Hundar hjälper oss att förstå människans sjukdomar. Kerstin Lindblad-Toh

Save this PDF as:
 WORD  PNG  TXT  JPG

Storlek: px
Starta visningen från sidan:

Download "Hundar hjälper oss att förstå människans sjukdomar. Kerstin Lindblad-Toh"

Transkript

1 Hundar hjälper oss att förstå människans sjukdomar Kerstin Lindblad-Toh

2 Målsättning med min forskning Att hitta människors sjukdomsgener via: - djurmodeller - en bättre förståelse av arvsmassan - storskalig teknologi och nya strategier Att utveckla ny diagnostik och behandlingsmetoder som bygger på kunskap om sjukdomsgener.

3 Hundars historia hjälper oss hitta sjukdomsgener Stora skillnader i utseende och beteende mellan raser Vi har valt egenskaper och anlag med stor effekt Anrikning av sjukdom inom raser Lättare hitta generna!! x x x x x Egenskap Sjukdom

4 Hund och människan har samma sjukdomar 1. Cancer 2. Epilepsi 3. Thyroidea sjukdomar 4. Allergier 5. Hjärtsjukdomar 6. Autoimmuna sjukdomar 7. Prog. Retinal Atrofi 8. Katarakter 9. Tvångsyndrom Tillgängliga sjukjournaler och stamtavlor

5 Människans och hundens gener i par 99% av hundens genom har sekvenserats Lätt hitta motsvarande människogen Regler signaler också likadana

6 Hur letar vi sjukdomsgener? Markörer i genomet varierar mellan olika hundar C A C G A T T C G A T G G A C G T C A C G A T A C G A T G G A C G T SNP (Single Nucleotide Polymorphism)

7 2.5 miljoner SNPar identifierade = 1 SNP/kb

8 Sjukdomsmappning med markörer och haplotyper Chromosome A / G C / G C / G A / T T / C A / T

9 SNP antal beror på längden av haplotypblock Korta haplotyper: fler SNPs behövs Långa haplotyper: färre SNPs behövs

10 Hundars historia gynnsam p.10 Domesticering ( ~ 30,000 år sedan)) Rasbildning (< 200 år sedan) Stora kromosombitar nedärvs tillsammans Lätt att hitta rätt region Raser är nära släkt -> samma mutationer

11 Fas 1: Genmappning inom en ras Leta igenom hela genomet efter en region associerad med sjukdom Långa haplotyper: färre SNPar behövs 500 kb

12 Fas 2: Finmappning med FLERA raser Addera andra raser och hitta liten region med få gener

13 Sammanfattning av vit färg mappning 2,400,000,000 bases (hela hundgenomet) Genom-vid mappning i 20 boxer 1,000,000 bases Fin mappning i Boxer & Bullterrier 100,000 bases Del av gen är misstänkt

14 Studieupplägg -> signifikanta resultat Markörer: > 15,000 SNPs testar >95% av genomet Hundar: Mycker mera effektivt än hos människa - tiotusentals patienter behövs hos människa

15 Med nya verktyg har vi hittat gener Nature Genetics, 2007 Nature Genetics, 2007 Vit färg Hårkam & & dövhet neuraltubsdefekt boxer R. Ridgeback MITF FGF3, FGF4, FGF19 Science, 2007 Genome Research, 2008 Hårlös & Dagblindhet tandproblem Strävhårig Tax Kinesisk nakenhund NPHP4 FOXI2 PNAS, 2009 Nature Genetics, 2007 PLOS Genetics, 2011 Human Genetics, 2007 ALS SLE Familjär Feber Kardiomyopati P. W. Corgi N. S. D. T. Retrievers Shar-Peis Boxers SOD1 Flera gener HAS2 Flera gener

16 Olika mutationstyper i monogena egenskaper Vit färg Hårkam Hårlöshet Indel i promotor ändrat uttryck? Repetitiv sekvens adderad Duplikation - (CNV?) - överuttryck? kort indel: kodande - felaktigt protein Dagblindhet Deletion av exon - kortare protein Komplexa sjukdomar: många typer av reglerande mutationer?

17 Hur läser vi av arvsmassan? Cirka 3 miljarder bokstäver: acggtggtctatttvargaggctatgafinnstttcgcctgattaggtagctagc tagcgenernagcgttttacggtggtctatttgaggctatgatttcgcctgatta ggtagctahurgctagcgcgtgagsättsgctatgatttdecgcctgapåtta ggtagjämförctagctagcgcgagcgdjurencgttttacattctttgcaga gagcatgatggasåaattgttgttsynstatttaattgggctdetctgagattt gtcgttagtcgattviktigatagggattccgatcgcgatcgcgatcgatcgct Hur tyder vi arvsmassan?

18 Hur läser vi av arvsmassan? Cirka 3 miljarder bokstäver: acggtggtctatttvargaggctatgafinnstttcgcctgattaggtagctagc tagcgenernagcgttttacggtggtctatttgaggctatgatttcgcctgatta ggtagctahurgctagcgcgtgagsättsgctatgatttdecgcctgapåtta ggtagjämförctagctagcgcgagcgdjurencgttttacattctttgcaga gagcatgatggasåaattgttgttsynstatttaattgggctdetctgagattt gtcgttagtcgattviktigatagggattccgatcgcgatcgcgatcgatcgct human armadillo elefant kanin igelkott katt delfin Områden med få skillnader är de viktiga

19 Hur läser vi av arvsmassan? Cirka 3 miljarder bokstäver: acggtggtctatttvargaggctatgafinnstttcgcctgattaggtagctagc tagcgenernagcgttttacggtggtctatttgaggctatgatttcgcctgatta ggtagctahurgctagcgcgtgagsättsgctatgatttdecgcctgapåtta ggtagjämförctagctagcgcgagcgdjurencgttttacattctttgcaga gagcatgatggasåaattgttgttsynstatttaattgggctdetctgagattt gtcgttagtcgattviktigatagggattccgatcgcgatcgcgatcgatcgct human armadillo elefant kanin igelkott katt delfin Områden med få skillnader är de viktiga

20 Komparativ genomik ger förståelse av människans arvsmassa >5 % av däggdjursgenom har en funktion ~1.5 % ger upphov till proteiner >3.5 % reglersignaler (när, var, hur bilda proteiner) ~20,000 gener hos däggdjur Genfamiljer expanderar hos vissa djurarter De flesta och starkaste reglersignalerna sitter vid gener som styr bl a fosterutvecklingen ~20% av reglersignaler är nya hos däggdjur Skräp-DNA ger upphov till nya signaler.

