Genetik II. Jessica Abbott

Save this PDF as:
 WORD  PNG  TXT  JPG

Storlek: px
Starta visningen från sidan:

Download "Genetik II. Jessica Abbott"

Transkript

1 Genetik II Jessica Abbott

2 Nukleosid Sockergrupp + kvävebas Kvävebaser: Puriner (adenin, guanin) Pyrimidiner (cytosin, thymin i DNA, uracil i RNA)

3 Basparning A=T G C

4 Packning av DNA i eukaryot cellkärna Nukleosom Histoner Solenoid Domän Heterokromatin och eukromatin Kromosom, kromatid

5 Replikation Origin of replication Initieringsprotein Helikas Topoisomeras SSB Primas RNA-primer

6 Transkription 1. RNA-polymeras Promotor 2. Initiering 3. Elongering 4. Terminering

7 Translation

8 Cellcykeln INTERFAS G1 förberedelser inför S-fas S-fas DNA-syntes G2 förberedelser inför mitos G0

9 M-fas Mitos Profas Metafas Anafas Telofas Cytokines

10 Meios DNA replikation Meios I Delas homologerna från varandra Meios II Delas systerkromatiderna från varandra

11 Meios contra Mitos Föregås av DNA replikation 2n, 4c Meios Könsceller Kromosomer parvis Rekombination Resultat: 4 haploida celler Mitos Kromosomer självständigt Resultat: 2 diploida celler

12 Allel och lokus Allel = variant av samma gen Lokus = platsen på kromosomen där informationen för en viss gen lagras MHC, många varianter Örsnibb, två varianter

13 Heterozygositet och homozygositet Homozygot = två kopior av samma allel (Homo = lika) eller Heterozygot = två olika alleler (Hetero = olika)

14 Fenotyp Genotyp = den genetiska koden Fenotyp = den fysiska skepnaden Genotyp Utveckling och miljöpåverkan Fenotyp

15 Fenotyp Alltid ett resultat av gener i samspel med miljön! Samma genotyp Bra förhållanden Dåliga förhållanden

16 Mutationer Mutationsfrekvens Mutationsvarians Mutational bias mutationer oftare skadliga än fördelaktiga Evolution av mutationsfrekvens Fitness landscape

17 Selektion Fixering av fördelaktiga alleler Mutationselection balance

18 Genetisk drift Viktig: i små populationer för sällsynta alleler för neutrala alleler Flaskhalsar Flaskhals

19 Effekten av en mutation? En bit saknas Felaktig veckning Aktiviteten försämras

20 Punktmutation Mutationer

21 Mutationer Punktmutation: sickle cell anemi

22 Frameshift Mutationer

23 Mutationer Frameshift: Huntingtons sjukdom

24 Mutationer Invertering Duplicering

25 Mutationer Invertering: In(3R)Payne mel sub

26 Duplicering Mutationer

27 Rekombination Leder till snabbare evolution

28 Rekombination Utnyttjar den stående genetiska variansen

29 Dominans När heterozygoten har samma fenotyp som ena homozygot

30 Gröna ögon då? Dominans

31 Dominans Egentligen flera olika faktorer

32 Dominanta markörer Ögonfärg kan användas som en dominant markör hos bananflugor X

33 Dominanta markörer Ögonfärg kan användas som en dominant markör hos bananflugor

34 Egenskap Typer av genetisk variation 2 Dominant Ingen skillnad mellan heterozygot och dominant homozygot Additativ Heterozygot mittemellan Epistatisk Icke-linjär interaktion mellen flera loci aa Aa AA Genotyp

35 Hur många loci? Ju fler loci desto närmare normalfördelning Polygenisk egenskap = många gener

36 Polygeniska egenskaper

37 Pleiotropi När samma gen har effekter på flera olika egenskaper Gen 1 Egenskap 1 1 to 1 mapping Egenskap 2 Gen 2 Egenskap 3 Pleiotropi Egenskap 4

38 Kvantitativ genetik Beskriver karaktärer vars uttryck är kvantitativt snarare än kvalitativt Använder statisktiska metoder för att dra slutsatser om genetisk variation Kvalitativ variation Kvantitativ variation

39 Mendeliansk vs. kvantitativ genetik Mendeliansk genetik: Få loci och få alleler, oftast kända Kvalitativa egenskaper (blå eller röd, ja eller nej) Dominans Kvantitativ genetik: Många loci och alleler, oftast okända Kvantitativa egenskaper (storlek, längd) Additativ genetisk varians

40 Kvantitativ genetik Man kan dela upp den fenotypiska och genetiska variation i olika källor Fenotyp = gener + miljö V P = V G + V E Miljöbetingad varians V P = V A + V D + V I +V E Fenotypisk varians Additativ genetisk varians Dominans varians Epistatisk varians

41 Heritabilitet Mått på hur mycket av variansen i en egenskap styrs av generna

42 Heritabilitet Mått på hur mycket av variansen i en egenskap styrs av generna Heritabilitet ( Narrow-sense heritability ) h 2 = V A V P Additative genetisk varians Fenotypisk variation = gener + miljön

43 Parent-offspring regression Heritabilitet

44 Stamtavlor Heritabilitet och andra parametrar kan estimeras från informationen in en stamtavla

45 Stamtavlor Genetisk släktskap halveras för varje generation 50% 50% 25%

46 Stamtavlor Helsyskon har i genomsnitt 50% av genomet gemensamt Kusiner 12,5% 50% 12,5%

47 Stamtavlor Kan även skilja ibland mellan effekten av könskromosomerna och autosomerna X-länkad recessiv allel Färglokus på X

48 Animal model Stora stamtavlor Många hopp mellan generationer Kan användas till att estimera genetiska parametrar i naturliga populationer

49 Länkade gener Loci på olika kromosomer ärvs helt oberoende av varandra Loci på samma kromosom ärvs tillsammans

50 Länkade gener Större sannolikhet för recombination mellan B och C än mellan A och B Map units = % rekombinerade gameter

51 Linkage mapping

52 QTL QTL = quantitative trait locus Använder markörer till att hitta relevanta loci Behövs många markörer

53 QTL QTLs för benskörhet

54 SNP SNP = single nucleotide polymorphism Kan användas som markörer Hittas genom sekvensering

55 Sekvensering Olika långa fragment Kort sekvens Färgmarkerade nukleotider

56 Sekvensering TGACCAAAATATGCGAT TTCGAAATCGCGTTGACCA TGACCAAAATAT AAATCGCGTTGACCAAAATA ATCGGTTCGAAATCGC Korta sekvenser ( contigs ) CGATATGGCCAG AATATGCGATATGGCCAG...ATCGGTTCGAAATCGCGTTGACCAAAATATGCGATATGGCCAG... Färdig sekvens

