TENTAMEN, Systematik

Storlek: px
Starta visningen från sidan:

Download "TENTAMEN, Systematik 2012-05-02"

Transkript

1 TENTAMEN, Systematik EMG, Umeå universitet, Ulla Carlsson-Granér och Anders Nilsson Tentamensformalia Kursens namn: 5BI090 Ekologi och Systematik 15 hp, moment systematik VT12 Datum: Tid: Inga tillåtna hjälpmedel ***************************************************************** Denna tentamen består av fem delar som var och en är kopplad till en eller flera av kursens förväntade studieresultat. Del 1. Prokaryota och eukaryota cellers uppkomst och utveckling Del 2. Plantae- växter Del 3. Fungi - svampar Del 4. Vetenskaplig namngivning, systematikens teoribildning Del 5. Metazoa - djur: Varje del består av ett antal delfrågor. I början av varje del anges vilket/vilka förväntade studieresultat som frågorna examinerar, maximala poängen för delmomentet, samt gränsen för godkänt (60 %) och väl godkänt (80 %). Bedömnings- och betygskriterier Varje del (1-5) bedöms var för sig. För godkänt krävs att du nått upp till 60 % rätt på var och ett av delmomenten. För att komma upp i de poäng som krävs för väl godkänd på varje del (80 % rätt) krävs att du uppvisar en analytisk förmåga i lösandet av uppgifter samt att du i förekommande fall kan tillämpa kursens innehåll på nya frågeställningar. För väl godkänt på hela tentamen ska du ha uppnått väl godkänt på minst 3 av de 5 delmomenten samt att alla 5 delmoment är godkända. Kom ihåg! Slappna av och bli inte skärrad av mängden frågor utan ta det lugnt och beta av en efter en. Skriv dina svar på lösa svarspapper, olika blad för olika delfrågor (alternativfrågor kan du om du vill svara på direkt i tentamen). Glöm inte att skriva din personliga kod på varje svarspapper! Lycka till! Ulla & Anders

2 Del 1. Frågor för följande förväntade studieresultat, Max 13p, G =7,5p, VG = 10,5p redogöra för prokaryota och eukaryota cellers uppkomst och utveckling samt översiktligt beskriva de encelliga organismernas mångfald 1. Fram till för några år sedan placerades alla prokaryoter dvs. bakterier och arkeer i samma rike (3p) a) Vilka egenskaper hos bakterier och arkeer gjorde att de tidigare placerades i samma taxon? b) Vad motiverar att vi idag placerar bakterier och arkeer i två olika domäner? 2. a) Vilka olika sätt att livnära sig på finns bland bakterier (dvs domän bacteria)? b) Ge exempel på bakterier som livnär sig på de sätten du angett. (4p) 3. Vad är sekundär endosymbios och vilken betydelse anses detta ha haft för diversiteten bland eukaryoter? (3p) 4. Under materialstudierna såg ni exempel från organismgrupperna nedan. a) Vilken organismgrupp ser ni under I) resp. under II) I) II) b) Beskriv kort organismerna som syns i a) resp. b) (ex. levnadssätt, livsmiljö etc.) (3p)

3 Del 2. Frågor för följande förväntade studieresultat max 16 p, G = 9,5p VG=12,5p karakterisera och identifiera de flercelliga eukaryoternas huvudgrupper med tonvikt på landväxter samt kunna göra evolutionära jämförelser 5. Vad är det för skillnad mellan: (6p) a. Spor och gamet? b. Bär och Nöt? c. Kotte och frukt? d. Gametangium och sporangium? e. Knapp och märke? f. Homospor och heterospor 6. Kransalger (Charophyceae) anses vara landväxters (Plantae) nu levande närmaste släktingar. Utvecklingen av växter på land innebar anpassningar till helt andra miljöbetingelser än de som råder i vattnet. (6p) a) Beskriv fya egenskaper som utvecklats hos växter som en anpassning till ett liv på land och förklara vilka fördelar det kan vara för en landlevande växt att ha de nämnda egenskaperna. b) Ange någon/några växtgrupper som har de egenskaper du angett i a) 7. Jämför fröbildningen mellan barrträd (Coniferophyta) och gömfröiga (Spermatophyta) växter. Diskutera skillnaderna ur ett evolutionärt perspektiv. (4p)

4 Del 3. Frågor för följande förväntade studieresultat Max 10p, G= 6p, VG=8p karakterisera och identifiera de flercelliga eukaryoternas huvudgrupper med tonvikt på lsvampar samt kunna göra evolutionära jämförelser 8. Vad är typsikt för svampar när det gäller: (3p) a) Cellväggens uppbyggnad b) Sätt att skaffa föda c) Livscykel 9. Beskriv följande begrepp som uppträder bland svampar och ge exempel på en organism (ex. någon som ni tittade på under materialstudierna) hos vilken det uppträder (3p) a) osepterat mycel b) soredier d) karyogami 10. Vad är mykorrhiza? Ge exempel på ett svampphylum där det finns arter som bildar mykorrhiza (2p) 11. När du kommer hem efter att ha varit borta en helg så har det bröd du lämnade hemma möglat. Du som nyfiken biologistudent vill förstår ta reda på vilket mögel du har på brödet. Du tar därför med dig brödet till universitetet och gör ett mikropreprat. Beskriv hur du responerar för att bestämma om du har en klättermögel (Rhizopus stolonifera, Zygomycota) eller vitmögel (Aspergillus sp. Ascomycota) på din brödbit (2p)