21 29 däggdjur förklarar människans arvsmassa Lindblad-Toh, Nature 2011 > 3 miljoner signaler

22 Vi hittar både fler gener och många fler reglersignaler Bättre upplösning Nya signaler HÄRNÄST: däggdjur för att förstå varje bokstav

23 Pågående projekt När sjukdomsgener hittats, undersöker vi samma gener hos människor.

24 Pågående projekt När sjukdomsgener hittats, undersöker vi samma gener hos människor.

25 Axelsson et al, Nature, 2013 Vilka förändringar i arvsmassan har lett till hundens domesticering? Letade hunden upp människan? Fångade människor vargungar?

26 Jämför arvsmassan hos hund och varg Regioner som skiljer mellan hund och varg Regioner där alla hundar är lika Ca 40 region leder till domesticerade hundar

27 Beteende och metabolism har selekterats Gener som påverkar hjärnans utveckling och funktion - Tidiga förändringar?????? Gener som påverkar stärkelse nedbrytning - Adaptation till jordbrukskulturer. - Samevolution med människan? Påverkar selektionen våra sjukdomar?

28 Carneiro etal Science 2014 Beteende viktigt i kaniners domesticering in collaboration with Leif Andersson, Miguel Carneiro, Carl-Johan Rubin, Nuno Ferrand and the rabbit genome consortium Domesticering startade i södra Frankrike på sexhundra talet. Tusentals förändringar reglerar hjärngener Beteende viktigt

29 Tvångsyndrom hos Dobermann Pinschers Slickar kudden (startar vid ~4.8 månader) Slickar flanken (startar vid ~8.5 månader) Sår och ärr av allt slickande Människor med liknande sjukdom tvättar händerna allt för ofta

30 Jämför 92 sjuka och 68 friska Doberman p raw = 8x10-7 p genome = ,500 SNP with MAF > 0.05

31 Zoomar in (fin-mappar) på kromosom 7 Bara en gen:

32 Hur fungerar CDH2? Neuronal cadherin Binder ihop celler Under embryo utvecklingen: ger höger vänster symmetri I hjärnan: binder ihop celler vid synapserna så att de kan interagera Ger plasticitet (inlärning och minne)

33 Vad går fel i tvångsyndrom? 33

34 Leta fler mutationer i flera raser Resekvensera alla top regioner i arvsmassan Sjuka & friska i varje ras

35 Mutationer finns i vissa regioner av gener

36 Många genes påverkar synaptisk plasticitet Hur synapsen sitter ihop cadherin Hur synapser förändras dynamiskt Hur glutamat frisläpps

37 När vi hittat gener: dags att omsätta i praktiken! + Diagnostik Behandlingar Människan 37 Personalized medicine

Hundar hjälper oss att förstå människans sjukdomar. Kerstin Lindblad-Toh

Hundar hjälper oss att förstå människans sjukdomar. Kerstin Lindblad-Toh Hundar hjälper oss att förstå människans sjukdomar Kerstin Lindblad-Toh Målsättning med min forskning Att hitta människors sjukdomsgener via: - djurmodeller - en bättre förståelse av arvsmassan - storskalig

Läs mer

Genetik vid polyneuropatier. Christina Jern

Genetik vid polyneuropatier. Christina Jern Genetik vid polyneuropatier Christina Jern Information lagras i DNA 2 m DNA i varje cell Bara 3 cm kodar för protein Det humana genomet februari 2001 The International Human Genome Mapping Consortium

Läs mer

Studier av ärftlig bakgrund till livmoderinflammation hos hundar

Studier av ärftlig bakgrund till livmoderinflammation hos hundar Delrapport år 2 av 3, till Svenska Kennelklubbens och Försäkringsbolaget Agrias Forskningsfond, september 2012, samt ansökan om utökat anslag för år 3. Studier av ärftlig bakgrund till livmoderinflammation

Läs mer

Genetisk testning av medicinska skäl

Genetisk testning av medicinska skäl Genetisk testning av medicinska skäl NÄR KAN DET VARA AKTUELLT MED GENETISK TESTNING? PROFESSIONELL GENETISK RÅDGIVNING VAD LETAR MAN EFTER VID GENETISK TESTNING? DITT BESLUT Genetisk testning av medicinska

Läs mer

Metoder för att identifiera genetisk sjukdomar

Metoder för att identifiera genetisk sjukdomar Hunden människans sjukaste vän Olof Vadell Populärvetenskaplig sammanfattning av Självständigt arbete i biologi 2012 Institutionen för biologisk grundutbildning, Uppsala universitet Hunden har varit en

Läs mer

Bestämning av antalet aktiva CYP2D6 genkopior (CNV) med Pyrosequencing. Anna-Lena Zackrisson PhD. anna-lena.zackrisson@rmv.se

Bestämning av antalet aktiva CYP2D6 genkopior (CNV) med Pyrosequencing. Anna-Lena Zackrisson PhD. anna-lena.zackrisson@rmv.se Bestämning av antalet aktiva CYP2D6 genkopior (CNV) med Pyrosequencing Anna-Lena Zackrisson PhD INTRODUKTION LINKÖPINGSENHETEN RÄTTSMEDICIN RÄTTSKEMI RÄTTSGENETIK INTRODUKTION Sammanställa genetisk information

Läs mer

Vi är tacksamma för att ni ställer upp och svarar på hälsoenkäten för schnauzer.

Vi är tacksamma för att ni ställer upp och svarar på hälsoenkäten för schnauzer. Vi är tacksamma för att ni ställer upp och svarar på hälsoenkäten för schnauzer. Enkäten är en del av RAS, vilken ska uppgraderas i år. Vilket vi hoppas leder fram till hur vår fantastiska ras utvecklats

Läs mer

GENETISKA UTREDNINGAR OCH METODER MULTIFAKTORIELLT ARV

GENETISKA UTREDNINGAR OCH METODER MULTIFAKTORIELLT ARV GENETISKA UTREDNINGAR OCH METODER MULTIFAKTORIELLT ARV VARFÖR GENETISKA ANALYSER? Bekräfta/fastställa klinisk diagnos Genotyp-fenotyp; prognos Anlagsbärardiagnostik Reproduktionsalternativ/ Fosterdiagnostik/PGD

Läs mer

Erik Eriksson VMD Enheten för Bakteriologi

Erik Eriksson VMD Enheten för Bakteriologi Diagnostik VTEC/EHEC Erik Eriksson VMD Enheten för Bakteriologi SVA Tänker prata om VTEC / EHEC Sjukdomsframkallande faktorer PCR Magnetiska kulor (Immunomagnetisk separation) Diagnostik de vanligaste

Läs mer

Genetik en sammanfattning

Genetik en sammanfattning Genetik en sammanfattning Pär Leijonhufvud $\ BY: 3 februari 2015 C Innehåll Inledning 2 Klassisk genentik 2 Gregor Mendel munken som upptäckte ärftlighetens lagar....... 2 Korsningsrutor, ett sätt att

Läs mer

Demenssjukdomar och ärftlighet

Demenssjukdomar och ärftlighet Demenssjukdomar och ärftlighet SveDem Årsmöte 141006 Caroline Graff Professor, Överläkare caroline.graff@ki.se Forskningsledare vid Karolinska Institutet Centrum för Alzheimerforskning, Huddinge Chef för

Läs mer

Genomic Era. Vad är autism? Tvillingstudier. Genetiska Riskfaktorer för neuropsykiatriska funktionshinder

Genomic Era. Vad är autism? Tvillingstudier. Genetiska Riskfaktorer för neuropsykiatriska funktionshinder Genomic Era Genetiska Riskfaktorer för neuropsykiatriska funktionshinder MaiBritt Giacobini PRIMA Järva 50tal Watson Crick double helix 2003 Humana genomet 3 miljarder baspar kartlagt Stor implikation

Läs mer

Arytmogen högerkammarkardiomyopati

Arytmogen högerkammarkardiomyopati Centrum för kardiovaskulär genetik Norrlands universitetssjukhus Information till patienter och anhöriga Arytmogen högerkammarkardiomyopati Den här informationen riktar sig till dig som har sjukdomen arytmogen

Läs mer

ESSENCE-dag 2. Läkarens arbete. /Elisabeth Fernell. Utvecklingsneurologiska enheten, Barnkliniken, Skaraborgs sjukhus, Mariestad

ESSENCE-dag 2. Läkarens arbete. /Elisabeth Fernell. Utvecklingsneurologiska enheten, Barnkliniken, Skaraborgs sjukhus, Mariestad ESSENCE-dag 2 Läkarens arbete /Elisabeth Fernell Utvecklingsneurologiska enheten, Barnkliniken, Skaraborgs sjukhus, Mariestad Gillbergcentrum, Göteborgs universitet Innehåll Läkarens del i: Funktionsutredning

Läs mer

Totalt finns det alltså 20 individer i denna population. Hälften, dvs 50%, av dem är svarta.

Totalt finns det alltså 20 individer i denna population. Hälften, dvs 50%, av dem är svarta. EVOLUTION Tänk dig att det på en liten ö i skärgården finns 10 st honor av den trevliga insekten långvingad muslus. Fem av dessa är gula med svarta fläckar och fem är helsvarta. Det är samma art, bara

Läs mer

Sara Ekvall, doktorand Inst. för immunologi, genetik & patologi Uppsala universitet Handledare: Marie-Louise Bondeson & Göran Annerén

Sara Ekvall, doktorand Inst. för immunologi, genetik & patologi Uppsala universitet Handledare: Marie-Louise Bondeson & Göran Annerén Sara Ekvall, doktorand Inst. för immunologi, genetik & patologi Uppsala universitet Handledare: Marie-Louise Bondeson & Göran Annerén Celler & DNA Vår kropp är uppbyggd av ~100 000 miljarder celler I cellen

Läs mer

Människans genom Databaser ger kunskap om genetiska sjukdomar

Människans genom Databaser ger kunskap om genetiska sjukdomar Nationellt resurscentrum för biologi och bioteknik Övning i bioinformatik Människans genom Databaser ger kunskap om genetiska sjukdomar Många molekylärbiologiska databaser och program är fritt tillgängliga

Läs mer

Evolution i molekylärbiologiskt perspektiv

Evolution i molekylärbiologiskt perspektiv Nutidens upptäcktsfärder går till organismernas minsta beståndsdelar. Evolution i molekylärbiologiskt perspektiv En viktig milstolpe i vetenskapens historia är sekvenseringen av det mänskliga genomet.

Läs mer

GENETIK - Läran om arvet

GENETIK - Läran om arvet GENETIK - Läran om arvet Kroppens minsta levande enheter är cellerna I cellkärnorna finns vår arvsmassa - DNA (DNA - Deoxiribonukleinsyra) Proteiner Transportproteiner Strukturproteiner Enzymer Reglerande

Läs mer

Cystnjursjukdomar och genetik. Carina Frykholm Klinisk genetik Akademiska sjukhuset, Uppsala

Cystnjursjukdomar och genetik. Carina Frykholm Klinisk genetik Akademiska sjukhuset, Uppsala Cystnjursjukdomar och genetik Carina Frykholm Klinisk genetik Akademiska sjukhuset, Uppsala Njurcystor i frisk population Ålder En cysta Bilaterala 30-49 år 1.7 % 1 % 50-70 år 11.5 % 4 % >70 år 22.1 %

Läs mer

Hur kommer teknologiska landvinningar påverka sjukvården?

Hur kommer teknologiska landvinningar påverka sjukvården? Hur kommer teknologiska landvinningar påverka sjukvården? Per Hall, professor Institutionen för medicinsk epidemiologi och biostatistik Karolinska Institutet Stockholm Hemoglobin Normalvärde för kvinnor

Läs mer

Hur blev boxern så bra och vad kan vi lära av historien? Skribent: Anna Persson

Hur blev boxern så bra och vad kan vi lära av historien? Skribent: Anna Persson Hur blev boxern så bra och vad kan vi lära av historien? Skribent: Anna Persson Lennart Swenson är forskare med specialisering på hundars reproduktion, funktion och hälsa på institutionen för husdjursgenetik

Läs mer

Mikroorganismer och cancer

Mikroorganismer och cancer Mikroorganismer och cancer Vilken betydelse har bakterier, svampar, parasiter för cancerutveckling? 1 Mikroorganismers betydelse för cancerutveckling Svårt ämne a: studera Lång latensad, flera steg Exogena

Läs mer

Arv + miljö = diabetes?

Arv + miljö = diabetes? Arv + miljö = diabetes? Kristina Lejon universitetslektor, immunologi, Institutionen för klinisk mikrobiologi Vad är det som gör att vi får diabetes? Anna Möllsten var nyss inne på den frågan och visade

Läs mer

HT 2011. En farmakologs syn på. Biologisk variation. Orsaker & konsekvenser Läkemedelsanvändning. I Nylander. Medicin & Farmaci

HT 2011. En farmakologs syn på. Biologisk variation. Orsaker & konsekvenser Läkemedelsanvändning. I Nylander. Medicin & Farmaci HT 2011 En farmakologs syn på Biologisk variation Orsaker & konsekvenser Läkemedelsanvändning I Nylander Medicin & Farmaci Individrelaterade faktorer Vad händer i veckan? Introduktion Miljöns inverkan

Läs mer

HUGO-projektet. Kartläggningen av det mänskliga genomet

HUGO-projektet. Kartläggningen av det mänskliga genomet Vem är HUGO? HUGO-projektet Kartläggningen av det mänskliga genomet Kartläggning av genom Genom= allt DNA hos en organism. Kartläggningen sker genom att man bestämmer DNA-sekvensen för hela genomet och

Läs mer

Tentamen. Medicin, avancerad nivå, Farmakologi och sjukdomslära, del 1. Kurskod: MC2014. Prov: Allmän farmakologi. Kursansvarig: Maria Fernström

Tentamen. Medicin, avancerad nivå, Farmakologi och sjukdomslära, del 1. Kurskod: MC2014. Prov: Allmän farmakologi. Kursansvarig: Maria Fernström Tentamen Medicin, avancerad nivå, Farmakologi och sjukdomslära, del 1 Kurskod: MC2014 Prov: Allmän farmakologi Kursansvarig: Maria Fernström Datum: 121204 Totalpoäng: 65p Poängfördelning: Skrivtid: 4 tim

Läs mer

Tjänsteskrivelse. Kompetenscentrum "Djur som resurs"

Tjänsteskrivelse. Kompetenscentrum Djur som resurs Malmö stad Stadsområdesförvaltning Norr 1 (3) Datum 2014-11-27 Vår referens Ann Rubin Planeringssekreterare ann.rubin@malmo.se Tjänsteskrivelse Kompetenscentrum "Djur som resurs" SOFN-2014-524 Sammanfattning

Läs mer

Genetik II. Jessica Abbott

Genetik II. Jessica Abbott Genetik II Jessica Abbott Nukleosid Sockergrupp + kvävebas Kvävebaser: Puriner (adenin, guanin) Pyrimidiner (cytosin, thymin i DNA, uracil i RNA) Basparning A=T G C Packning av DNA i eukaryot cellkärna

Läs mer

En bioinformatisk genjakt

En bioinformatisk genjakt En bioinformatisk genjakt Efter en ide från: CUSMOBIO, Milano, Italien. Hur man kan söka i databaser efter information om en gen som kan ge ökad risk för bröstcacer. Bakgrund Människor utan symptom men

Läs mer

Ärftliga sjukdomar och egenskaper hos hund

Ärftliga sjukdomar och egenskaper hos hund Engelsk bulldog Tibetansk terrier Västgötaspets Dvärgpinscher Chow chow Foto: Pleple2000 Foto: Flickr user skaty222 Foto: Sören T Eriksson Foto: Entheta Foto:Jurriaan Schulman Alla bilder Wikimedia commons

Läs mer

UVIS. Ett nationellt center för avbildning med tyngdpunkt inom translationell medicin. Jan Grawé. Uppsala Universitet

UVIS. Ett nationellt center för avbildning med tyngdpunkt inom translationell medicin. Jan Grawé. Uppsala Universitet UVIS Ett nationellt center för avbildning med tyngdpunkt inom translationell medicin Jan Grawé Rudbecklaboratoriet b t Uppsala Universitet Science For Life Laboratory (SciLifeLab) En satsning på storskalig

Läs mer

Område: Ekologi. Innehåll: Examinationsform: Livets mångfald (sid. 14-31) I atomernas värld (sid.32-45) Ekologi (sid. 46-77)

Område: Ekologi. Innehåll: Examinationsform: Livets mångfald (sid. 14-31) I atomernas värld (sid.32-45) Ekologi (sid. 46-77) Område: Ekologi Innehåll: Livets mångfald (sid. 14-31) I atomernas värld (sid.32-45) Ekologi (sid. 46-77) Undervisningen i kursen ska behandla följande centrala innehåll: Frågor om hållbar utveckling:

Läs mer

Bilaga 1: SBTKs arbete 1990 fram till nu Senast uppdaterad: 2010-07-22

Bilaga 1: SBTKs arbete 1990 fram till nu Senast uppdaterad: 2010-07-22 SBTK:s arbete Svenska Bostonterrierklubben har arbetat aktivt med avelsfrågor sedan 1970-talet. Dock dröjde det till 1994/1995 innan någon nedskriven viljeyttring fanns att tillgå för uppfödarna. Arbetet

Läs mer

Fragil X. Genetik, diagnostik och symptom. A marker X chromosome Am J Hum Genet. 1969 May;21(3):231-44. Fragilt X - Historik. Förekomst av fragilt X

Fragil X. Genetik, diagnostik och symptom. A marker X chromosome Am J Hum Genet. 1969 May;21(3):231-44. Fragilt X - Historik. Förekomst av fragilt X Förekomst av fragilt Fragil Genetik, diagnostik och symptom MaiBritt Giacobini Helena Malmgren Karolinska Universitetssjukhuset 1/ 4-5000 pojkar 1 /6-8000 flickor Ungefär 500 personer har diagnosen i Sverige

Läs mer

genvägar arv facit.notebook December 02, 2009 Genvägar arv mar 11 10:20

genvägar arv facit.notebook December 02, 2009 Genvägar arv mar 11 10:20 Genvägar arv mar 11 10:20 1 Hur kommer det sig att elefantungar liknar elefanter och ringblommor liknar ringblommor? Kromosomerna innehåller arvsanlagen som också kallas gener. Varje genfinns i två exemplar.

Läs mer

MERLE. fascinerande, förbryllande och förskräckande

MERLE. fascinerande, förbryllande och förskräckande MERLE fascinerande, förbryllande och förskräckande Det finns en pälsfärg hos hundar som aldrig undgår att väcka uppmärksamhet. Den liknar ingenting annat. Det handlar om det som hos flera vallhundsraser

Läs mer

Genetik, Gen-etik och Genteknik

Genetik, Gen-etik och Genteknik Genetik, Gen-etik och Genteknik Syfte och innehåll Att utveckla kunskap om det genetiska arvet och genteknikens möjligheter. Arbetssätt Vi kommer att varva föreläsningar, diskussioner, arbetsuppgifter

Läs mer

Rasspecifik Avelsstrategi. Berner Sennenhund. Utarbetad av Svenska Sennenhundklubbens Avelsråd i samarbete med uppfödare, täckhundsägare och hundägare

Rasspecifik Avelsstrategi. Berner Sennenhund. Utarbetad av Svenska Sennenhundklubbens Avelsråd i samarbete med uppfödare, täckhundsägare och hundägare Rasspecifik Avelsstrategi Berner Sennenhund Utarbetad av Svenska Sennenhundklubbens Avelsråd i samarbete med uppfödare, täckhundsägare och hundägare Utvärdering av RAS 2010 Svenska Sennenhundklubben 2011-05-21

Läs mer

Genetisk variation är livsviktig för vitaliteten och ganska snabbt även en förutsättning för överlevnaden hos en art.

Genetisk variation är livsviktig för vitaliteten och ganska snabbt även en förutsättning för överlevnaden hos en art. Naturens behov av genetisk variation Genetisk variation är livsviktig för vitaliteten och ganska snabbt även en förutsättning för överlevnaden hos en art. Då vi benämner en art i naturen som utrotningshotad

Läs mer

Farmakogenetik/genomik

Farmakogenetik/genomik Farmakogenetik/genomik HT-2013 Lars Westberg Institutionen för neurovetenskap och fysiologi Sektionen för farmakologi Göteborgs universitet lars.westberg@pharm.gu.se Översikt Introduktion Definitioner

Läs mer

GENKOMB - en metod att hitta målprotein för läkemedel.

GENKOMB - en metod att hitta målprotein för läkemedel. ENKOMB - en metod att hitta målprotein för läkemedel. Erik urell dam meur Jakub Westholm i samarbete med strazeneca Disposition Biologisk bakgrund: cellen och arvsmassan proteinsyntes genuttryck och genuttrycksdata

Läs mer

Denna pdf-fil är nedladdad från Illustrerad Vetenskaps webbplats (www.illvet.com) och får ej lämnas vidare till tredjepart.

Denna pdf-fil är nedladdad från Illustrerad Vetenskaps webbplats (www.illvet.com) och får ej lämnas vidare till tredjepart. Käre användare! Denna pdf-fil är nedladdad från Illustrerad Vetenskaps webbplats (www.illvet.com) och får ej lämnas vidare till tredjepart. Av hänsyn till copyright innehåller den inga foton. Med vänlig

Läs mer

Information och samtyckesformulär inför genomisk utredning av ovanliga sjukdomar och syndrom med metoderna genomisk array och exomanalys

Information och samtyckesformulär inför genomisk utredning av ovanliga sjukdomar och syndrom med metoderna genomisk array och exomanalys Information och samtyckesformulär inför genomisk utredning av ovanliga sjukdomar och syndrom med metoderna genomisk array och exomanalys Detta informationsblad och samtyckesformulär är riktat till dig

Läs mer

Den engelska artikeln tillsammans med en lista på litteraturhänvisningar finns RSV2000 engelska hemsida.

Den engelska artikeln tillsammans med en lista på litteraturhänvisningar finns RSV2000 engelska hemsida. Keijo Kodis från Finland har skickat en vetenskaplig artikel och ytterligare förklaringar från författarna som vi är väldigt tacksamma för att få sprida. Originaltexten är på Engelska och det är därför

Läs mer

Familjär hyperkolesterolemi -från 0 till 80 på 10 år

Familjär hyperkolesterolemi -från 0 till 80 på 10 år Familjär hyperkolesterolemi -från 0 till 80 på 10 år Jönköping, 19 mars 2015 Lennart Nilsson överläkare, docent, universitetslektor Kardiogenetiska regionmottagningen lennart.nilsson@liu.se Universitetssjukhuset,

Läs mer

Information till dig som får behandling med JEVTANA (cabazitaxel)

Information till dig som får behandling med JEVTANA (cabazitaxel) Information till dig som får behandling med JEVTANA (cabazitaxel) Om JEVTANA JEVTANA är ett läkemedel som används för behandling av prostatacancer som har fortskridit efter att du har behandlats med annan

Läs mer

Lycka till! Tentamen. Kursens namn: Medicin C, Tumörbiologi Kursens kod: MC1728 Kursansvarig: Anna Göthlin Eremo

Lycka till! Tentamen. Kursens namn: Medicin C, Tumörbiologi Kursens kod: MC1728 Kursansvarig: Anna Göthlin Eremo Tentamen Kursens namn: Medicin C, Tumörbiologi Kursens kod: MC1728 Kursansvarig: Anna Göthlin Eremo Datum: 2012-06-01 Skrivtid: 4 timmar 08:15-12:15 (P245) Poängfördelning: Karin Franzén Pia Wegman Sabina

Läs mer

Fysisk aktivitet på Recept som behandlingsmetod inom hälso- och sjukvården

Fysisk aktivitet på Recept som behandlingsmetod inom hälso- och sjukvården Fysisk aktivitet på Recept som behandlingsmetod inom hälso- och sjukvården Stefan Lundqvist Leg sjukgymnast Varför r skall vi arbeta med fysisk aktivitet/ FaR och andra levnadsvanor? Medicinska, hälsoskäl

Läs mer

Kontakta din läkare. sanofi-aventis Box 14142, 167 14 BROMMA. Tel 08-634 50 00, infoavd@sanofi-aventis.com, www.sanofi-aventis.se

Kontakta din läkare. sanofi-aventis Box 14142, 167 14 BROMMA. Tel 08-634 50 00, infoavd@sanofi-aventis.com, www.sanofi-aventis.se Kontakta din läkare Kontakta genast din läkare om du drabbas av något av nedanstående symtom medan du behandlas med JEVTANA. feber, dvs en kroppstemperatur på 38 C eller högre diarré (t.ex. om du har lös

Läs mer

Information för patienter och föräldrar

Information för patienter och föräldrar 12 Västra Götalandsregionen: Klinisk Genetik Sahlgrenska Universitetssjukhuset/Sahlgrenska 413 45 Göteborg Tel: 031-343 44 14 / 031-343 42 06 (sekr); Fax: 031-84 21 60 Stockholmsregionen: Kliniskt genetiska

Läs mer

Rasspecifika avelsstrategier 2010-2015

Rasspecifika avelsstrategier 2010-2015 Rasspecifika avelsstrategier 2010-2015 Inriktning Rasklubbens långsiktiga mål är att bibehålla wachtelhundrasens specifika karaktär och jaktliga egenskaper som mångsidig bruksjakthund med god mentalitet,

Läs mer

Beteendegenetik. Vårt genetiska kod. Koden överförs vid celldelning. Handlar om hur psykologiska förmågor och möjliga beteenden ärvs i DNA

Beteendegenetik. Vårt genetiska kod. Koden överförs vid celldelning. Handlar om hur psykologiska förmågor och möjliga beteenden ärvs i DNA Beteendegenetik Handlar om hur psykologiska förmågor och möjliga beteenden ärvs i DNA Handlar också om samspelet mellan arv och miljö Viktigt att skilja på Genotyp den specifika genetiska koden vi har

Läs mer

Åsa Grimberg. bioscience explained Vol 8 No 1. Växtförädlarens verktygslåda genom tiderna. Avdelningen för växtförädling P.O. Box 101, SE-23053 Alnarp

Åsa Grimberg. bioscience explained Vol 8 No 1. Växtförädlarens verktygslåda genom tiderna. Avdelningen för växtförädling P.O. Box 101, SE-23053 Alnarp Åsa Grimberg Avdelningen för växtförädling P.O. Box 101, SE-23053 Alnarp Växtförädlarens verktygslåda genom tiderna Selektionsförädling För över tiotusen år sedan började människorna bruka jorden och odla

Läs mer

Forskningens dag 7 8 november 2012 Hur mår provrörsbarnen?

Forskningens dag 7 8 november 2012 Hur mår provrörsbarnen? Forskningens dag 7 8 november 2012 Hur mår provrörsbarnen? Karin Källén Hur mår provrörsbarnen? Bakgrund: Hur mäter man hälsa genom att utnyttja register? Vad mäter man? Hur jämför man risker? Hur tolkar

Läs mer

Bo von Schèele, fil dr, professor Stress Medicine AB, www.stressmedicin.se Institutet för Psykofysiologisk Beteende Medicin, ipbm.

Bo von Schèele, fil dr, professor Stress Medicine AB, www.stressmedicin.se Institutet för Psykofysiologisk Beteende Medicin, ipbm. , 1996, 2015, Bo von Schèele, Stress Medicine AB (1/7-96 & 10/1-15) Patienten som en aktiv, utbildad, kompetent resurs i sin egen rehabilitering: En psykofysiologisk beteendemedicinsk manual som bygger

Läs mer

2011-09-15. I neutrofila celler så utgör calprotectin - 5 % av totala proteininnehållet - 60 % av proteininnehållet i cytoplasman

2011-09-15. I neutrofila celler så utgör calprotectin - 5 % av totala proteininnehållet - 60 % av proteininnehållet i cytoplasman Barnallergologi-sektionens höstmöte, Linköping 2011-09 09-15 Överläkare, Medicine doktor Barn och Ungdomsmedicinska kliniken/ Centrum för Klinisk Forskning Centrallasarettet, Västerås Karolinska Institutet,

Läs mer

Clicker 5. Lathund kring de vanligaste och mest grundläggande funktionerna för att komma igång med Clicker. Habilitering & Hjälpmedel

Clicker 5. Lathund kring de vanligaste och mest grundläggande funktionerna för att komma igång med Clicker. Habilitering & Hjälpmedel Clicker 5 Lathund kring de vanligaste och mest grundläggande funktionerna för att komma igång med Clicker. Habilitering & Hjälpmedel Vad är Clicker 5? Clicker 5 är ett stöd till personer i behov av extra

Läs mer

När du behöver frysa in dina ägg. Information om hur det går till att ta ut en bit av en äggstock och frysa in.

När du behöver frysa in dina ägg. Information om hur det går till att ta ut en bit av en äggstock och frysa in. När du behöver frysa in dina ägg Information om hur det går till att ta ut en bit av en äggstock och frysa in. Innehållsförteckning Varför ska jag frysa in mina ägg? Hur går det till? Hur tas en bit av

Läs mer

Cancer som en ämnesomsättningssjukdom del 1

Cancer som en ämnesomsättningssjukdom del 1 Cancer som en ämnesomsättningssjukdom del 1 Artiklarna skrivna av Dr Georgia Ede (översättning S E Nordin) Thomas Seyfried PhD, en hjärncancerforskare med över 25 års erfarenhet inom området, gav en banbrytande

Läs mer

Är du. hundallergiker. men älskar hundar? Unik nyhet!

Är du. hundallergiker. men älskar hundar? Unik nyhet! Är du hundallergiker men älskar hundar? Unik nyhet! Hunden lämnar avtryck... Hundar lämnar osynliga spår av allergen efter sig. De sprids via kläder till allmänna platser såsom kollektiv trafik, arbetsplatser

Läs mer

Sammanfattning Arv och Evolution

Sammanfattning Arv och Evolution Sammanfattning Arv och Evolution Genetik Ärftlighetslära Gen Information om ärftliga egenskaper. Från föräldrar till av komma. Tillverkar proteiner. DNA (deoxiribonukleinsyra) - DNA kan liknas ett recept

Läs mer

Specialklubben Rhodesian Ridgeback Sverige

Specialklubben Rhodesian Ridgeback Sverige 2 3 Svarsval Antal Procent Kvinna 244 82,99 % Man 50 17,01 % Totalt 294 100,00 % 4 5 Svarsval Antal Procent -29 år 24 8,16 % 30-39 år 77 26,19 % 40-49 år 99 33,67 % 50-59 år 67 22,79 % 60-69 år 19 6,46

Läs mer

NUKLEINSYRORNAS UPPBYGGNAD: Två olika nukleinsyror: DNA deoxyribonukleinsyra RNA ribonukleinsyra

NUKLEINSYRORNAS UPPBYGGNAD: Två olika nukleinsyror: DNA deoxyribonukleinsyra RNA ribonukleinsyra NUKLEINSYRORNAS UPPBYGGNAD: Två olika nukleinsyror: DNA deoxyribonukleinsyra RNA ribonukleinsyra Monomererna som bygger upp nukleinsyrorna kallas NUKLEOTIDER. En nukleotid består av tre delar: en kvävebas

Läs mer

Diabetes i media. -tips till dig som skriver om diabetes

Diabetes i media. -tips till dig som skriver om diabetes Diabetes i media -tips till dig som skriver om diabetes Förord 03 5 tips till dig som rapporterar om diabetes 04 Diabetes ett samhällsproblem 06 Diabetes i siffror 07 Vad är diabetes 09 Två typer av diabetes

Läs mer

Farmakogenetik/genomi k. Översikt. Farmakogenetik / farmakogenomik. Introduktion. Farmakogenetik: Vad testar man? Klinisk praxis idag?

Farmakogenetik/genomi k. Översikt. Farmakogenetik / farmakogenomik. Introduktion. Farmakogenetik: Vad testar man? Klinisk praxis idag? Farmakogenetik/genomi k HT-2009 Jonas Melke Institutionen för neurovetenskap och fysiologi Sektionen för farmakologi Göteborgs universitet jonas.melke@pharm.gu.se Översikt Introduktion Definitioner Genetisk

Läs mer

Fakta om spridd bröstcancer

Fakta om spridd bröstcancer Fakta om spridd bröstcancer Världens vanligaste kvinnocancer Bröstcancer står för närmare 23 procent av alla cancerfall hos kvinnor och är därmed världens vanligaste cancerform bland kvinnor i såväl rika

Läs mer

Klassen måste ha gått igenom:

Klassen måste ha gått igenom: 1 Gruppdiskussion/Värderingsrollspel Genteknik och människan Eleverna är ledamöter i en kommitté som ska ta ställning till ett antal konkreta förslag om gentester och genteknik på människa. Kan utföras

Läs mer

Information om SKK:s index för HD och ED

Information om SKK:s index för HD och ED Information om SKK:s index för HD och ED Text: Sofia Malm Höft- och armbågsledsdysplasi (HD och ED) är vanligt förekommande i många, framförallt storvuxna, hundraser. Trots mångåriga hälsoprogram orsakar

Läs mer

Tidig upptäckt. Marcela Ewing. Spec. allmänmedicin/onkologi Regional processägare Tidig upptäckt Regionalt cancercentrum väst

Tidig upptäckt. Marcela Ewing. Spec. allmänmedicin/onkologi Regional processägare Tidig upptäckt Regionalt cancercentrum väst Tidig upptäckt Marcela Ewing Spec. allmänmedicin/onkologi Regional processägare Tidig upptäckt Regionalt cancercentrum väst Disposition av föreläsning Bakgrund Alarmsymtom och allmänna symtom Svårigheten

Läs mer

Screening, genetik, fosterdiagnostik och etik

Screening, genetik, fosterdiagnostik och etik Screening, genetik, fosterdiagnostik och etik Kunskapsbakgrund särskilt utredningsuppdrag 2013 www.lio.se Henning Elvtegen, Ledningsstaben Innehållsförteckning Inledning 3 1. Bakgrund 4 1.1 Uppdrag och

Läs mer

Bröstcancer. Litteraturlista från Sjukhusbiblioteket i Västmanland. Sjukhusbiblioteket Västerås

Bröstcancer. Litteraturlista från Sjukhusbiblioteket i Västmanland. Sjukhusbiblioteket Västerås Bröstcancer Litteraturlista från Sjukhusbiblioteket i Västmanland Sjukhusbiblioteket Västerås FACKLITTERATUR Bröstcancer / Jonas Bergh. 2007, 128 s. En bok om vad som väntar en kvinna med diagnosen bröstcancer,

Läs mer

Celiaki eller glutenintolerans

Celiaki eller glutenintolerans Celiaki eller glutenintolerans Bland de vanligaste kroniska barnsjukdomarna, upp mot 1% En autoimmun sjukdom Kombination av arv och miljö krävs Kan man skydda sig? Celiaki kort bakgrund Immunsystemet reagerar

Läs mer

Plocka ihop Lägg i påsen Lämna in till ett apotek

Plocka ihop Lägg i påsen Lämna in till ett apotek Plocka ihop Lägg i påsen Lämna in till ett apotek Sådär, då har farfar rensat bland medicinerna. Och vart ska det här då? Apo tek såklart! Alla gamla eller överblivna läkemedel som lämnas in till apoteken

Läs mer

Åsa Konradsson-Geuken Karolinska Institutet & Uppsala Universitet

Åsa Konradsson-Geuken Karolinska Institutet & Uppsala Universitet Åsa Konradsson-Geuken Karolinska Institutet & Uppsala Universitet Människa i fokus Vätterbygdens folkhögskola Jönköping April 2016 oo Omgiven av mig as Mats Konradsson Mina upplevelser Allmänt om hjärnan

Läs mer

D-vitaminbrist hos äldre på särskilt boende. Maria Samefors 2012-09-13

D-vitaminbrist hos äldre på särskilt boende. Maria Samefors 2012-09-13 D-vitaminbrist hos äldre på särskilt boende Maria Samefors 2012-09-13 D-vitamin Ett fettlösligt vitamin med hormonella egenskaper. 2 källor till D-vitamin: kost och solljus, varav solljus svarar för 90%

Läs mer

Lindrig utvecklingsstörning - aspekter ur ett samverkansperspektiv

Lindrig utvecklingsstörning - aspekter ur ett samverkansperspektiv Lindrig utvecklingsstörning - aspekter ur ett samverkansperspektiv 2012-12-03 Elisabeth Fernell Utvecklingsneurologiska enheten, Skaraborgs sjukhus, Mariestad och Gillbergcentrum, GU, Göteborg BIF Lindr.utv.

Läs mer

Facit tds kapitel 18

Facit tds kapitel 18 Facit tds kapitel 18 Testa dig själv 18.1 1. Arvsanlagen finns i cellkärnan. Inför celldelningen samlas de i kromosomer. 2. Det kemiska ämne som bär på arvet kallas DNA. 3. Instruktionerna i DNA är ritningar,

Läs mer

WestieAlliansens hälsoenkät 2008

WestieAlliansens hälsoenkät 2008 WestieAlliansens hälsoenkät 2008 Syfte: Vi skall få en god bild av hur rasen mår. Enkätsvaren ska ge en indikation på om det finns något som är onormalt högt representerat inom rasen och därmed ge vägledning

Läs mer

RAS Rasspecifik avelsstrategi för pudel

RAS Rasspecifik avelsstrategi för pudel RAS Rasspecifik avelsstrategi för pudel Innehållsförteckning Inledning... 3 Historik... 3 Nuläget... 4 Exteriör... 6 SRD... 6 Mål:... 7 Strategi:... 7 SAR = Silver(grå), Aprikos, Röd... 7 Mål:... 7 Strategi:...

Läs mer

Hur påverkar strålning celler och organismer?

Hur påverkar strålning celler och organismer? Hur påverkar strålning celler och organismer? Bo Stenerlöw Inst. f. immunologi, genetik och patologi Rudbecklaboratoriet Uppsala universitet bo.stenerlow@igp.uu.se Joniserande strålning Dos: Gray (Gy =

Läs mer

Stamceller För att få mer kött på benen

Stamceller För att få mer kött på benen Stamceller För att få mer kött på benen Av Nicole Loginger Populärvetenskaplig sammanfattning av självständigt arbete i biologi 2013, Institutionen för biologisk grundutbildning, Uppsala. Hunger, miljöproblem

Läs mer

Centrum för kardiovaskulär genetik med familjen i fokus

Centrum för kardiovaskulär genetik med familjen i fokus Centrum för kardiovaskulär genetik Norrlands universitetssjukhus Information till patienter och anhöriga Centrum för kardiovaskulär genetik med familjen i fokus Centrum för kardiovaskulär genetik (CKG)

Läs mer

Avelsstrategi för Australisk terrier

Avelsstrategi för Australisk terrier Avelsstrategi för Australisk terrier Ursprung Den Australiska terrierns historia antas börja under kolonisationen på 1800-talet då emigranter från England och Skottland kom till Australien. Det var inte

Läs mer

Kod: Personnummer: Plats nr: Inlämnad kl: ID kollad: Poäng: Betyg: SKRIV DIN KOD PÅ ALLA SIDOR ÄVEN OM FRÅGAN LÄMNAS OBESVARAD.

Kod: Personnummer: Plats nr: Inlämnad kl: ID kollad: Poäng: Betyg: SKRIV DIN KOD PÅ ALLA SIDOR ÄVEN OM FRÅGAN LÄMNAS OBESVARAD. STOCKHOLMS UNIVERSITET Institutionen för biologisk grundutbildning Cell och molekylärbiologi 2015-02-02 Omtentamen CMB-II (11 hp) Kod: Personnummer: Plats nr: Inlämnad kl: ID kollad: Poäng: Betyg: Skrivtiden

Läs mer

Är genetiken på väg att bota diabetes?

Är genetiken på väg att bota diabetes? Är genetiken på väg att bota diabetes? Simon Eklöv Populärvetenskaplig sammanfattning av Självständigt arbete i biologi 2013 Institutionen för biologisk grundutbildning, Uppsala universitet. Under början

Läs mer

52 onkologi i sverige nr 5 13

52 onkologi i sverige nr 5 13 52 onkologi i sverige nr 5 13 Genreglerande DNA-element EN OUTFORSKAD ORSAK TILL CANCER Utvecklingen av cancer är starkt kopplad till uppkomsten av genetiska förändringar. Dessa förändringar omfattar allt

Läs mer

RAS-DOKUMENTATION FÖR PAPILLON i SVERIGE

RAS-DOKUMENTATION FÖR PAPILLON i SVERIGE RAS-DOKUMENTATION FÖR PAPILLON i SVERIGE papillion-001 2005-02-12 Sidan 1 av 13 Innehållsförteckning Förord Papillon Ringens arbete tom 2003 Historik Statistik Avelspolicy Avelsstrategi Avelsplaner Tidsplan

Läs mer

Boule Diagnostics AB Bolagspresentation 5 mars 2014. Ernst Westman, CEO

Boule Diagnostics AB Bolagspresentation 5 mars 2014. Ernst Westman, CEO Boule Diagnostics AB Bolagspresentation 5 mars 2014 Ernst Westman, CEO 2014-03-05 BOULE DIAGNOSTICS BOLAGSPRESENTATION (1) Copyright 2014 by Boule Diagnostics AB Blodcellräkning Blodcellräkning det vanligaste

Läs mer

Framtida tekniker MLPA (Multiplex Ligation Probe Amplification) med tillämpning inom Talassemi. Dick Nelson Klinisk kemi, Labmedicin Skåne

Framtida tekniker MLPA (Multiplex Ligation Probe Amplification) med tillämpning inom Talassemi. Dick Nelson Klinisk kemi, Labmedicin Skåne Framtida tekniker MLPA (Multiplex Ligation Probe Amplification) med tillämpning inom Talassemi. Dick Nelson Klinisk kemi, Labmedicin Skåne α-talassemi 4 genotyper Wild type αα / αα - - α + -talassemi α

Läs mer

Forskning för människors hälsa med hjälp av djurförsök

Forskning för människors hälsa med hjälp av djurförsök 1 Forskning för människors hälsa med hjälp av djurförsök Ett hett politiskt område där många skrönor florerar och okunskapen är stor. Så sammanfattade Karin Sandström, Handikappförbundens samarbetsorgan,

Läs mer

TVÅNGSSYNDROM. Fråga Diagnoskriterium Föreligger nu Tidigare (endast) (1), (2), (3) och (4).

TVÅNGSSYNDROM. Fråga Diagnoskriterium Föreligger nu Tidigare (endast) (1), (2), (3) och (4). TVÅNGSSYNDROM Tvångstankar Nu skulle jag vila fråga om det har hänt att du att du plågats av underliga eller menlösa tankar som återkom gång på gång fast du försökte låta bli att tänka på det sättet? Fortsätt

Läs mer

Fosfodiesterashämmare: nya läkemedel når kliniska prövningar inom kort Fosfo-di-vadå? fosfodiesterashämmare

Fosfodiesterashämmare: nya läkemedel når kliniska prövningar inom kort Fosfo-di-vadå? fosfodiesterashämmare Huntingtons sjukdom forsknings nyheter. I klartext Skriven av forskare För de globala HS medlemmarna. Fosfodiesterashämmare: nya läkemedel når kliniska prövningar inom kort CHDI och Pfizer presenterar

Läs mer

2016-05-31. YTTRANDE ANGÅENDE SKB:s ANSÖKAN OM SLUTFÖRVAR FÖR ANVÄNT KÄRNBRÄNSLE.

2016-05-31. YTTRANDE ANGÅENDE SKB:s ANSÖKAN OM SLUTFÖRVAR FÖR ANVÄNT KÄRNBRÄNSLE. Britta Kahanpää Ledamot Miljörörelsens Kärnavfallssekretariat Östra Ny Evelund Gård 610 30 Vikbolandet britta.kahanpaa@gmail.com Tel: 0768-993447 2016-05-31 NACKA TINGSRÄTT Avdelning 4 INKOM: 2016-06-01

Läs mer

Bioinformatik. Marina Axelson-Fisk Matematisk orientering, 30 nov 2015

Bioinformatik. Marina Axelson-Fisk Matematisk orientering, 30 nov 2015 Bioinformatik Marina Axelson-Fisk Matematisk orientering, 30 nov 2015 Bioinformatik Bioinformatik Var används bioinformatik? DNA analys Medicin DNA-sekvensering och assemblering Sekvensanalys Proteinstruktur

Läs mer

Celiaki eller glutenintolerans

Celiaki eller glutenintolerans Celiaki eller glutenintolerans Bland de vanligaste kroniska barnsjukdomarna, upp mot 1% En autoimmun sjukdom Kombination av arv och miljö krävs Kan man skydda sig? Celiaki kort bakgrund Immunsystemet reagerar

Läs mer

Vad händer i ett genetiskt laboratorium?

Vad händer i ett genetiskt laboratorium? 12 utveckla nya metoder eller låta sådana prover delta i kvalitetskontrollprogram, såvida inte patienten har uttryckt att man inte vill att ens prov ska vara del av sådan verksamhet. Som alla andra sparade

Läs mer

Komma igång med Widgit Online

Komma igång med Widgit Online Komma igång med Widgit Online Innehåll 1. Logga in 2. Hitta i Widgit Online 3. Skapa ett dokument 4. Skapa ett rutnät 5. Kontakta oss Hej! Den här guiden bör ge dig den information du behöver för att börja

Läs mer

Med hopp om framtiden transposoner, DNA som flyttar sig själv

Med hopp om framtiden transposoner, DNA som flyttar sig själv Med hopp om framtiden transposoner, DNA som flyttar sig själv Jessica Bergman Populärvetenskaplig sammanfattning av Självständigt arbete i biologi VT 2008 Institutionen för biologisk grundutbildning, Uppsala

Läs mer

Medicin B, Sjukdomslära med farmakologi, 15hp Tentamen del I, provkod 0101. (För studenter registrerade V15) Kurskod: MC1402.

Medicin B, Sjukdomslära med farmakologi, 15hp Tentamen del I, provkod 0101. (För studenter registrerade V15) Kurskod: MC1402. Medicin B, Sjukdomslära med farmakologi, 15hp Tentamen del I, provkod 0101. (För studenter registrerade V15) Kurskod: MC1402. Kursansvarig: Per Odencrants Datum: 2015 06 13 Skrivtid: 4 timmar Totalpoäng:

Läs mer