57 Genuttryck DNA transcriberas tilll mrna mrna translateras till protein Protein veckas och skickas vidare

58 Genuttryck Mutationer i kodande sekvenser = ändrad protein

59 Genuttryck Mutationer i kodande sekvenser = ändrad protein Mutationer i regleringssekvenser = produktion av högre eller lägre koncentration av samma protein

60 Egenskap Konc. protein Genuttryck Olika alleler kan resultera i olika uttrycksnivåer Svårt att mäta proteinnivåer direkt, så man kan mäta mrna istället aa Aa AA Genotyp 0 aa Aa AA Genotyp

61 Bygg en chip med komplementär DNA Isolera mrna från prov och tillsätt markör mrna binder till DNA på chip Ju mer mrna desto mer markör Markörintensitet = indirekt mått på uttryck Microarray data

62 Fenotyp Alltid ett resultat av gener i samspel med miljön! Samma genotyp Bra förhållanden Dåliga förhållanden

63 Fenotyp G x E När samspelet mellan genotyp och miljö skiljer sig mellan genotyper Gen. 2 Gen. 1 Reaktionsnormer Miljöegenskap

64 Fenotyp G x E Genetisk variation, ingen miljöpåverkan: Miljöpåverkan, ingen genetisk variation: Skillnader i plasticitet: Rangordningsskifte: Miljöegenskap

65 Hur kan vi använda den här kunskapern? Kvantitativ genetik: Är en egenskap genetiskt betingad? Vad är den relativa betydelsen av interaktioner mellan gener, eller mellan gener och miljön? QTL analys: Hur många loci spelar in? Fysiska lokalisering på kromosomerna?

66 Hur kan vi använda den här Sekvensering: kunskapern? Vilka gener är möjliga kausala varianter? Genuttryck och experiment: Vad är det för mekanism som ger upphov till fenotypiska skillnader?

67 Astma Inflammatoriskt syndrom som påverkar luftvägarna Drabbar ca. 10% av populationen

68 Heritabilitet Land Ålder h 2 Danmark Sverige Sverige Norge Norge Finland Finland Nederländerna Nederländerna England Australien USA Italien

69 Heritabilitet P = 0.02

70 Miljöpåverkan Ökar risken Sänker risken

71 Ratio kvinnor:män Könsskillnader

72 QTL och SNP Ca. 25 kända loci Ju fler alleler desto större risk

73 Kausala varianter Oftast kopplad till inflammation och allergier Testande av mekanism hos människor och möss

74 G x E

75 Astmarisk G x S Olika varianter på TLSP-genen har könsspecifika effekter SNP rs : SNP rs : Män Kvinnor aa Aa AA Genotyp aa Aa AA Genotyp

Genetik I. Jessica Abbott

Genetik I. Jessica Abbott Genetik I Jessica Abbott Att kunna/förstå efter föreläsningarna i genetik: DNA och RNA Packning av DNA Replikation Transkription och translation Cellcykeln Mitos och meios Översikt över genetiska verktyg

Läs mer

Tidiga erfarenheter av arvets mysterier

Tidiga erfarenheter av arvets mysterier Cellens genetik Cellen Växtcellen Växtcellen Tidiga erfarenheter av arvets mysterier Artförädling genom riktad avel Religiösa förbud mot syskongiftemål Redan de gamla grekerna.. Aristoteles ~350 år före

Läs mer

Evolution, del 2: Evolutionsprocesser och förändringar i det genetiska materialet. Jessica Abbott Forskare Evolutionär Ekologi

Evolution, del 2: Evolutionsprocesser och förändringar i det genetiska materialet. Jessica Abbott Forskare Evolutionär Ekologi Evolution, del 2: Evolutionsprocesser och förändringar i det genetiska materialet Jessica Abbott Forskare Evolutionär Ekologi Naturlig selektion Alleler som ger bättre överlevnad och/eller reproduktionsförmåga

Läs mer

Genetik. - cellens genetik - individens genetik. Kap 6

Genetik. - cellens genetik - individens genetik. Kap 6 Genetik - cellens genetik - individens genetik Kap 6 Vad bestämmer hur en organism (cell) ser ut och fungerar? Generna (arvsanlagen) och miljön Hur går det till? En gen är en ritning för hur ett protein

Läs mer

GENETIK - Läran om arvet

GENETIK - Läran om arvet GENETIK - Läran om arvet Kroppens minsta levande enheter är cellerna I cellkärnorna finns vår arvsmassa - DNA (DNA - Deoxiribonukleinsyra) Proteiner Transportproteiner Strukturproteiner Enzymer Reglerande

Läs mer

Karl Holm Ekologi och genetik, EBC, UU. ebc.uu.se. Nick Brandt. Populationsgenetik

Karl Holm Ekologi och genetik, EBC, UU. ebc.uu.se. Nick Brandt. Populationsgenetik Karl Holm Ekologi och genetik, EBC, UU karl.holm@ ebc.uu.se Nick Brandt Populationsgenetik Kursens upplägg Föreläsningar 24/4, 10:15-16:00 Friessalen Introduktion, HWE 27/4, 10:15-16:00 Inavel 28/4, 10:15-16:00

Läs mer

Kromosomer, celldelning och förökning

Kromosomer, celldelning och förökning Kromosomer, celldelning och förökning Kromosomen Hur ligger DNA lagrat? DNA 2 nm Prokaryota celler har vanligtvis endast en kromosom. I eukaryota celler finns alltid mer än en DNA-molekyl som bildar olika

Läs mer

Kod: Personnummer: Plats nr: Inlämnad kl: ID kollad: Poäng: Betyg: SKRIV DIN KOD PÅ ALLA SIDOR ÄVEN OM FRÅGAN LÄMNAS OBESVARAD.

Kod: Personnummer: Plats nr: Inlämnad kl: ID kollad: Poäng: Betyg: SKRIV DIN KOD PÅ ALLA SIDOR ÄVEN OM FRÅGAN LÄMNAS OBESVARAD. STOCKHOLMS UNIVERSITET Institutionen för biologisk grundutbildning Cell och molekylärbiologi 2015-02-02 Omtentamen CMB-II (11 hp) Kod: Personnummer: Plats nr: Inlämnad kl: ID kollad: Poäng: Betyg: Skrivtiden

Läs mer

Skrivning för biolog- och molekylärbiologlinjen, genetik 5p.