5 Del 4. Frågor för följande förväntade studieresultat Max 13p, G 7,5 p, VG 10,5p tillämpa reglerna för vetenskaplig namngivning av taxa inom botanik och zoologi, förstå några centrala delar av systematikens teoribildning och känna till några av de viktigaste arbetsmetoderna 12. Ordna följande linneanska kategorier så att de bildar en serie från den minst till den mest omfattande! Ge därefter ett botaniskt eller zoologiskt exempel på ett vetenskapligt taxonnamn för varje kategori [t ex art bot. Zea mays] (2,5p) Klass familj fylum släkte ordning 13. Vilka av följande parvisa jämförelser kan sägas representera homologa strukturer utifrån en morfologisk synvinkel? Motivera dina svar! (3p) (a) Ögat hos en bläckfisk och ögat hos en tonfisk. (b) Fjällen på en huggorm och fjällen på en gädda. (c) Lungan hos en lungfisk och simblåsan hos en sik. 14. Rita ett gemensamt kladogram för samtliga åtta följande arter som följer den använda klassificeringen så att alla släkten och familjer är monofyletiska: (2,5p) FELIDAE: Felis silvestris, F. pardalis, Panthera leo, P. onca CANIDAE: Canis lupus, C. rufus, C. dingo, Vulpes vulpes 15. En molekylärsystematisk studie av tre arter av ugglor och med ormvråken som utgrupp utgår från följande DNA-sekvenser med 30 nukleotider. (5p) Ormvråk Berguv Lappuggla Pärluggla GTA TGT GTC GCC CAT CGT TCC CTG TGC GCT GTA TGT ATC ACC CAC CGT GCC CTG TTC TCG GTA CGT GTC GCG CAC TCG GGC CCG TGC TCT GCA CGT GTC GCG CAC GTC TGC CCG CGC TGT a) Vilka karaktärer i matrisen är fylogenetiskt informativa? (1p) b) Rita de tre orotade träd som finns för dessa fyra arter! (1p) c) Ange trädlängden för vart och ett av de tre orotade träden, baserad endast på de informativa karaktärerna! (2p) d) Rita det kortaste trädet rotat med ormvråken! (1p)

6 Del 5. Frågor för följande förväntat studieresultat Max 19p, G 11p, VG 15p karakterisera och identifiera olika eukaryota organismgrupper och göra evolutionära/fylogenetiska jämförelser inom djur 16. Ange två embryologiska skillnader mellan djur tillhörande grupperna Protostomia respektive Deuterostomia. Namnge även två fyla från vardera gruppen! (4p) 17. Insekter, mångfotingar och palpkäkar är tre av leddjurens nulevande huvudgrupper. Ange hur de tre grupperna skiljer sig åt vad gäller antenner, mundelar och ben! (3p) 18. Hårstjärnor, ormstjärnor och sjöstjärnor är tre olika typer av tagghudingar med armar. Ange tre olika morfologiska egenskaper som skiljer dem åt, samt även tre egenskaper som visar att de alla tillhör samma fylum! (3p) 19. Rita det mest sannolika släktskapsträdet för följande olika ryggsträngsdjur: vithaj, blåval, kopparödla, lancettfisk, boaorm, mört, lövgroda och pirål! (3p) 20. Fast de kommer från två helt olika grenar på amnioternas träd uppvisar däggdjurens och fåglarnas evolution många parallella drag. Ange tre nya egenskaper som utvecklats oberoende hos både däggdjur och fåglar samt även tre morfologiska skillnader mellan de båda grupperna! (3p) 21. Ordna följande taxa från vårt eget underfylum i rätt hierarkisk ordning, från det mest till det minst omfattande! Ange även vilken egenskap som namnet på varje taxon refererar till! (3p) Synapsida - Gnathostomata - Vertebrata - Tetrapoda - Craniata - Amniota

Studier av tillväxt, reproduktion, ämnesomsättning, utveckling, sjukdomar, ekologi och evolution av växter.

Studier av tillväxt, reproduktion, ämnesomsättning, utveckling, sjukdomar, ekologi och evolution av växter. Växtrikets historia Botanik Läran om växter Studier av tillväxt, reproduktion, ämnesomsättning, utveckling, sjukdomar, ekologi och evolution av växter. Studeras på alla nivåer; molekylär, genetisk och

Läs mer

Vad är en art? morfologiska artbegreppet

Vad är en art? morfologiska artbegreppet Vad är en art? Vad är en art? Du tycker kanske att det är uppenbart vad som är olika arter? En hund är en annan art än en katt det ser man ju på långt håll. De flesta arter är så pass olika att man på

Läs mer

443-419 miljoner år före nutid

443-419 miljoner år före nutid Textsammanställning till utställningen Fossil och evolution SILUR 443-419 miljoner år före nutid Stora steg Under silur utvecklas de första kärlväxterna. De är förgångare till nästan alla dagens landväxter

Läs mer

Urdjur mm. Läs sidorna: 14-17 (cell) 24 (livets utveckling) 37 (urdjur) 28-32 (bakterier) 196-197 (virus, vaccin etc) Anteckningar och stenciler

Urdjur mm. Läs sidorna: 14-17 (cell) 24 (livets utveckling) 37 (urdjur) 28-32 (bakterier) 196-197 (virus, vaccin etc) Anteckningar och stenciler Urdjur mm. Läs sidorna: 14-17 (cell) 24 (livets utveckling) 37 (urdjur) 28-32 (bakterier) 196-197 (virus, vaccin etc) Anteckningar och stenciler 1. När vi pratar om biologi, vad pratar vi om då? Ge förslag

Läs mer

Årskurs 7 - Biologi. Djurvärlden

Årskurs 7 - Biologi. Djurvärlden Årskurs 7 - Biologi Djurvärlden Allmänt Djuren är indelade i olika grupper beroende på hur nära släkt de är. Huvudgrupper Ryggradsdjur (ex, fiskar, groddjur, kräldjur, fåglar och däggdjur) Ryggradslösa

Läs mer

GODKÄND BETYGSKRITERIER BIOLOGI

GODKÄND BETYGSKRITERIER BIOLOGI BETYGSKRITERIER BIOLOGI GODKÄND Växter känna till växtens grundproblem och hur växten tacklar problemen jämfört med djuren känna till att växterna har utvecklats successivt från enkla alger till blomväxter

Läs mer

Evolution. Hur arter uppstår, lever och försvinner

Evolution. Hur arter uppstår, lever och försvinner Evolution Hur arter uppstår, lever och försvinner Aristoteles 384-322 f.kr Idéhistoria Carl von Linné 1707-1778 Georges de Buffon 1707-1788 Jean Babtiste Lamarck 1744-1829 1. Eukaryoter Tre domäner 2.

Läs mer

Cell och molekylärbiologi (BL3008) 2015-08-28 Omtentamen CMB-II (11 hp) Kod: Personnummer: Plats nr: Inlämnad kl: ID kollad: Poäng: Betyg:

Cell och molekylärbiologi (BL3008) 2015-08-28 Omtentamen CMB-II (11 hp) Kod: Personnummer: Plats nr: Inlämnad kl: ID kollad: Poäng: Betyg: STOCKHOLMS UNIVERSITET Institutionen för biologisk grundutbildning Cell och molekylärbiologi (BL3008) 2015-08-28 Omtentamen CMB-II (11 hp) Kod: Personnummer: Plats nr: Inlämnad kl: ID kollad: Poäng: Betyg:

Läs mer

Vaddå ekologisk mat?

Vaddå ekologisk mat? Vaddå ekologisk mat? Klöver i hyllorna! Vår egen miljösignal, treklövern, är inte en officiell miljömärkning, utan en vägvisare i butiken som gör det lättare för dig att hitta de miljömärkta varorna.

Läs mer

4 Svampar och lavar bra på samarbete

4 Svampar och lavar bra på samarbete 4 Svampar och lavar bra på samarbete 4.1 OH1 Svampens byggnad 1 Namnge svamparna 2 Svampexkursion och svampbestämning 3 Sporernas färg hos olika svampar 4 En svamps utveckling 5 Hur livnär sig svampar?

Läs mer

Rita ett vackert höstlöv till din text. Om du vill kan du gå ut och plocka ett.

Rita ett vackert höstlöv till din text. Om du vill kan du gå ut och plocka ett. Naturen på hösten!!!! Namn: Svara på följande frågor i ditt kladdhäfte: 1. Varför har vi olika årstider? 2. Varför har träden blad/löv? 3. Vad är fotosyntes? 4. Skriv så många hösttecken du kan! 5. Varför

Läs mer

07-03-08. Ordning i Myllret

07-03-08. Ordning i Myllret Moment Ordning i Myllret Studieplan och bedömningsgrunder i Biologi för åk 7 Bedömningsgrunder för uppnåendemålen veta att biologin är läran om det levande förstå förutsättningar för liv kunna använda

Läs mer

Ekologi. Samspelet mellan organismerna och den omgivande miljön

Ekologi. Samspelet mellan organismerna och den omgivande miljön Ekologi Samspelet mellan organismerna och den omgivande miljön Enligt kursplanen ska ni efter det här området ha kunskap i: Människans beroende av och påverkan på naturen och vad detta innebär för en hållbar

Läs mer

Rita gärna figurer där så är möjligt, för att förtydliga dina svar. Viktigt! Glöm inte att skriva tentamenskod på alla blad du lämnar in.

Rita gärna figurer där så är möjligt, för att förtydliga dina svar. Viktigt! Glöm inte att skriva tentamenskod på alla blad du lämnar in. Färg och beredning (Färg och beredning med reklamationshantering) 7,5 högskolepoäng Provmoment: Skriftlig omtentamen Ladokkod: TFB03A Tentamen ges för: TE och BC Tentamenskod: Tentamensdatum: 31 augusti

Läs mer

Simulera evolutionen Ett spel för att lära ut principerna kring evolutionen med hjälp av olika föremål.

Simulera evolutionen Ett spel för att lära ut principerna kring evolutionen med hjälp av olika föremål. bioscience explained 134567 John A. Barker Formerly of the Department of Education and Professional Studies King s College, London Simulera evolutionen Ett spel för att lära ut principerna kring evolutionen

Läs mer

Våra nordiska smådjur

Våra nordiska smådjur SKANSEN SVERIGES STÖRSTA KLASSRUM! Våra nordiska smådjur Åk4 - Åk6 Lektion på Lill-Skansen Innehåll Inledning... 1 Innan... 1 Notebook Smartboard... 1 Power Point... 1 Under lektionen.... 2 Efter lektionen...

Läs mer

Övning i bioinformatik

Övning i bioinformatik Övning: Släktträd sid 1 Övning i bioinformatik Släktträd med hjälp av databaser och program från Internet Det finns databaser som är fritt tillgängliga och innehåller nukleotid- och amino-syrasekvenser

Läs mer

Vilka pollen har högt näringsvärde för bin och pollinerande insekter? - en litteraturstudie

Vilka pollen har högt näringsvärde för bin och pollinerande insekter? - en litteraturstudie Vilka pollen har högt näringsvärde för bin och pollinerande insekter? - en litteraturstudie Ingemar Fries Ekologiska institutionen SLU, Uppsala Vilka pollen har högt näringsvärde för bin och pollinerande

Läs mer

Integrerat växtskydd SJV, Uppsala 2014 11 19. Sjukdomar i skogsplantskolor mm. Elna Stenström

Integrerat växtskydd SJV, Uppsala 2014 11 19. Sjukdomar i skogsplantskolor mm. Elna Stenström Integrerat växtskydd SJV, Uppsala 2014 11 19 Sjukdomar i skogsplantskolor mm. Elna Stenström Spridningsmöjligheter för svampsjukdomar Direkt från planta till planta; Rotkontakt, kontakt mellan barr, blad

Läs mer

Lärarhandledning och elevhäfte för högstadiet och gymnasiet

Lärarhandledning och elevhäfte för högstadiet och gymnasiet Lärarhandledning och elevhäfte för högstadiet och gymnasiet Besök Mark kommuns utställning på Kinna huvudbibliotek som pågår fram till 30 augusti. Utställningen handlar bland annat om att bin och blommor

Läs mer

Ordinarie tentamen ht 2011 för biologimomentet i Klimatförändringar orsaker och verkan.

Ordinarie tentamen ht 2011 för biologimomentet i Klimatförändringar orsaker och verkan. Ordinarie tentamen ht 2011 för biologimomentet i Klimatförändringar orsaker och verkan. Observera att a) dina svar måste vara läsbara för att du ska få poäng för dem, samt b) grafer måste ha axelbenämningar

Läs mer

men - du får inte skada stängsel och. du måste stänga grindarna efter dig.

men - du får inte skada stängsel och. du måste stänga grindarna efter dig. EKOLOGI ALLEMANSRÄTTEN I Sverige får man röra sig fritt i skog och mark. Man får också plocka svamp, bär och blommor, även om man inte äger marken som de växer på. Detta kallas för allemansrätten. Men

Läs mer

TENTAMEN HOMEOSTAS, Läk 537 T3 2 0 0 7 0 2 1 5

TENTAMEN HOMEOSTAS, Läk 537 T3 2 0 0 7 0 2 1 5 TENTAMEN HOMEOSTAS, Läk 537 T3 2 0 0 7 0 2 1 5 Namn: Personnr: - texta Max: 80 poäng KOD: Gk: 48 poäng Skrivtid: 13-18 : Läs detta först: 1. Ta det lugnt! 2. Mobiltelefoner, väskor och ytterkläder skall

Läs mer

7,5 hp. Analys och bedömning av företag och förvaltning Provmoment: Ladokkod: Tentamen ges för: TEN1 SAN023 ACEKO och SAMEK. Namn: Personnummer:

7,5 hp. Analys och bedömning av företag och förvaltning Provmoment: Ladokkod: Tentamen ges för: TEN1 SAN023 ACEKO och SAMEK. Namn: Personnummer: Analys och bedömning av företag och förvaltning Provmoment: Ladokkod: Tentamen ges för: TEN1 SAN023 ACEKO och SAMEK 7,5 hp Tentamensdatum: 2015-01-12 Tid: 09.00-13.00 Hjälpmedel: IAS 18 Intäkter IAS 32

Läs mer

GCACCACCGGCAAGCTGCCCGTGCC CTGGCCCACCCTCGTGACCACCCTGACC TACGGCGGT TGCAGTGCTTCAGCCGCTACCCCGA CCACATGAAGCAGCCGACTTCTTCAAGT CCGCCATTT -35

GCACCACCGGCAAGCTGCCCGTGCC CTGGCCCACCCTCGTGACCACCCTGACC TACGGCGGT TGCAGTGCTTCAGCCGCTACCCCGA CCACATGAAGCAGCCGACTTCTTCAAGT CCGCCATTT -35 TAGTTATTAATAGTAATCAATTACG GGGTCATTAGTTCATAGCCCATATATGG AGTTCCGCG TTACAACTTACGGTAAATGGCCGCC TGGCTGACCGCCCAACGACCCCCGCCCA TTGACGTCA ATATGACGTATGTTCCCATAGTAAC GCCAATAGGGAC TTGACA TTGACGTCAATGGGTGGAG TATAAT

Läs mer

Lill-Skansens djur. (Så fort alla djuren fotats fyller vi på) www.skansen.se

Lill-Skansens djur. (Så fort alla djuren fotats fyller vi på) www.skansen.se Lill-Skansens djur. Här presenterar vi de djur som finns inne på Lill- Skansen. För att besöket ska bli så bra som möjligt är det bra om du lär dig känna igen så många djur som möjligt. Foton: Anders Bouvin

Läs mer

Masterprogram i biologi 2015/2016

Masterprogram i biologi 2015/2016 Masterprogram i biologi 2015/2016 120 HP UPPSALA CAMPUS 100% På masterprogrammet i biologi får du en förstklassig utbildning med stor valfrihet att skapa din egen profil. Genom det stora kursutbudet inom

Läs mer

tisdag 8 oktober 13 Carl Von Linné

tisdag 8 oktober 13 Carl Von Linné Carl Von Linné Carl Von Linné Svensk Botanikprofessor. Carl Von Linné Svensk Botanikprofessor. Utformade ett taxonomi system. Carl Von Linné Svensk Botanikprofessor. Utformade ett taxonomi system. Taxonomi:

Läs mer

4.2 Vad är träd bra för?

4.2 Vad är träd bra för? AGROFORESTRY 4.2 Vad är träd bra för? Dela upp eleverna i grupper och tilldela varje grupp varsin del av trädet som de får tillverka förslagsvis i papper eller kartong. Dela upp trädet i delarna; stammen,

Läs mer

Boris flyttar in ULF SINDT

Boris flyttar in ULF SINDT Lärarmaterial SIDAN 1 Boken handlar om: En ekorrunge blir tagen, från boet, av en kråka. Ekorrungen sprattlar för att komma loss, och kråkan tappar den. Ekorren landar på trappan, utanför en familjs hus.

Läs mer

Formelsamling finns sist i tentamensformuläret. Ämnesområde Hörselvetenskap A Kurs Akustik och ljudmiljö, 7,5hp Kurskod: HÖ1004 Tentamenstillfälle 1

Formelsamling finns sist i tentamensformuläret. Ämnesområde Hörselvetenskap A Kurs Akustik och ljudmiljö, 7,5hp Kurskod: HÖ1004 Tentamenstillfälle 1 Ämnesområde Hörselvetenskap A Kurs Akustik och ljudmiljö, 7,5hp Kurskod: HÖ1004 Tentamenstillfälle 1 Datum 2011-06-01 Tid 4 timmar Kursansvarig Åsa Skagerstrand Tillåtna hjälpmedel Övrig information Resultat:

Läs mer

Karlstads universitet Samhällskunskap för lärare åk 7-9, 90 hp (1-90) Ingår i Lärarlyftet 90 högskolepoäng

Karlstads universitet Samhällskunskap för lärare åk 7-9, 90 hp (1-90) Ingår i Lärarlyftet 90 högskolepoäng Karlstads universitet Samhällskunskap för lärare åk 7-9, 90 hp (1-90) Ingår i Lärarlyftet 90 högskolepoäng Målgrupp Du som har behörighetsgivande lärarexamen och undervisar i samhällskunskap i åk 7-9 utan

Läs mer

Välkommen till vår skog!!!

Välkommen till vår skog!!! Välkommen till vår skog!!! Lär Dig mer om den svenska vildmarken och de stora rovdjuren!! Du kan hälsa på de olika rovdjurens hem och se vad de gör och äter!!!! Ha det så kul!! Lodjur Lynx lynx Hej!! Vill

Läs mer

Cellen och biomolekyler

Cellen och biomolekyler Cellen och biomolekyler Alla levande organismer är uppbyggda av celler!! En prokaryot cell, typ bakterie: Saknar cellkärna Saknar organeller En eukaryot djurcell: Har en välavgränsad kärna (DNA) Har flera

Läs mer

Provmoment: Ladokkod: Tentamen ges för:

Provmoment: Ladokkod: Tentamen ges för: Finansiell ekonomi Provmoment: Ladokkod: Tentamen ges för: Namn: (Ifylles av student) Personnummer: (Ifylles av student) Tentamensdatum: 23/8 13 Tid: 09:00 14:00 Hjälpmedel: Miniräknare SFE011 Nationalekonomi

Läs mer

EUSO 2014 Biologidel

EUSO 2014 Biologidel EUSO 2014 Biologidel Inledande individuell del (15 min) Syftet med denna del är att ställa in tankarna på det aktuella område inom biologin, samt att ge en uppfattning om kunskapsnivån. Praktiskt arbete

Läs mer

Vuxen 1. Barn 1. Vad stämmer INTE på en Tvestjärt? 1. Den kan flyga. X. Den kan simma. 2. Den kan gräva

Vuxen 1. Barn 1. Vad stämmer INTE på en Tvestjärt? 1. Den kan flyga. X. Den kan simma. 2. Den kan gräva Vuxen 1. Vad stämmer INTE på en Tvestjärt? 1. Den kan flyga X. Den kan simma 2. Den kan gräva Barn 1. Fladdermusen flyger på natten, men vad äter den? 1. Den suger blod från människor X. Sorkar och möss

Läs mer

Tiaminas och tiaminbrist i Östersjön. Svante Wistbacka Åbo Akademi

Tiaminas och tiaminbrist i Östersjön. Svante Wistbacka Åbo Akademi Tiaminas och tiaminbrist i Östersjön Svante Wistbacka Åbo Akademi Tiamin -Ett vattenlösligt vitamin i B-vitamin gruppen (vitamin B1) -Essentiell komponent i flera coenzym involverade i energimetabolismen

Läs mer

ÄSVA51, Svenska IV, GY, 30 högskolepoäng Swedish IV, 61-90 hp, for Upper Secondary School Teaching, 30 credits Grundnivå / First Cycle

ÄSVA51, Svenska IV, GY, 30 högskolepoäng Swedish IV, 61-90 hp, for Upper Secondary School Teaching, 30 credits Grundnivå / First Cycle Humanistiska och teologiska fakulteterna ÄSVA51, Svenska IV, GY, 30 högskolepoäng Swedish IV, 61-90 hp, for Upper Secondary School Teaching, 30 credits Grundnivå / First Cycle Fastställande Kursplanen

Läs mer

Kursdesign som aktiverar studenter under HELA kursen

Kursdesign som aktiverar studenter under HELA kursen Kursdesign som aktiverar studenter under HELA kursen Olle Hage Lektor ETS - Nationalekonomi Luleå tekniska universitet 971 87 Luleå Sverige 0920-49 23 36 Olle.Hage@ltu.se Bakgrund (1) A-kursen i nationalekonomi

Läs mer

Innehåll. Förord... 7. Inledning... 11. Tack... 195 Vidare läsning... 197 Illustrationer... 203 Register... 205. kapitel 1 Ursprung...

Innehåll. Förord... 7. Inledning... 11. Tack... 195 Vidare läsning... 197 Illustrationer... 203 Register... 205. kapitel 1 Ursprung... Innehåll Förord.... 7 Inledning.... 11 kapitel 1 Ursprung... 13 kapitel 2 Evolution.... 21 kapitel 3 Upptäckt... 33 kapitel 4 Miljö och civilisation... 49 kapitel 5 Bakteriell patogenes... 69 kapitel 6

Läs mer

Snabbguide till GlobalTwitcher (Juni 2012)

Snabbguide till GlobalTwitcher (Juni 2012) Snabbguide till GlobalTwitcher (Juni 2012) Denna snabbguide är avsedd att hjälpa nya medlemmer att komma igång med huvudfunktionerna på GlobalTwitcher (GT). Siten innehåller dock ett stort antal funktioner

Läs mer

Tummen upp! Matte ÅK 6

Tummen upp! Matte ÅK 6 Tummen upp! Matte ÅK 6 Tummen upp! är ett häfte som kartlägger elevernas kunskaper i förhållande till kunskapskraven i Lgr 11. PROVLEKTION: RESONERA OCH KOMMUNICERA Provlektion Följande provlektion är

Läs mer

Tentamen *:58/ID100V Programmering i C Exempel 3

Tentamen *:58/ID100V Programmering i C Exempel 3 DSV Tentamen *:58/ID100V Sid 1(5) Tentamen *:58/ID100V Programmering i C Exempel 3 Denna tentamen består av fyra uppgifter som tillsammans kan de ge maximalt 22 poäng. För godkänt resultat krävs minst

Läs mer

BIOLOGI. Susanne Fabricius Fredrik Holm Anders Nystrand

BIOLOGI. Susanne Fabricius Fredrik Holm Anders Nystrand BIOLOGI Susanne Fabricius Fredrik Holm Anders Nystrand ISBN 978-91-47-08594-1 2013 Susanne Fabricius, Fredrik Holm, Anders Nystrand och Liber AB Redaktion: Peter Larshammar Formgivare: Lotta Rennéus Bildredaktör:

Läs mer

634-541 miljoner år före nutid

634-541 miljoner år före nutid 2015 Textsammaställning till utställningen Fossil och evolution EDIACARA 634-541 miljoner år före nutid Stora steg Under ediacara dyker de första flercelliga djuren upp. I periodens slut kommer också små

Läs mer

Betygskriterier för Examensarbete, 15hp Franska C1/C3, Italienska C, Spanska C/C3

Betygskriterier för Examensarbete, 15hp Franska C1/C3, Italienska C, Spanska C/C3 Uppsala universitet Institutionen för moderna språk VT11 Betygskriterier för Examensarbete, 15hp Franska C1/C3, Italienska C, Spanska C/C3 För betyget G skall samtliga betygskriterier för G uppfyllas.

Läs mer

Provmoment: Ladokkod: Tentamen ges för:

Provmoment: Ladokkod: Tentamen ges för: Finansiell ekonomi Provmoment: Ladokkod: Tentamen ges för: Skriftlig tentamen 21FE1B Nationalekonomi 1-30 hp 7,5 högskolepoäng Namn: (Ifylles av student) Personnummer: (Ifylles av student) Tentamensdatum:

Läs mer

Genetik I. Jessica Abbott

Genetik I. Jessica Abbott Genetik I Jessica Abbott Att kunna/förstå efter föreläsningarna i genetik: DNA och RNA Packning av DNA Replikation Transkription och translation Cellcykeln Mitos och meios Översikt över genetiska verktyg

Läs mer

Grodor. Malmö Naturskola. Små grodorna, små grodorna är lustiga att se Ej öron, ej öron, ej svansar hava de

Grodor. Malmö Naturskola. Små grodorna, små grodorna är lustiga att se Ej öron, ej öron, ej svansar hava de Grodor Små grodorna, små grodorna är lustiga att se Ej öron, ej öron, ej svansar hava de Fel. Grodor har både öron och svans. Öronen sticker inte ut på kroppen som på människor men de finns där. Örat syns

Läs mer

TDDA94 LINGVISTIK, 3 poäng tisdag 19 december 2000

TDDA94 LINGVISTIK, 3 poäng tisdag 19 december 2000 Lars Ahrenberg, sid 1(5) TENTAMEN TDDA94 LINGVISTIK, 3 poäng tisdag 19 december 2000 Inga hjälpmedel är tillåtna. Maximal poäng är 36. 18 poäng ger säkert godkänt. Del A. Besvara alla frågor i denna del.

Läs mer

Provsvar: Analys av DNA från mikroorganismer i rumsdamm

Provsvar: Analys av DNA från mikroorganismer i rumsdamm Provsvar: Analys av DNA från mikroorganismer i rumsdamm Prov från Ånässkolan uttaget av Olle Wedenmark Ergo-Tek Provplatsen var 401 och provet var märkt 401. Provnummer 08-260-016. Provet togs ut 2008-02-18

Läs mer

Religion - Delta i etiska samtal, etik och moral - Vad förkunnade Jesus - Bibelkunskaper om GT - Bibelkunskaper om NT

Religion - Delta i etiska samtal, etik och moral - Vad förkunnade Jesus - Bibelkunskaper om GT - Bibelkunskaper om NT - Delta i etiska samtal, etik och moral - Vad förkunnade Jesus - Bibelkunskaper om GT - Bibelkunskaper om NT - FN:s barnkonventioner och BRIS - Hur reklamen påverkar oss - Demokratiska beslut - Tyda samhällsinformation

Läs mer

OMTENTAMEN HOMEOSTAS, Läk 537 T3

OMTENTAMEN HOMEOSTAS, Läk 537 T3 OMTENTAMEN HOMEOSTAS, Läk 537 T3 2 0 0 5 0 8 1 8 Namn: Personnr: - texta Max: 79 poäng Gk: 47 poäng Skrivtid: 8-13 : Läs detta först: 1. Ta det lugnt! 2. Mobiltelefoner, väskor och ytterkläder skall förvaras

Läs mer

Program för biologisk mångfald på motorbanor. Motorbanan som miljöresurs - Ett projekt i samarbete med Prof. Nils Ryrholm

Program för biologisk mångfald på motorbanor. Motorbanan som miljöresurs - Ett projekt i samarbete med Prof. Nils Ryrholm Program för biologisk mångfald på motorbanor Motorbanan som miljöresurs - Ett projekt i samarbete med Prof. Nils Ryrholm SVEMO:s och motorsportens miljöutmaningar SVEMO vill bidra till en hållbar utveckling

Läs mer

Lektionsupplägg: Tack för maten, naturen!

Lektionsupplägg: Tack för maten, naturen! Lektionsupplägg: Tack för maten, naturen! På vilka sätt är vi beroende av naturen och vad är ekosystemtjänster? Eleverna får i denna uppgift definiera ekosystemtjänster samt fundera på vilka tjänster vi

Läs mer

Campus Sundsvall. F alt. F(x) E D C B. 70% 35p. 80% 40p

Campus Sundsvall. F alt. F(x) E D C B. 70% 35p. 80% 40p Campus Sundsvall EKONOMISK POLITIK I EN ÖPPEN EKONOMI 7,5 hp EKONOMISK POLITIK I EN ÖPPEN EKONOMI 7,5 HP Skriftlig tentamen 2011-01-13 kl. (fem timmar) Tentamen består av sammanlagt 9 uppgifter om sammanlagt

Läs mer

Domän Eukarya. Endosymbiontteorin

Domän Eukarya. Endosymbiontteorin Bildserien visar ciliaten Ophrydium versatile. De stora ringarna markerar framdelen med cilier. De små ringarna visar en födopartikel som individen försöker fånga. Domän Eukarya En eukaryot cell är betydligt

Läs mer

Poäng. Start v. Applikationsprogramm ering i Python 7.5. Antal registrerade (män/kvinnor) 50 (34/16)

Poäng. Start v. Applikationsprogramm ering i Python 7.5. Antal registrerade (män/kvinnor) 50 (34/16) TEK/NAT Kursrapport Kurs Kurskod Poäng År Start v. Applikationsprogramm ering i Python 5DA 7.5 215 13 Institution Institutionen för datavetenskap Antal registrerade (män/kvinnor) 5 (34/16) Antal aktiva

Läs mer

Vem är släkt med vem? En inblick i systematikerns laboratorium

Vem är släkt med vem? En inblick i systematikerns laboratorium Vem är släkt med vem? En inblick i systematikerns laboratorium M änniskan har ända sedan språket utvecklades gett namn åt både djur och växter i sin omgivning. Forntidens jägare och samlare behövde berätta

Läs mer

Konsten att använda Internet som bestämningslitteratur

Konsten att använda Internet som bestämningslitteratur Konsten att använda Internet som bestämningslitteratur Av Eva Hedström Idag har de flesta av oss tillgång till dator med Internet-uppkoppling. Men hur gör man för att hitta rätt information? Oavsett om

Läs mer

Grzegorz Papaj, med illustrationer av Jacek Lilpop. Spåra evolutionen. bioscience explained Vol 4 No 2 1346. Instruktioner för spelet

Grzegorz Papaj, med illustrationer av Jacek Lilpop. Spåra evolutionen. bioscience explained Vol 4 No 2 1346. Instruktioner för spelet 1346 Grzegorz Papaj, med illustrationer av Jacek Lilpop Laboratory of Bioinformatics and Protein Engineering / Szkoła Festiwalu Nauki International Institute of Molecular and Cell Biology ul. Księcia Trojdena

Läs mer

Något om molekylära metoder inom svampsystematiken. Projektarbete av Elin Grahn Svampkunskap III Umeå, Skövde, ht-10 Handledare: Elisabeth Wiklund

Något om molekylära metoder inom svampsystematiken. Projektarbete av Elin Grahn Svampkunskap III Umeå, Skövde, ht-10 Handledare: Elisabeth Wiklund Inst för ekologi, miljö och geovetenskap Svampkunskap III, 7,5 hp Något om molekylära metoder inom svampsystematiken Projektarbete av Elin Grahn Svampkunskap III Umeå, Skövde, ht-10 Handledare: Elisabeth

Läs mer

Tentamen på kurs Makroekonomi delkurs 2, 7,5 ECTS poäng, 1NA821

Tentamen på kurs Makroekonomi delkurs 2, 7,5 ECTS poäng, 1NA821 Försättsblad Tentamen (Används även till tentamenslådan.) Måste alltid lämnas in. OBS! Eventuella lösblad måste alltid fästas ihop med tentamen. Institution Ekonomihögskolan Skriftligt prov i delkurs Makro

Läs mer

Jordbrukets tekniska utveckling.

Jordbrukets tekniska utveckling. /BOD Inläsningsfrågor i ämnet: Jordbrukets tekniska utveckling. För cirka 6000 år sedan började de första invånarna i Sverige bruka jorden. Dess för innan var de jakt och samlare. Då började de även bli

Läs mer

Biologi. Ämnesprov, läsår 2012/2013. Delprov C. Årskurs. Elevens namn och klass/grupp

Biologi. Ämnesprov, läsår 2012/2013. Delprov C. Årskurs. Elevens namn och klass/grupp Ämnesprov, läsår 2012/2013 Biologi Delprov C Årskurs 6 Elevens namn och klass/grupp Prov som återanvänds omfattas av sekretess enligt 17 kap. 4 offentlighets- och sekretesslagen. Detta prov återanvänds

Läs mer

Obstetrik, Gynekologi och Neonatologi

Obstetrik, Gynekologi och Neonatologi Obstetrik, Gynekologi och Neonatologi 8 hp Provmoment: 2 Ladokkod:62BO11 Tentamen ges för: BM06 samt studenter i fristående kurs TentamensKod: Tentamensdatum: 2012 11 09 Tid: 09.00 13.00 Hjälpmedel: Inga

Läs mer

Ekologi. organismerna och den omgivande miljön.

Ekologi. organismerna och den omgivande miljön. Ekologi Ekologi handlar mycket om växelspelet mellan organismerna och den omgivande miljön. Organismerna kan äta varandra, parasitera, samarbeta eller dra nytta av varandra. Forskning inom ekologi försöker

Läs mer

MITT I NATUREN. Uppdrag för åk f-3. Välkommen till uppdraget Mitt i naturen i Universeums utställning Vattnets väg på plan 4.

MITT I NATUREN. Uppdrag för åk f-3. Välkommen till uppdraget Mitt i naturen i Universeums utställning Vattnets väg på plan 4. MITT I NATUREN Uppdrag för åk f-3 Välkommen till uppdraget Mitt i naturen i Universeums utställning Vattnets väg på plan 4. Lärarhandledningen är till för att ge dig som lärare en möjlighet att förbereda

Läs mer

Värt att veta om mögel

Värt att veta om mögel Värt att veta om mögel Anna-Sara Claeson Institutionen för psykologi Umeå universitet Seminarium om inomhusmiljö och hälsa, Umeå 28 februari 2013 Allmänt om mikroorganismer Vad? Mögel, jäst, rötsvamp,

Läs mer

Försättsblad Tentamen

Försättsblad Tentamen Försättsblad Tentamen (Används även till tentamenslådan.) Måste alltid lämnas in. OBS! Eventuella lösblad måste alltid fästas ihop med tentamen. Institution Ekonomihögskolan Skriftligt prov i delkurs Makro

Läs mer

Farmaceutiska fakulteten Uppsala 19 mars 2013 Studievägledningen

Farmaceutiska fakulteten Uppsala 19 mars 2013 Studievägledningen Farmaceutiska fakulteten Uppsala 19 mars 2013 Studievägledningen Antagning till senare del av Apotekarprogrammet och Receptarieprogrammet för studenter med tidigare högskolestudier Farmaceutiska fakulteten

Läs mer

Kursplan - Grundläggande engelska

Kursplan - Grundläggande engelska 2012-11-02 Kursplan - Grundläggande engelska Grundläggande engelska innehåller fyra delkurser, sammanlagt 450 poäng: 1. Nybörjare (150 poäng) GRNENGu 2. Steg 2 (100 poäng) GRNENGv 3. Steg 3 (100 poäng)

Läs mer

Frågor och svar ordinarietenta Repro/utveckling VT 2012

Frågor och svar ordinarietenta Repro/utveckling VT 2012 1. Rune är drygt 70 år och har sedan en längre tid besvärats av miktionssvårigheter (dvs problem att kissa). Urinstrålen är inte längre så kraftig som när han var yngre, och ofta får han pressa på och

Läs mer

6 Djur en myllrande mångfald

6 Djur en myllrande mångfald 6 Djur en myllrande mångfald 6.1 OH1 Djurens släktträd 1 Djur finns överallt 2 Ryggrad eller inte? 3 Ägg med skal en anpassning till landliv 4 Växelvarm eller jämnvarm? 6.3 5 Snäckor och sniglar i terrarium

Läs mer

Programmering B PHP. Specialiseringen mot PHP medför att kursens kod i betygshanteringen heter PPHP1408.

Programmering B PHP. Specialiseringen mot PHP medför att kursens kod i betygshanteringen heter PPHP1408. Programmering B PHP DTR1208 - Programmering B 50 poäng Specialiseringen mot PHP medför att kursens kod i betygshanteringen heter PPHP1408. Mål Mål för kursen (Skolverket) