, Överläkare Forskningsledare vid Karolinska Institutet Centrum för Alzheimerforskning, Huddinge Chef för

Läs mer

Gener i hälsa och sjukdom

Gener i hälsa och sjukdom Gener i hälsa och sjukdom Upplägg Genetiska sjukdomar Introduktion Kromosomavvikelser Monogena sjukdomar Multifaktoriella (komplexa) sjukdomar Kristina Lagerstedt-Robinson Peter Gustavsson Artikel Exome

Läs mer

Hur kommer teknologiska landvinningar påverka sjukvården?

Hur kommer teknologiska landvinningar påverka sjukvården? Hur kommer teknologiska landvinningar påverka sjukvården? Per Hall, professor Institutionen för medicinsk epidemiologi och biostatistik Karolinska Institutet Stockholm Hemoglobin Normalvärde för kvinnor

Läs mer

Miriam Mints Docent, överläkare Karolinska Universitetssjukhuset Solna

Miriam Mints Docent, överläkare Karolinska Universitetssjukhuset Solna Miriam Mints Docent, överläkare Karolinska Universitetssjukhuset Solna 2010 09 02 EC är den fjärde vanligaste tumörformen hos kvinnor och utgör ca 6 % av all kvinnlig cancer vilket motsvarar ca 1400 fall/år

Läs mer

HUGO-projektet. Kartläggningen av det mänskliga genomet

HUGO-projektet. Kartläggningen av det mänskliga genomet Vem är HUGO? HUGO-projektet Kartläggningen av det mänskliga genomet Kartläggning av genom Genom= allt DNA hos en organism. Kartläggningen sker genom att man bestämmer DNA-sekvensen för hela genomet och

Läs mer

Arvet och DNA. Genetik och genteknik

Arvet och DNA. Genetik och genteknik Arvet och DNA Genetik och genteknik Genetik Du är inte en kopia utav någon av dina föräldrar utan en unik blandning av egenskaper från båda dina föräldrar. Genetik är den del av biologin som handlar om

Läs mer

Hur påverkar strålning celler och organismer?

Hur påverkar strålning celler och organismer? Hur påverkar strålning celler och organismer? Bo Stenerlöw Inst. f. immunologi, genetik och patologi Rudbecklaboratoriet Uppsala universitet Joniserande strålning Dos: Gray (Gy =

Läs mer

Klinisk genetik en introduktion

Klinisk genetik en introduktion Klinisk genetik en introduktion Ulf Kristoffersson Överläkare, docent Genetiska kliniken Labmedicin Skåne, Lund Vad ska en sjuksköterska kunna om ärftlighet? Ta en familjeanamnes och rita ett enkelt släktträd

Läs mer

Med hopp om framtiden transposoner, DNA som flyttar sig själv

Med hopp om framtiden transposoner, DNA som flyttar sig själv Med hopp om framtiden transposoner, DNA som flyttar sig själv Jessica Bergman Populärvetenskaplig sammanfattning av Självständigt arbete i biologi VT 2008 Institutionen för biologisk grundutbildning, Uppsala

Läs mer

Flatcoated retriever, schäfer, tysk jaktterrier och finsk stövare är några raser som bara har 55 procents chans att leva i tio år.

Flatcoated retriever, schäfer, tysk jaktterrier och finsk stövare är några raser som bara har 55 procents chans att leva i tio år. Totalt alla raser Hundarna blir äldre över tid Över 90 procent blir äldre än fem år idag, och två tredjedelar av alla hundar blir över 10 år gamla. 1995 avled 4,4 procent av hanhundarna, 2002 avled 3,9

Läs mer

Arv + miljö = diabetes?

Arv + miljö = diabetes? Arv + miljö = diabetes? Kristina Lejon universitetslektor, immunologi, Institutionen för klinisk mikrobiologi Vad är det som gör att vi får diabetes? Anna Möllsten var nyss inne på den frågan och visade

Läs mer

ESSENCE-dag 2. Läkarens arbete. /Elisabeth Fernell. Utvecklingsneurologiska enheten, Barnkliniken, Skaraborgs sjukhus, Mariestad

ESSENCE-dag 2. Läkarens arbete. /Elisabeth Fernell. Utvecklingsneurologiska enheten, Barnkliniken, Skaraborgs sjukhus, Mariestad ESSENCE-dag 2 Läkarens arbete /Elisabeth Fernell Utvecklingsneurologiska enheten, Barnkliniken, Skaraborgs sjukhus, Mariestad Gillbergcentrum, Göteborgs universitet Innehåll Läkarens del i: Funktionsutredning

Läs mer

Screening, genetik, fosterdiagnostik och etik

Screening, genetik, fosterdiagnostik och etik Screening, genetik, fosterdiagnostik och etik Kunskapsbakgrund särskilt utredningsuppdrag 2013 Henning Elvtegen, Ledningsstaben Innehållsförteckning Inledning 3 1. Bakgrund 4 1.1 Uppdrag och

Läs mer

Dermoid sinus hos Rhodesian ridgeback

Dermoid sinus hos Rhodesian ridgeback Dermoid sinus hos Rhodesian ridgeback Foto: Ingrid Bergman Av Ingrid Bergman Engelsk titel: Dermoid sinus in the Rhodesian ridgeback Handledare: Göran Andersson Inst. för husdjursgenetik Examinator: Stefan

Läs mer

Lycka till! Tentamen. Kursens namn: Medicin C, Tumörbiologi Kursens kod: MC1728 Kursansvarig: Anna Göthlin Eremo

Lycka till! Tentamen. Kursens namn: Medicin C, Tumörbiologi Kursens kod: MC1728 Kursansvarig: Anna Göthlin Eremo Tentamen Kursens namn: Medicin C, Tumörbiologi Kursens kod: MC1728 Kursansvarig: Anna Göthlin Eremo Datum: 2012-06-01 Skrivtid: 4 timmar 08:15-12:15 (P245) Poängfördelning: Karin Franzén Pia Wegman Sabina

Läs mer

Tentamen Biologi BI1112 Termin och år: Klockan:

Tentamen Biologi BI1112 Termin och år: Klockan: Tentamen Biologi BI1112 Termin och år: 120312 Klockan: 0800-13.15 Betygsgränser:!!! 50-66%! Betyg 3!!!!! 67-83%! Betyg 4!!!!! 84-100%! Betyg 5 Fråga 1-4 Cellbiologi Fråga 5-7 Genetik Fråga 8-10 Växtfysiologi!!!!

Läs mer

UVIS. Ett nationellt center för avbildning med tyngdpunkt inom translationell medicin. Jan Grawé. Uppsala Universitet

UVIS. Ett nationellt center för avbildning med tyngdpunkt inom translationell medicin. Jan Grawé. Uppsala Universitet UVIS Ett nationellt center för avbildning med tyngdpunkt inom translationell medicin Jan Grawé Rudbecklaboratoriet b t Uppsala Universitet Science For Life Laboratory (SciLifeLab) En satsning på storskalig

Läs mer

GENKOMB - en metod att hitta målprotein för läkemedel.

GENKOMB - en metod att hitta målprotein för läkemedel. ENKOMB - en metod att hitta målprotein för läkemedel. Erik urell dam meur Jakub Westholm i samarbete med strazeneca Disposition Biologisk bakgrund: cellen och arvsmassan proteinsyntes genuttryck och genuttrycksdata

Läs mer

X-bunden nedärvning. Information för patienter och föräldrar. Genetiska patientföreningars paraplyorganisation: Sällsynta diagnoser

X-bunden nedärvning. Information för patienter och föräldrar. Genetiska patientföreningars paraplyorganisation: Sällsynta diagnoser 12 Uppsala Örebroregionen: Klinisk Genetik Rudbecklaboratoriet Akademiska barnsjukhuset 751 85 Uppsala Tel: 018-611 59 40 ; Fax: 018-55 40 25 X-bunden nedärvning Norra sjukvårdsregionen: Klinisk Genetik

Läs mer

Farmakogenetik/genomi k. Översikt. Farmakogenetik / farmakogenomik. Introduktion. Farmakogenetik: Vad testar man? Klinisk praxis idag?

Farmakogenetik/genomi k. Översikt. Farmakogenetik / farmakogenomik. Introduktion. Farmakogenetik: Vad testar man? Klinisk praxis idag? Farmakogenetik/genomi k HT-2009 Jonas Melke Institutionen för neurovetenskap och fysiologi Sektionen för farmakologi Göteborgs universitet Översikt Introduktion Definitioner Genetisk

Läs mer

Klipp-och-klistra DNA: fixa mutationen med gen editering DNA, RNA och Protein

Klipp-och-klistra DNA: fixa mutationen med gen editering DNA, RNA och Protein Huntingtons sjukdom forsknings nyheter. I klartext Skriven av forskare För de globala HS medlemmarna. Klipp-och-klistra DNA: fixa mutationen med gen editering Forskare gör exakta ändringar av DNA i ett

Läs mer

Curly Coated Retriever Undersökning

Curly Coated Retriever Undersökning Curly Coated Retriever Undersökning Läs noga igenom instruktionerna innan ni fyller i enkäten Fyll i en enkät för varje Curly Coated Retreiver du äger som visar eller har visat hårlöshet/ tunn päls Introduktion

Läs mer

et Juvertumörer Vill du bidra till ökad kunskap om tumörsjukdomar hos hund?

et Juvertumörer Vill du bidra till ökad kunskap om tumörsjukdomar hos hund? Djurägarinformation om Projektet et Juvertumörer hos hund Vill du bidra till ökad kunskap om tumörsjukdomar hos hund? Vi letar efter gener som orsakar juvertumörer. Varför? För att kunna testa symptomfria

Läs mer

Gener, genom och kromosomer , 6.6 och sid

Gener, genom och kromosomer , 6.6 och sid Gener, genom och kromosomer 6.1-6.3, 6.6 och sid 263-265 En gen är en DNA-sekvens som kan.. En kromosom är en DNA-molekyl. I cellen finns det lika mycket protein som DNA i kromosomerna, se fig6-1. Ett

Läs mer

Genetik, Gen-etik och Genteknik

Genetik, Gen-etik och Genteknik Genetik, Gen-etik och Genteknik Syfte och innehåll Att utveckla kunskap om det genetiska arvet och genteknikens möjligheter. Arbetssätt Vi kommer att varva föreläsningar, diskussioner, arbetsuppgifter

Läs mer

Mikroorganismer och cancer

Mikroorganismer och cancer Mikroorganismer och cancer Vilken betydelse har bakterier, svampar, parasiter för cancerutveckling? 1 Mikroorganismers betydelse för cancerutveckling Svårt ämne a: studera Lång latensad, flera steg Exogena

Läs mer


ELEMENTÄR - SVÅRARE FÄRGGENETIK. Del 3 ELEMENTÄR - SVÅRARE FÄRGGENETIK Del 3 av Maria Grönkvist Efter det att jag i förra numret av HR skrev en lista på den genetiska koden för en del färgvarianter har jag fått en fråga som lyder: hur får man

Läs mer

Är genetiken på väg att bota diabetes?

Är genetiken på väg att bota diabetes? Är genetiken på väg att bota diabetes? Simon Eklöv Populärvetenskaplig sammanfattning av Självständigt arbete i biologi 2013 Institutionen för biologisk grundutbildning, Uppsala universitet. Under början

Läs mer


Farmakogenetik/genomik Farmakogenetik/genomik HT-2013 Lars Westberg Institutionen för neurovetenskap och fysiologi Sektionen för farmakologi Göteborgs universitet Översikt Introduktion Definitioner

Läs mer

Datorer och matematik hjälper oss att motverka sjukdomar

Datorer och matematik hjälper oss att motverka sjukdomar GA N AT ION ALCTAC ATCA G ENOMI CSGT INFR A S T RU CTURE Datorer och matematik hjälper oss att motverka sjukdomar Adam Ameur Bioinformatiker SciLifeLab Uppsala, 13e Maj 2014 Introduktion till bioinformatik

Läs mer

Allmänt om bakterier

Allmänt om bakterier Bakterier Allmänt om bakterier Bakterier är varken djur eller växter De saknar cellvägg och klorofyll De är viktiga nedbrytare - bryter ner döda växter och djur En matsked jord = 10 miljarder bakterier

Läs mer

Medicin B, Sjukdomslära med farmakologi, 15hp Tentamen del I, provkod 0101. (För studenter registrerade V15) Kurskod: MC1402.

Medicin B, Sjukdomslära med farmakologi, 15hp Tentamen del I, provkod 0101. (För studenter registrerade V15) Kurskod: MC1402. Medicin B, Sjukdomslära med farmakologi, 15hp Tentamen del I, provkod 0101. (För studenter registrerade V15) Kurskod: MC1402. Kursansvarig: Per Odencrants Datum: 2015 06 13 Skrivtid: 4 timmar Totalpoäng:

Läs mer

Vi är tacksamma för att ni ställer upp och svarar på hälsoenkäten för schnauzer.

Vi är tacksamma för att ni ställer upp och svarar på hälsoenkäten för schnauzer. Vi är tacksamma för att ni ställer upp och svarar på hälsoenkäten för schnauzer. Enkäten är en del av RAS, vilken ska uppgraderas i år. Vilket vi hoppas leder fram till hur vår fantastiska ras utvecklats

Läs mer

Tentamen: Biologi 1TV001 Termin och år: VT08

Tentamen: Biologi 1TV001 Termin och år: VT08 Tentamen: Biologi 1TV001 Termin och år: VT08 7/3-08, klockan 08.00-13.00 Skriv svar på alla frågor på separata papper, märk varje papper med kod: Betygsgränser: 50-66% Betyg 3 67-83% Betyg 4 84-100 % Betyg

Läs mer

Williams syndrom. Britt-Marie Anderlid Klinisk Genetik och Astrid Lindgrens barnsjukhus

Williams syndrom. Britt-Marie Anderlid Klinisk Genetik och Astrid Lindgrens barnsjukhus Williams syndrom Britt-Marie Anderlid Klinisk Genetik och Astrid Lindgrens barnsjukhus Syndrom Ordet kommer från grekiska och betyder ``springa tillsammans Syndrom : En kombination av avvikelser som tros

Läs mer

Genterapi. Varför genomförs genterapi? Förutsättning för genterapi är att den genetiska skadan är känd!

Genterapi. Varför genomförs genterapi? Förutsättning för genterapi är att den genetiska skadan är känd! GENTERAPI - T3 HT 2009 Jan-Ingvar Jönsson Genterapi Överföring av terapeutisk (frisk) gen till sjuk cell eller vävnad Att reparera en skadad gen Att ersätta en skadad eller deleterad gen med en frisk gen

Läs mer

Kromosomrubbningar och utvecklingsfel

Kromosomrubbningar och utvecklingsfel Kromosomrubbningar och utvecklingsfel Pär Leijonhufvud NkB/Nk1b (19 mars 2012) 1. Kromosomrubbningar och utvecklingsfel (a) Många olika typer av fel, i grunden två orsaker i. Kromosomrubbningar ii. Fel

Läs mer

LPP Nervsystemet, hormoner och genetik

LPP Nervsystemet, hormoner och genetik LPP Nervsystemet, hormoner och genetik Det är bara hormonerna och han är full av hormoner är två vanliga uttryck med ordet hormon, men vad är egentligen hormoner och hur påverkar de kroppen? Vi har ett

Läs mer

DNA-sekvenserings utskick Carola Andersson KMP-lab Sahlgrenska Universitetssjukhuset

DNA-sekvenserings utskick Carola Andersson KMP-lab Sahlgrenska Universitetssjukhuset DNA-sekvenserings utskick 2012 Carola Andersson KMP-lab Sahlgrenska Universitetssjukhuset Meningen med utskicket Kvalitets kontroll av: Längd läsbar sekvens Detektion av mutationer/variationer Namngivning

Läs mer

Genetisk variation är livsviktig för vitaliteten och ganska snabbt även en förutsättning för överlevnaden hos en art.

Genetisk variation är livsviktig för vitaliteten och ganska snabbt även en förutsättning för överlevnaden hos en art. Naturens behov av genetisk variation Genetisk variation är livsviktig för vitaliteten och ganska snabbt även en förutsättning för överlevnaden hos en art. Då vi benämner en art i naturen som utrotningshotad

Läs mer

Thomas Brännström Universitetslektor, överläkare Inst. för medicinsk biovetenskap Enheten för patologi

Thomas Brännström Universitetslektor, överläkare Inst. för medicinsk biovetenskap Enheten för patologi Kan man ärva ALS? Thomas Brännström Universitetslektor, överläkare Inst. för medicinsk biovetenskap Enheten för patologi Jag ska försöka besvara ytterligare några frågor än rubrikens. Jag börjar med att

Läs mer

Huntingtons sjukdom - en hjärnsjukdom

Huntingtons sjukdom - en hjärnsjukdom Huntingtons sjukdom forsknings nyheter. I klartext Skriven av forskare För de globala HS medlemmarna. Benmärgstransplantation vid Huntingtons sjukdom Benmärgstransplantation skyddar HS-möss från vissa

Läs mer

Forskning om diagnos och behandling vid Alzheimers sjukdom

Forskning om diagnos och behandling vid Alzheimers sjukdom Forskning om diagnos och behandling vid Alzheimers sjukdom Erik Portelius Sahlgrenska Universitetssjukhuset, PhD Institutionen för neurovetenskap och fysiologi vid Göteborgs Universitet Kompetensutveckling

Läs mer

Vad är repetitionslängd?

Vad är repetitionslängd? Huntingtons sjukdom forsknings nyheter. I klartext Skriven av forskare För de globala HS medlemmarna. Ny analys visar att den korta CAG-längden inte spelar roll Storleken är inte allt: forskning tyder

Läs mer

Den engelska artikeln tillsammans med en lista på litteraturhänvisningar finns RSV2000 engelska hemsida.

Den engelska artikeln tillsammans med en lista på litteraturhänvisningar finns RSV2000 engelska hemsida. Keijo Kodis från Finland har skickat en vetenskaplig artikel och ytterligare förklaringar från författarna som vi är väldigt tacksamma för att få sprida. Originaltexten är på Engelska och det är därför

Läs mer

Planering i genetik och evolution för Så 9 Lag Öst. (Planeringen är preliminär och vissa lektionspass kan ändras)

Planering i genetik och evolution för Så 9 Lag Öst. (Planeringen är preliminär och vissa lektionspass kan ändras) Planering i genetik och evolution för Så 9 Lag Öst (Planeringen är preliminär och vissa lektionspass kan ändras) Lokal Pedagogisk Planering i Biologi Ansvarig lärare: Janne Wåhlin Ämnesområde: Genetik

Läs mer

Karl Holm Ekologi och genetik, EBC, UU. Nick Brandt. Populationsgenetik

Karl Holm Ekologi och genetik, EBC, UU. Nick Brandt. Populationsgenetik Karl Holm Ekologi och genetik, EBC, UU karl.holm@ Nick Brandt Populationsgenetik Kursens upplägg Föreläsningar 24/4, 10:15-16:00 Friessalen Introduktion, HWE 27/4, 10:15-16:00 Inavel 28/4, 10:15-16:00

Läs mer

2014-08-29 Jan Minde LINUS dagarna 1

2014-08-29 Jan Minde LINUS dagarna 1 2014-08-29 Jan Minde LINUS dagarna 1 Ärftlig smärtokänslighet Jan Minde Ortoped Gällivare sjukhus, Ortoped klinken 2014-08-29 Jan Minde LINUS dagarna 2 ÄRFTLIGA SJUKDOMAR I Norrbotten

Läs mer

MERLE. fascinerande, förbryllande och förskräckande

MERLE. fascinerande, förbryllande och förskräckande MERLE fascinerande, förbryllande och förskräckande Det finns en pälsfärg hos hundar som aldrig undgår att väcka uppmärksamhet. Den liknar ingenting annat. Det handlar om det som hos flera vallhundsraser

Läs mer

Onkogenetisk regionmottagning i Linköping. Marie Stenmark Askmalm Sigrun Liedgren Lilianne Ferraud Madelene Jansson Ann-Charlotte Isaksson

Onkogenetisk regionmottagning i Linköping. Marie Stenmark Askmalm Sigrun Liedgren Lilianne Ferraud Madelene Jansson Ann-Charlotte Isaksson Onkogenetisk regionmottagning i Linköping Marie Stenmark Askmalm Sigrun Liedgren Lilianne Ferraud Madelene Jansson Ann-Charlotte Isaksson Dagordning Organisation Mål för onkogenetiska mottagningen Definition

Läs mer

Nomenklatur för vanliga SNP-analyser Gör vi rätt?

Nomenklatur för vanliga SNP-analyser Gör vi rätt? Nomenklatur för vanliga SNP-analyser Gör vi rätt? Camilla Valtonen-André Tisdagen den 10 nov 2015 Nomenklatur för vanliga SNP-analyser Nomenklatur vad är det? Vad är rätt nomenklatur? Guidelines Varför

Läs mer

Tolkning av resultat för genetiskt test av LPN1

Tolkning av resultat för genetiskt test av LPN1 Tolkning av resultat för genetiskt test av LPN1 Fri (N/N): En fri hund har två kopior av den normala genen (även kallat homozygot normal). Men detta resultat utesluter inte möjligheten att en hund kan

Läs mer

Tidiga erfarenheter av arvets mysterier

Tidiga erfarenheter av arvets mysterier Cellens genetik Cellen Växtcellen Växtcellen Tidiga erfarenheter av arvets mysterier Artförädling genom riktad avel Religiösa förbud mot syskongiftemål Redan de gamla grekerna.. Aristoteles ~350 år före

Läs mer

För att komma till källan måste man gå mot strömmen

För att komma till källan måste man gå mot strömmen För att komma till källan måste man gå mot strömmen D GENETICA FÄRGER OCH HÅRLAG HOS BELGISK VALLHUND Belgisk vallhund omfattar de fyra raserna malinois, laekenois, tervueren och groenendael. I ursprungslandet

Läs mer

Stamceller är sådana celler som kan bli vilken sorts cell som helst Stamceller specialiserar sig så småningom till ex. muskelceller, blodceller,

Stamceller är sådana celler som kan bli vilken sorts cell som helst Stamceller specialiserar sig så småningom till ex. muskelceller, blodceller, Stamceller Vad är stamceller? Från början är vi bara en cell Den cellen delar på sig och blir 2 celler, 4 celler, 8 celler osv tills de är de 100 000 miljarder celler en vuxen människa består av Men alla

Läs mer

Betygskriterier DNA/Genetik

Betygskriterier DNA/Genetik Betygskriterier DNA/Genetik Godkänd Du skall Känna till hur DNA molekylen är uppbyggd, vilka de genetiska språket(bokstäverna) är och hur de formar sig i DNA- molekylen Känna till begreppen Gen, Kromosom,

Läs mer

Genetik. Gregor Mendel onsdag 12 september 12

Genetik. Gregor Mendel onsdag 12 september 12 Gregor Mendel 1822-1884 1 Mendel valde ärtor för att undersöka hur arvet förs vidare från föräldrar till avkomma, alltså hur exempelvis utseende ärvs mellan generationer. Med ärtorna kunde han styra sina

Läs mer

LHON är en gåtfull sjukdom Referat av professor Thomas Rosenbergs föreläsning på LHON Eye Society s seminarium, Hagaberg, 25-26 oktober 2013.

LHON är en gåtfull sjukdom Referat av professor Thomas Rosenbergs föreläsning på LHON Eye Society s seminarium, Hagaberg, 25-26 oktober 2013. LHON är en gåtfull sjukdom Referat av professor Thomas Rosenbergs föreläsning på s seminarium, Hagaberg, 25-26 oktober 2013. År 1871 publicerade Theodor Karl Gustav von Leber, professor i Göttingen i Tyskland,

Läs mer

Bioinformatik. Marina Axelson-Fisk Matematisk orientering, 30 nov 2015

Bioinformatik. Marina Axelson-Fisk Matematisk orientering, 30 nov 2015 Bioinformatik Marina Axelson-Fisk Matematisk orientering, 30 nov 2015 Bioinformatik Bioinformatik Var används bioinformatik? DNA analys Medicin DNA-sekvensering och assemblering Sekvensanalys Proteinstruktur

Läs mer

HT 2011. En farmakologs syn på. Biologisk variation. Orsaker & konsekvenser Läkemedelsanvändning. I Nylander. Medicin & Farmaci

HT 2011. En farmakologs syn på. Biologisk variation. Orsaker & konsekvenser Läkemedelsanvändning. I Nylander. Medicin & Farmaci HT 2011 En farmakologs syn på Biologisk variation Orsaker & konsekvenser Läkemedelsanvändning I Nylander Medicin & Farmaci Individrelaterade faktorer Vad händer i veckan? Introduktion Miljöns inverkan

Läs mer

Hur man avlar fram friska vita siameser

Hur man avlar fram friska vita siameser Början I England, runt 1960, såg Patricia Turner, en berömd kattgenetiker, ett överexponerat foto av en lilamaskad siames. Vissa säger att den bilden gav henne inspiration till att starta upp ett avelsprogram

Läs mer

Denna pdf-fil är nedladdad från Illustrerad Vetenskaps webbplats ( och får ej lämnas vidare till tredjepart.

Denna pdf-fil är nedladdad från Illustrerad Vetenskaps webbplats ( och får ej lämnas vidare till tredjepart. Käre användare! Denna pdf-fil är nedladdad från Illustrerad Vetenskaps webbplats ( och får ej lämnas vidare till tredjepart. Av hänsyn till copyright innehåller den inga foton. Med vänlig

Läs mer

07-03-08. Ordning i Myllret

07-03-08. Ordning i Myllret Moment Ordning i Myllret Studieplan och bedömningsgrunder i Biologi för åk 7 Bedömningsgrunder för uppnåendemålen veta att biologin är läran om det levande förstå förutsättningar för liv kunna använda

Läs mer

Hur blev boxern så bra och vad kan vi lära av historien? Skribent: Anna Persson

Hur blev boxern så bra och vad kan vi lära av historien? Skribent: Anna Persson Hur blev boxern så bra och vad kan vi lära av historien? Skribent: Anna Persson Lennart Swenson är forskare med specialisering på hundars reproduktion, funktion och hälsa på institutionen för husdjursgenetik

Läs mer

Information till dig som får behandling med JEVTANA (cabazitaxel)

Information till dig som får behandling med JEVTANA (cabazitaxel) Information till dig som får behandling med JEVTANA (cabazitaxel) Om JEVTANA JEVTANA är ett läkemedel som används för behandling av prostatacancer som har fortskridit efter att du har behandlats med annan

Läs mer

Genetisk diagnostik vid neuropsykiatriska funktionshinder

Genetisk diagnostik vid neuropsykiatriska funktionshinder Genetisk diagnostik vid neuropsykiatriska funktionshinder MaiBritt Giacobini, MD,PhD PRIMA Barn och Vuxenpsykiatri AB 3 Maj, 2012 Upplägg Lite om neuropsykiatriska funktionshinder Miljöfaktorer Gener och

Läs mer

Bilaga 1: SBTKs arbete 1990 fram till nu Senast uppdaterad: 2010-07-22

Bilaga 1: SBTKs arbete 1990 fram till nu Senast uppdaterad: 2010-07-22 SBTK:s arbete Svenska Bostonterrierklubben har arbetat aktivt med avelsfrågor sedan 1970-talet. Dock dröjde det till 1994/1995 innan någon nedskriven viljeyttring fanns att tillgå för uppfödarna. Arbetet

Läs mer

Arv och miljö, eller kineser, koreaner och japaner

Arv och miljö, eller kineser, koreaner och japaner Arv och miljö, eller kineser, koreaner och japaner Som vi vet styrs de egenskaper vi får, av vilka egenskaper våra förfäder hade. Vi har sett tabellen (Punettdiagram) med kaninerna. Nu ska vi använda våra

Läs mer

Hund och katt hälsa, hållbarhet och välfärd

Hund och katt hälsa, hållbarhet och välfärd Fakulteten för veterinärmedicin och husdjursvetenskap Hund och katt hälsa, hållbarhet och välfärd Det är något särskilt med hundar och katter Familjemedlemmar, arbetsredskap och stöd Hunden och katten

Läs mer

DNA- analyser kan användas för att

DNA- analyser kan användas för att Genteknik DNA- analyser kan användas för att -identifiera och koppla misstänkta till brottsplats -fria oskyldigt utpekade och oskyldigt fällda -personidentifiering vid masskatastrofer, krig, massgravar

Läs mer

PROV 6 Bioteknik. 1. Hur klona gener med hjälp av plasmider?

PROV 6 Bioteknik. 1. Hur klona gener med hjälp av plasmider? För essäsvaren 1 2 kan den sökande få högst 9 poäng/fråga. Vid poängsättningen beaktas de exakta sakuppgifter som den sökande gett i sitt svar. För dessa kan den sökande få högst 7 poäng. Dessutom 1. Hur

Läs mer

Vad kan vi lära om sambandet mellan skolelever miljö och psykisk hälsa med hjälp av epigenetik?

Vad kan vi lära om sambandet mellan skolelever miljö och psykisk hälsa med hjälp av epigenetik? Vad kan vi lära om sambandet mellan skolelever miljö och psykisk hälsa med hjälp av epigenetik? Catharina Lavebratt Centrum för Molekylär Medicin Karolinska Institutet Yvonne Forsell Modell Miljö Stress

Läs mer