Skrivning för biolog- och molekylärbiologlinjen, genetik 5p. Skrivning för biolog- och molekylärbiologlinjen, genetik 5p. Namn: Adress: Resultat: Betyg: Hjälpmedel: Miniräknare. Formelblad med tabell. Skrivtid: 9.00-13.00. Beräkningar och svar ska vara motiverade.

Läs mer

NUKLEINSYRORNAS UPPBYGGNAD: Två olika nukleinsyror: DNA deoxyribonukleinsyra RNA ribonukleinsyra

NUKLEINSYRORNAS UPPBYGGNAD: Två olika nukleinsyror: DNA deoxyribonukleinsyra RNA ribonukleinsyra NUKLEINSYRORNAS UPPBYGGNAD: Två olika nukleinsyror: DNA deoxyribonukleinsyra RNA ribonukleinsyra Monomererna som bygger upp nukleinsyrorna kallas NUKLEOTIDER. En nukleotid består av tre delar: en kvävebas

Läs mer

Kap 26 Nukleinsyror och proteinsyntes. Bilder från McMurry

Kap 26 Nukleinsyror och proteinsyntes. Bilder från McMurry Kap 26 Nukleinsyror och proteinsyntes Bilder från McMurry Namn Efternamn 26 februari 2011 2 Varje DNA molekyl är uppbyggd av många gener induviduella DNA segmant som innehåller instruktioner för syntes

Läs mer

GENETISKA UTREDNINGAR OCH METODER MULTIFAKTORIELLT ARV

GENETISKA UTREDNINGAR OCH METODER MULTIFAKTORIELLT ARV GENETISKA UTREDNINGAR OCH METODER MULTIFAKTORIELLT ARV VARFÖR GENETISKA ANALYSER? Bekräfta/fastställa klinisk diagnos Genotyp-fenotyp; prognos Anlagsbärardiagnostik Reproduktionsalternativ/ Fosterdiagnostik/PGD

Läs mer

DNA-molekylen. 1869 upptäcktes DNA - varken protein, kolhydrat eller lipid.

DNA-molekylen. 1869 upptäcktes DNA - varken protein, kolhydrat eller lipid. Genetik Ärftlighetslära - hur går det till när egenskaper går i arv? Molekylär genetik - information i DNA och RNA Klassisk genetik - hur olika egenskaper ärvs Bioteknik - Hur DNA flyttas mellan olika

Läs mer

Mitos - vanlig celldelning

Mitos - vanlig celldelning Mitos - vanlig celldelning Interfas Cellens normala tillstånd kopiering sker. Enskilda kromosomer kan inte urskiljas Profas DNA molekylerna packar ihop sig i tydliga kromosomer Metafas Cellkärnans membran

Läs mer

Tentamen. Kurskod: MC1004. Medicin A, Molekylär cellbiologi. Kursansvarig: Christina Karlsson. Datum 130814 Skrivtid 4h

Tentamen. Kurskod: MC1004. Medicin A, Molekylär cellbiologi. Kursansvarig: Christina Karlsson. Datum 130814 Skrivtid 4h Tentamen Medicin A, Molekylär cellbiologi Kurskod: MC1004 Kursansvarig: Christina Karlsson Datum 130814 Skrivtid 4h Totalpoäng: 86p Poängfördelning Johanna Sundin (fråga 1 8): 18p Ignacio Rangel (fråga

Läs mer

Instuderingsfrågor avsnitten Molekylär genetik och Rekombinant DNA tekniker, MCB

Instuderingsfrågor avsnitten Molekylär genetik och Rekombinant DNA tekniker, MCB Instuderingsfrågor avsnitten Molekylär genetik och Rekombinant DNA tekniker, MCB Molekylärgenetikdelen 1. Vad är DNA? 2. Vad heter byggstenarna i DNA? 3. Vad är RNA? 4. Vad är en bas, nukleosid, nukleotid

Läs mer

Gen Transkripterbar del. promotor exon intron exon intron exon Slut på transkription. av transkription, fixar rätt tid och rätt mängd.

Gen Transkripterbar del. promotor exon intron exon intron exon Slut på transkription. av transkription, fixar rätt tid och rätt mängd. Gener är viktiga i biologin och idag ett aktuellt ämne. Genetik = läran om arvbarhet. Startade på 1860-talet med munken Gregor Mendel, som påvisade det som vi kallar gener. Genetik = läran om gener. Gen

Läs mer

Ägg till embryo Dugga 120305 Platsnummer VIKTIGT ATT DU FYLLER I OCH LÄMNAR IN! TEXTA TACK. Efternamn. Förnamn. Personnummer

Ägg till embryo Dugga 120305 Platsnummer VIKTIGT ATT DU FYLLER I OCH LÄMNAR IN! TEXTA TACK. Efternamn. Förnamn. Personnummer IDENTITETSBLAD VIKTIGT ATT DU FYLLER I OCH LÄMNAR IN! TEXTA TACK Efternamn Förnamn Personnummer Gruppnummer (Grupp 1-40 på kursen) Enligt KI:s utbildningsstyrelses beslut skall skrivningar rättas anonymt.

Läs mer

LPP Nervsystemet, hormoner och genetik

LPP Nervsystemet, hormoner och genetik LPP Nervsystemet, hormoner och genetik Det är bara hormonerna och han är full av hormoner är två vanliga uttryck med ordet hormon, men vad är egentligen hormoner och hur påverkar de kroppen? Vi har ett

Läs mer

Genetik. Biologisk översiktskurs VT Hemtenta. Finns på studentportalen Ska vara inlämnad 25 Februari Ska skickas till urkund

Genetik. Biologisk översiktskurs VT Hemtenta. Finns på studentportalen Ska vara inlämnad 25 Februari Ska skickas till urkund Genetik Biologisk översiktskurs VT 2011 Hemtenta Finns på studentportalen Ska vara inlämnad 25 Februari Ska skickas till urkund 1 Frågor? Peter Halvarsson peter.halvarsson@ebc.uu.se Populationsbiologi,

Läs mer

Få grepp om genetiken

Få grepp om genetiken Få grepp om genetiken Forskning och utveckling i den moderna biologin går i rasande takt. För att kunna hänga med i medierapporteringen och kunna ta ställning till frågor som handlar om genetik och genteknik,

Läs mer

Genetik, Gen-etik och Genteknik

Genetik, Gen-etik och Genteknik Genetik, Gen-etik och Genteknik Syfte och innehåll Att utveckla kunskap om det genetiska arvet och genteknikens möjligheter. Arbetssätt Vi kommer att varva föreläsningar, diskussioner, arbetsuppgifter

Läs mer

Delprov l, fredag 11/11,

Delprov l, fredag 11/11, Delprov l, fredag 11/11, 14.00-17.00 Fråga 1 (5 p). Ringa in ett av alternativen (endast ett): A. Vilket påstående är falskt? l. Aminosyror är byggstenar till proteiner 2. Membraner består av peptidoglykan

Läs mer

Simulering av evolutionär anpassing En studie om hur arters anpassningsförmåga varierar med mutationsfrekvens.

Simulering av evolutionär anpassing En studie om hur arters anpassningsförmåga varierar med mutationsfrekvens. Simulering av evolutionär anpassing En studie om hur arters anpassningsförmåga varierar med mutationsfrekvens. Christian Lie NV3C Polhemsgymnasiet Göteborg 1 Innehållsförteckning: Sammanfattning Inledning

Läs mer

Läsanvisningar och exempelfrågor del 2: genetik

Läsanvisningar och exempelfrågor del 2: genetik Läsanvisningar och exempelfrågor del 2: genetik Sidhänvisningarna avser den officiella kursboken, Karlsson, Krigsman, Molander, Wickman: Biologi A med Naturkunskap A, upplaga -05. Hänvisningar ges även

Läs mer

Molekylärbiologi: Betygskriterier

Molekylärbiologi: Betygskriterier Molekylärbiologi: Betygskriterier De obligatoriska momenten laboration och presentationsövningar examineras separat (endast G). Se separat utdelade anvisningar. Betygskriterier för teoridelen (se nedan).

Läs mer

Hardy-Weinberg jämnvikt Processer som minskar genetisk variation: Inavel Genetisk drift

Hardy-Weinberg jämnvikt Processer som minskar genetisk variation: Inavel Genetisk drift Populationsgenetik Hardy-Weinberg jämnvikt Processer som minskar genetisk variation: Inavel Genetisk drift Processer som ökar genetisk variation: Mutationer Migration Miljömässiga förändringar Balancen

Läs mer

Tentamen Biologi BI1112 Termin och år: Klockan:

Tentamen Biologi BI1112 Termin och år: Klockan: Tentamen Biologi BI1112 Termin och år: 120312 Klockan: 0800-13.15 Betygsgränser:!!! 50-66%! Betyg 3!!!!! 67-83%! Betyg 4!!!!! 84-100%! Betyg 5 Fråga 1-4 Cellbiologi Fråga 5-7 Genetik Fråga 8-10 Växtfysiologi!!!!

Läs mer

Mångfald inom en art. Genotyp. Genpool. Olika populationer. Fig En art definieras som

Mångfald inom en art. Genotyp. Genpool. Olika populationer. Fig En art definieras som Mångfald inom en art Population och art. Vad är skillnaden? Vad är en art? Genetisk variation Genetiskt olika populationer Tillämpningar av genetisk variation Etiska problem En art En art definieras som

Läs mer

Mångfald inom en art. Genotyp. Genpool. Olika populationer. Fig En art definieras som

Mångfald inom en art. Genotyp. Genpool. Olika populationer. Fig En art definieras som Mångfald inom en art Population och art. Vad är skillnaden? Vad är en art? Genetisk variation Genetiskt olika populationer Tillämpningar av genetisk variation Etiska problem En art En art definieras som

Läs mer

RNA-syntes och Proteinsyntes

RNA-syntes och Proteinsyntes RNA-syntes och Proteinsyntes Jenny Flygare (jenny.flygare@ki.se) Genexpression - översikt 5 (p) A T G T C A G A G G A A T G A 3 (OH) T A C A G T C T C C T T A C T 3 (OH) 5 (p) VAD TRANSLATERAS DEN HÄR

Läs mer

Varken homo- eller heterozygot. En gen förekommer i enkel upplaga hos en i övrigt diploid individ. Män är hemizygota för gener på X-kromosomen.

Varken homo- eller heterozygot. En gen förekommer i enkel upplaga hos en i övrigt diploid individ. Män är hemizygota för gener på X-kromosomen. G 1: NAMN... Definiera och redogör kortfattat följande begrepp: ( Varje delfråga ger 1 poäng) a. Hemizygot Varken homo- eller heterozygot. En gen förekommer i enkel upplaga hos en i övrigt diploid individ.

Läs mer

Genetik en sammanfattning

Genetik en sammanfattning Genetik en sammanfattning Pär Leijonhufvud $\ BY: 3 februari 2015 C Innehåll Inledning 2 Klassisk genentik 2 Gregor Mendel munken som upptäckte ärftlighetens lagar....... 2 Korsningsrutor, ett sätt att

Läs mer

Ägg till embryo Dugga 121029 Platsnummer VIKTIGT ATT DU FYLLER I OCH LÄMNAR IN! TEXTA TACK. Efternamn. Förnamn. Personnummer

Ägg till embryo Dugga 121029 Platsnummer VIKTIGT ATT DU FYLLER I OCH LÄMNAR IN! TEXTA TACK. Efternamn. Förnamn. Personnummer IDENTITETSBLAD VIKTIGT ATT DU FYLLER I OCH LÄMNAR IN! TEXTA TACK Efternamn Förnamn Personnummer Gruppnummer (Grupp 1-40 på kursen) Enligt KI:s utbildningsstyrelses beslut skall skrivningar rättas anonymt.

Läs mer

DNA-ordlista. 16S: Egentligen 16S rrna. Mitokondriell gen med förhållandevis liten variation som ofta används för att artbestämma DNA från däggdjur.

DNA-ordlista. 16S: Egentligen 16S rrna. Mitokondriell gen med förhållandevis liten variation som ofta används för att artbestämma DNA från däggdjur. DNA-ordlista 16S: Egentligen 16S rrna. Mitokondriell gen med förhållandevis liten variation som ofta används för att artbestämma DNA från däggdjur. Alignment: Att placera DNA-sekvenser intill varandra.

Läs mer

Tensta Gymnasium Per Anderhag 2005 Biologi A Naturligt urval Selektionstryck på Björkmätare 1

Tensta Gymnasium Per Anderhag 2005 Biologi A Naturligt urval Selektionstryck på Björkmätare 1 Naturligt urval Selektionstryck på Björkmätare 1 Laborationen bygger på den evolution som skett på nattfjärilen björkmätare (Biston betularia) i England. Fjärilen sitter på trädstammar och finns i två

Läs mer

Transkription och translation = Översättning av bassekvensen till aminosyrasekvens

Transkription och translation = Översättning av bassekvensen till aminosyrasekvens Transkription och translation = Översättning av bassekvensen till aminosyrasekvens OBS! Grova drag för prokaryota system! Mycket mer komplicerat i eukaryota system! RNA: Tre huvudtyper: trna transfer RNA

Läs mer

CELLDELNING 1 MITOS EUKARYOT CELLDELNING. Eukaryot celldelning. 1. cellcykeln 2. mitos 3. cytokinesis

CELLDELNING 1 MITOS EUKARYOT CELLDELNING. Eukaryot celldelning. 1. cellcykeln 2. mitos 3. cytokinesis CELLDELNING 1 MITOS EUKARYOT CELLDELNING 1. cellcykeln 2. mitos 3. cytokinesis Eukaryot celldelning självreplikering celldelning ett villkor för liv skapa liv, växa i storlek, eller ersätta döda celler

Läs mer

Provmoment: Ladokkod: Tentamen ges för: tentamen TX091X TNBAS12. Namn: (Ifylles av student) Personnummer: (Ifylles av student)

Provmoment: Ladokkod: Tentamen ges för: tentamen TX091X TNBAS12. Namn: (Ifylles av student) Personnummer: (Ifylles av student) Biologi A basår Provmoment: Ladokkod: Tentamen ges för: tentamen TX091X TNBAS12 7,5 högskolepoäng Namn: (Ifylles av student) Personnummer: (Ifylles av student) Tentamensdatum: on 24 oktober 2012 Tid: 9.00-13.00

Läs mer

Tentamen Reproduktion och utveckling, 2011-12- 10. Åke Strids frågor:

Tentamen Reproduktion och utveckling, 2011-12- 10. Åke Strids frågor: Tentamen Reproduktion och utveckling, 2011-12- 10 Åke Strids frågor: Inför celldelning måste DNA:t kopieras. 1. Redogör för hur kopieringen går till och vilka huvudkomponenter som ingår i kopieringsmaskineriet

Läs mer

Totalt finns det alltså 20 individer i denna population. Hälften, dvs 50%, av dem är svarta.

Totalt finns det alltså 20 individer i denna population. Hälften, dvs 50%, av dem är svarta. EVOLUTION Tänk dig att det på en liten ö i skärgården finns 10 st honor av den trevliga insekten långvingad muslus. Fem av dessa är gula med svarta fläckar och fem är helsvarta. Det är samma art, bara

Läs mer

Diagnosticera sicklecellsanemi med DNA-analys. Niklas Dahrén

Diagnosticera sicklecellsanemi med DNA-analys. Niklas Dahrén Diagnosticera sicklecellsanemi med DNA-analys Niklas Dahrén Sicklecellsanemi Erytrocyterna ser ut som skäror : Sjukdomen innebär a0 de röda blodkropparna (erytrocyterna) ser ut som skäror (eng. sickle)

Läs mer

IDENTITETSBLAD Dugga

IDENTITETSBLAD Dugga IDENTITETSBLAD Dugga 080225 VIKTIGT ATT DU FYLLER I OCH LÄMNAR IN! TEXTA TACK Efternamn Förnamn Personnummer Gruppnummer Platsnummer (i skrivsalen) Enligt KI:s utbildningsstyrelses beslut skall skrivningar

Läs mer

ELEMENTÄR - SVÅRARE FÄRGGENETIK. Del 4

ELEMENTÄR - SVÅRARE FÄRGGENETIK. Del 4 ELEMENTÄR - SVÅRARE FÄRGGENETIK Del 4 av Maria Grönkvist Hur fungerar ärftlighetslagarna när det är två genpar med i leken? Slumpens rutmönster utökas då till 16 rutor, dvs det finns 16 olika möjligheter

Läs mer

Tentamen Biologi BI1112 Termin och år: ad Klockan:

Tentamen Biologi BI1112 Termin och år: ad Klockan: Tentamen Biologi BI1112 Termin och år: 120831ad Klockan: 0800-13.15 Betygsgränser: 50-66% Betyg 3 67-83% Betyg 4 84-100% Betyg 5 Fråga 1-4 Cellbiologi Fråga 5-7 Genetik Fråga 8-10 Växtfysiologi Skriv svar

Läs mer

PROV 4 Växtproduktionsvetenskaper och husdjursvetenskap

PROV 4 Växtproduktionsvetenskaper och husdjursvetenskap Helsingfors universitet Urvalsprovet 29.5.2013 Agrikultur-forstvetenskapliga fakulteten PROV 4 Växtproduktionsvetenskaper och husdjursvetenskap Den sökandes namn: Personbeteckning: För essäsvaren 1-3 kan

Läs mer

Metoder för att identifiera genetisk sjukdomar

Metoder för att identifiera genetisk sjukdomar Hunden människans sjukaste vän Olof Vadell Populärvetenskaplig sammanfattning av Självständigt arbete i biologi 2012 Institutionen för biologisk grundutbildning, Uppsala universitet Hunden har varit en

Läs mer

Ägg till embryo Dugga 110307 Platsnummer VIKTIGT ATT DU FYLLER I OCH LÄMNAR IN! TEXTA TACK. Efternamn. Förnamn. Personnummer

Ägg till embryo Dugga 110307 Platsnummer VIKTIGT ATT DU FYLLER I OCH LÄMNAR IN! TEXTA TACK. Efternamn. Förnamn. Personnummer IDENTITETSBLAD VIKTIGT ATT DU FYLLER I OCH LÄMNAR IN! TEXTA TACK Efternamn Förnamn Personnummer Gruppnummer Enligt KI:s utbildningsstyrelses beslut skall skrivningar rättas anonymt. Därför skall namn och

Läs mer

BASÅRET KEMI B BIOKEMI VT 2012. GENETISK INFORMATION 191-210 (sid. 157-177)

BASÅRET KEMI B BIOKEMI VT 2012. GENETISK INFORMATION 191-210 (sid. 157-177) BASÅRET KEMI B BIOKEMI GENETISK INFORMATION 191-210 (sid. 157-177) DNA/RNA, Transkription, Translation VAR I CELLEN SKER DETTA? Replikation - kopiering av DNA, sker i cellkärnan Transkription - avläsa

Läs mer

Genetik och Avel. eller. man får ändå vara glad att det blev som det blev när det inte blev som det skulle

Genetik och Avel. eller. man får ändå vara glad att det blev som det blev när det inte blev som det skulle Genetik och Avel eller man får ändå vara glad att det blev som det blev när det inte blev som det skulle Biet är en enastående organism för vilken evolutionen fram till idag slutat i ett mycket avancerat

Läs mer

Information om SKK:s index för HD och ED

Information om SKK:s index för HD och ED Information om SKK:s index för HD och ED Text: Sofia Malm Höft- och armbågsledsdysplasi (HD och ED) är vanligt förekommande i många, framförallt storvuxna, hundraser. Trots mångåriga hälsoprogram orsakar

Läs mer

IDENTITETSBLAD Dugga 081013

IDENTITETSBLAD Dugga 081013 IDENTITETSBLAD Dugga 081013 VIKTIGT ATT DU FYLLER I OCH LÄMNAR IN! TEXTA TACK Efternamn Förnamn Personnummer Gruppnummer Platsnummer (i skrivsalen) Enligt KI:s utbildningsstyrelses beslut skall skrivningar

Läs mer

Genetik/Avel Grundkurs Handledning, målbeskrivning, råd och anvisningar 2004-11

Genetik/Avel Grundkurs Handledning, målbeskrivning, råd och anvisningar 2004-11 Grundkurs Handledning, målbeskrivning, råd och anvisningar 2004-11 Introduktion Genetiska kunskaper hos uppfödare är en nödvändighet för att förstå vad till exempel SKKs hälsoprogram innebär och varför

Läs mer

CELLDELNING, mitos, cellcykelreglering, meios

CELLDELNING, mitos, cellcykelreglering, meios CELLDELNING, mitos, cellcykelreglering, meios EUKARYOT CELLDELNING 1. cellcykeln 2. mitos 3. cytokinesis 1 Eukaryot celldelning självreplikering encelliga organismer: en ny organism bildas vid varje celldelning

Läs mer

Crafoordpriset i biovetenskaper 2015

Crafoordpriset i biovetenskaper 2015 RAFOORDPRISE I BIOVEENSKAPER 2015 POPULÄRVEENSKAPLI INFORMAION rafoordpriset i biovetenskaper 2015 rafoordpriset i biovetenskaper 2015 går till genetikerna Richard Lewontin, USA, och omoko Ohta, Japan,

Läs mer

Pedagogisk planering Bi 1 - Individens genetik

Pedagogisk planering Bi 1 - Individens genetik Centralt innehåll Genetik Arvsmassans uppbyggnad samt ärftlighetens lagar och mekanismer. Celldelning, dnareplikation och mutationer. Genernas uttryck. Proteinsyntes, monogena och polygena egenskaper,

Läs mer

Tentamen: Biologi 1TV001 Termin och år: VT08

Tentamen: Biologi 1TV001 Termin och år: VT08 Tentamen: Biologi 1TV001 Termin och år: VT08 7/3-08, klockan 08.00-13.00 Skriv svar på alla frågor på separata papper, märk varje papper med kod: Betygsgränser: 50-66% Betyg 3 67-83% Betyg 4 84-100 % Betyg

Läs mer

PROV 6 Bioteknik. 1. Hur klona gener med hjälp av plasmider?

PROV 6 Bioteknik. 1. Hur klona gener med hjälp av plasmider? För essäsvaren 1 2 kan den sökande få högst 9 poäng/fråga. Vid poängsättningen beaktas de exakta sakuppgifter som den sökande gett i sitt svar. För dessa kan den sökande få högst 7 poäng. Dessutom 1. Hur

Läs mer

Evolution. Hur arter uppstår, lever och försvinner

Evolution. Hur arter uppstår, lever och försvinner Evolution Hur arter uppstår, lever och försvinner Aristoteles 384-322 f.kr Idéhistoria Carl von Linné 1707-1778 Georges de Buffon 1707-1788 Jean Babtiste Lamarck 1744-1829 Idéhistoria Cuvier Malthus Lyell

Läs mer

Kompletterande material Biologi I HT12 Innehåll

Kompletterande material Biologi I HT12 Innehåll 1 Kompletterande material Biologi I HT12 Innehåll Kompletterande material Biologi I HT11... 1 Biologisk systematik (Ulf Norling, reviderat 2009)... 2 Stödanteckningar: DNA, proteinsyntes, genreglering

Läs mer

RNA och den genetiska koden

RNA och den genetiska koden RNA och den genetiska koden Table of Contents Struktur... 1 DNA och RNA... 2 Puriner och Pyrimidiner... 2 Watson-Crick baspar... 2 RNA som molekyl... 2 Primär struktur... 2 Sekundära strukturer... 2 Typer

Läs mer

Biologiskt kön i ett evolutionärt perspektiv

Biologiskt kön i ett evolutionärt perspektiv Biologiskt kön i ett evolutionärt perspektiv inte så statiskt som vi tror? Sören Nylin, Zoologi Are boys and girls really that different? Twenty years ago, doctors and researchers didn t think so. It's

Läs mer

Formativ bedömning i praktiken: Biologi 1

Formativ bedömning i praktiken: Biologi 1 Formativ bedömning i praktiken: Biologi 1 ISBN 978-91-47-11-6 2014 Olof Procopé och Liber AB Redaktör och projektledare: Cecilia Söderpalm-Berndes Formgivare: Lotta Rennéus och Birgitta Ståhlberg Illustratör:

Läs mer

Syfte? Naturliga populationer i Trollsvattnen. Otoliter för åldersbestämning. Vävnadsprover för genetisk analys

Syfte? Naturliga populationer i Trollsvattnen. Otoliter för åldersbestämning. Vävnadsprover för genetisk analys Syfte? Inblick i vanlig genotypbestämningsmetod Allozymer har ofta använts som genetisk markör vid populationsgenetiska studier Studera genetisk variation inom och mellan populationer används inom bevarandebiologin

Läs mer

Hundar hjälper oss att förstå människans sjukdomar. Kerstin Lindblad-Toh

Hundar hjälper oss att förstå människans sjukdomar. Kerstin Lindblad-Toh Hundar hjälper oss att förstå människans sjukdomar Kerstin Lindblad-Toh Målsättning med min forskning Att hitta människors sjukdomsgener via: - djurmodeller - en bättre förståelse av arvsmassan - storskalig

Läs mer

Från DNA till protein, dvs den centrala dogmen

Från DNA till protein, dvs den centrala dogmen Från DNA till protein, dvs den centrala dogmen DNA RNA Protein Biochemistry, kapitel 1 5 samt kapitel 29 31. Kapitel 2 5 samt 29 31 berörs även i kommande föreläsningar. Transkription och translation Informationsflödet

Läs mer

Evolution i molekylärbiologiskt perspektiv

Evolution i molekylärbiologiskt perspektiv Nutidens upptäcktsfärder går till organismernas minsta beståndsdelar. Evolution i molekylärbiologiskt perspektiv En viktig milstolpe i vetenskapens historia är sekvenseringen av det mänskliga genomet.

Läs mer

Kodominans Codominance Kodominans är när båda fenotyoerna får genomslag även om allelerna är heterozygota.

Kodominans Codominance Kodominans är när båda fenotyoerna får genomslag även om allelerna är heterozygota. Gloslista Svenska engelska Förklaring Allel Allele en variant av en gen, gener styr egenskaper. De flesta gener finns i olika varianter. De olika varianterna kallas alleler. Aminosyra Amino acid En aminosyra

Läs mer

Evolution. Hur arter uppstår, lever och försvinner

Evolution. Hur arter uppstår, lever och försvinner Evolution Hur arter uppstår, lever och försvinner Aristoteles 384-322 f.kr Idéhistoria Carl von Linné 1707-1778 Georges de Buffon 1707-1788 Jean Babtiste Lamarck 1744-1829 De fem rikena Växter Djur Svampar

Läs mer

Gener i hälsa och sjukdom

Gener i hälsa och sjukdom Gener i hälsa och sjukdom Upplägg Genetiska sjukdomar Introduktion Kromosomavvikelser Monogena sjukdomar Multifaktoriella (komplexa) sjukdomar Kristina Lagerstedt-Robinson Peter Gustavsson Artikel Exome

Läs mer

**************************************************************

************************************************************** Umeå universitet EMG Barbara Giles Kod nummer: Resultat Del 1 Del 2 Del 3 Del 4 Betyg alla delar 4 Tentamensformalia Kursens namn: 5BI110 Genetik och evolution 15 hp, moment genetik HT10 Datum: 2010-11-25

Läs mer

Transkriptionen. Niklas Dahrén

Transkriptionen. Niklas Dahrén Transkriptionen Niklas Dahrén Innehållet i denna undervisningsfilm: Översikt över proteinsyntesen Transkrip1onen Modifiering (bearbetning) av mrna Fler filmer på samma tema: Från gen 1ll protein Den gene1ska

Läs mer

Epigenetikens biokemi, eller Kemisk modifiering av DNA och histonproteiner för att styra genuttryck

Epigenetikens biokemi, eller Kemisk modifiering av DNA och histonproteiner för att styra genuttryck Epigenetikens biokemi, eller Kemisk modifiering av DNA och histonproteiner för att styra genuttryck Astrid Gräslund Inst. för biokemi och biofysik Stockholms Universitet Föreläsning, Värnamo, 131016 Epigenetik

Läs mer

Hundar hjälper oss att förstå människans sjukdomar. Kerstin Lindblad-Toh

Hundar hjälper oss att förstå människans sjukdomar. Kerstin Lindblad-Toh Hundar hjälper oss att förstå människans sjukdomar Kerstin Lindblad-Toh Målsättning med min forskning Att hitta människors sjukdomsgener via: - djurmodeller - en bättre förståelse av arvsmassan - storskalig

Läs mer

Chapter 5-7. Introduction. Content. Double helix, Watson and Crick + Maria Bolin + fig 5-2

Chapter 5-7. Introduction. Content. Double helix, Watson and Crick + Maria Bolin + fig 5-2 Chapter 5-7 Introduction Double helix, Watson and Crick + Maria Bolin + fig 5-2 On Feb. 28, 1953, Francis Crick walked into the Eagle pub in Cambridge, England, and, as James Watson later recalled, announced

Läs mer

Klinisk genetik en introduktion

Klinisk genetik en introduktion Klinisk genetik en introduktion Ulf Kristoffersson Överläkare, docent Genetiska kliniken Labmedicin Skåne, Lund Vad ska en sjuksköterska kunna om ärftlighet? Ta en familjeanamnes och rita ett enkelt släktträd

Läs mer

Poäng: Godkänt 35 p. Max 70 p.

Poäng: Godkänt 35 p. Max 70 p. Stefan Klintström Avd. f. kemi, IFM Tentamen i Modern Biologi för icke-biologer Datum: Måndagen den 14 december 2009 Tid: 09.00-16.00 Plats: Brahe Examinator: Therése Klingstedt och Stefan Klintström,

Läs mer

Arvet och DNA. Genetik och genteknik

Arvet och DNA. Genetik och genteknik Arvet och DNA Genetik och genteknik Genetik Du är inte en kopia utav någon av dina föräldrar utan en unik blandning av egenskaper från båda dina föräldrar. Genetik är den del av biologin som handlar om

Läs mer

NUKLEINSYRORNAS UPPBYGGNAD: Två olika nukleinsyror: DNA deoxyribonukleinsyra RNA ribonukleinsyra

NUKLEINSYRORNAS UPPBYGGNAD: Två olika nukleinsyror: DNA deoxyribonukleinsyra RNA ribonukleinsyra NUKLEINSYRORNAS UPPBYGGNAD: Två olika nukleinsyror: DNA deoxyribonukleinsyra RNA ribonukleinsyra Monomererna som bygger upp nukleinsyrorna kallas NUKLEOTIDER. En nukleotid består av tre delar: en kvävebas

Läs mer

Genetiska Algoritmer

Genetiska Algoritmer Linköpings Universitet Intutionen för datavetenskap Artificiell Intelligens HKGBB0 HT-2003, oktober Genetiska Algoritmer Som problemlösning Anna Skoglund annsk334@student.liu.se 0 Abstract Genetiska algoritmer

Läs mer

ELEMENTÄR - SVÅRARE FÄRGGENETIK. Del 3

ELEMENTÄR - SVÅRARE FÄRGGENETIK. Del 3 ELEMENTÄR - SVÅRARE FÄRGGENETIK Del 3 av Maria Grönkvist Efter det att jag i förra numret av HR skrev en lista på den genetiska koden för en del färgvarianter har jag fått en fråga som lyder: hur får man

Läs mer

Grundläggande molekylära genetiska mekanismer Kap 4,

Grundläggande molekylära genetiska mekanismer Kap 4, Grundläggande molekylära genetiska mekanismer Kap 4, 4.1-4.6. DNA tinnehåller den genetiska informationen. I en prokaryotcell finns DNA ti cytosolen, i en eukaryotcell finns det i. För att DNA t ska kunna

Läs mer

Lunds universitet Läkarprogrammets grundkurs. Appendix 1. Hur tolkar jag målen för grundkursen? Lo Persson Eva Ekblad

Lunds universitet Läkarprogrammets grundkurs. Appendix 1. Hur tolkar jag målen för grundkursen? Lo Persson Eva Ekblad Appendix 1 Hur tolkar jag målen för grundkursen? Lo Persson Eva Ekblad Alla kursplaner innehåller mål formulerade som förväntande studieresultat. Som stöd vid formuleringen av dessa förväntade studieresultat

Läs mer

Genetik i pedagogisk text

Genetik i pedagogisk text Högskolan i Halmstad Sektionen för lärarutbildning Genetik i pedagogisk text Analys av tre läroböcker för biologikurs A Examensarbete lärarprogrammet Slutseminarium 2010-01-13 Författare---------------

Läs mer

Sammanfattning Arv och Evolution

Sammanfattning Arv och Evolution Sammanfattning Arv och Evolution Genetik Ärftlighetslära Gen Information om ärftliga egenskaper. Från föräldrar till av komma. Tillverkar proteiner. DNA (deoxiribonukleinsyra) - DNA kan liknas ett recept

Läs mer

Genetik vid polyneuropatier. Christina Jern

Genetik vid polyneuropatier. Christina Jern Genetik vid polyneuropatier Christina Jern Information lagras i DNA 2 m DNA i varje cell Bara 3 cm kodar för protein Det humana genomet februari 2001 The International Human Genome Mapping Consortium

Läs mer

Information om index för HD och ED

Information om index för HD och ED www.skk.se/uppfödning 1 januari 2013 Information om index för HD och ED Höft- och armbågsledsdysplasi (HD och ED) är vanligt förekommande hos många hundraser. För ett effektivare avelsarbete för bättre

Läs mer

Den evolutionära scenen

Den evolutionära scenen Den evolutionära scenen Det finns en del att förklara Där allt händer Skapande Evolutionsteorin Gibboner Orangutang Gorilla Människa Schimpans Bonobo Naturligt urval Artbildning Livet har en historia Gemensamt

Läs mer

Heritabilitetsskattningar och avelsvärderingsmetodik för kvantitativa egenskaper. Erling Strandberg Inst för husdjursgenetik, SLU

Heritabilitetsskattningar och avelsvärderingsmetodik för kvantitativa egenskaper. Erling Strandberg Inst för husdjursgenetik, SLU Heritabilitetsskattningar och avelsvärderingsmetodik för kvantitativa egenskaper Erling Strandberg Inst för husdjursgenetik, SLU Typ av eg. Bakgrund Fenotyper Exempel Kvalitativa Olika typer av egenskaper

Läs mer

IDENTITETSBLAD Dugga 100309

IDENTITETSBLAD Dugga 100309 IDENTITETSBLAD Dugga 100309 VIKTIGT ATT DU FYLLER I OCH LÄMNAR IN! TEXTA TACK Efternamn Förnamn Personnummer Gruppnummer Platsnummer (i skrivsalen) Enligt KI:s utbildningsstyrelses beslut skall skrivningar

Läs mer

Tentamen Reproduktion och Utveckling, 2012-05- 05. a) Slidan och cervix innehåller två olika typer av epitelceller. Vilka och vad kännetecknar

Tentamen Reproduktion och Utveckling, 2012-05- 05. a) Slidan och cervix innehåller två olika typer av epitelceller. Vilka och vad kännetecknar Tentamen Reproduktion och Utveckling, 2012-05- 05 Observera: Skriv endast en fråga per blad Maria Björkqvists fråga: 1. Katarina har nyss fyllt 23 år och har för första gången fått kallelse till hälsokontroll

Läs mer

STOCKHOLMS UNIVERSITET INSTITUTIONEN FÖR BIOLOGISK GRUNDUTBILDNING

STOCKHOLMS UNIVERSITET INSTITUTIONEN FÖR BIOLOGISK GRUNDUTBILDNING STOCKHOLMS UNIVERSITET INSTITUTIONEN FÖR BIOLOGISK GRUNDUTBILDNING TENTAMEN Kurs: Prokaryot cell- och molekylärbiologi (PCMB) Datum: 2007-06-19 kl. 10-13 Visat betald terminsräkning och legitimation _

Läs mer

Cellbiologi. Maria Ankarcrona Nov 2010

Cellbiologi. Maria Ankarcrona Nov 2010 Cellbiologi Maria Ankarcrona Nov 2010 1 Instuderingsfrågor (från den 15/11) 1. Beskriv uppbyggnaden av den eukaryota cellens cellmembran. 2. Vilken funktion fyller cellmembranet? 3. Ge exempel på fördelar

Läs mer

Human Molekylärgenetik. Del 1 Inledning till human genetik

Human Molekylärgenetik. Del 1 Inledning till human genetik Human Molekylärgenetik Del 1 Inledning till human genetik del 1 definition varför studera molekylärgenetik? fenotyper genetisk variation monogena vs. komplexa anlag, exemplifiering genotyper vilka typer

Läs mer

Gener, genom och kromosomer , 6.6 och sid

Gener, genom och kromosomer , 6.6 och sid Gener, genom och kromosomer 6.1-6.3, 6.6 och sid 263-265 En gen är en DNA-sekvens som kan.. En kromosom är en DNA-molekyl. I cellen finns det lika mycket protein som DNA i kromosomerna, se fig6-1. Ett

Läs mer

Klipp-och-klistra DNA: fixa mutationen med gen editering DNA, RNA och Protein

Klipp-och-klistra DNA: fixa mutationen med gen editering DNA, RNA och Protein Huntingtons sjukdom forsknings nyheter. I klartext Skriven av forskare För de globala HS medlemmarna. Klipp-och-klistra DNA: fixa mutationen med gen editering Forskare gör exakta ändringar av DNA i ett

Läs mer

Molekylärbiologins centrala dogma

Molekylärbiologins centrala dogma Molekylärbiologins centrala dogma m Replikation:Bassekvensen i DNA står för den genetiska informationen. När en cell ska delas måste DNA:tdupliceras man måste få nytt DNA med exakt samma bassekvens som

Läs mer

genvägar arv facit.notebook December 02, 2009 Genvägar arv mar 11 10:20

genvägar arv facit.notebook December 02, 2009 Genvägar arv mar 11 10:20 Genvägar arv mar 11 10:20 1 Hur kommer det sig att elefantungar liknar elefanter och ringblommor liknar ringblommor? Kromosomerna innehåller arvsanlagen som också kallas gener. Varje genfinns i två exemplar.

Läs mer

Arv + miljö = diabetes?

Arv + miljö = diabetes? Arv + miljö = diabetes? Kristina Lejon universitetslektor, immunologi, Institutionen för klinisk mikrobiologi Vad är det som gör att vi får diabetes? Anna Möllsten var nyss inne på den frågan och visade

Läs mer

Omtentamen i tema Reproduktion/Utveckling Läkarprogrammet, T2, , kl Instruktioner

Omtentamen i tema Reproduktion/Utveckling Läkarprogrammet, T2, , kl Instruktioner Omtentamen i tema Reproduktion/Utveckling Läkarprogrammet, T2, 2013-04-27, kl 8.15-12.15 Instruktioner 1) Skriv din kod längst upp till höger på SAMTLIGA papper i detta häfte samt på eventuella extrablad

Läs mer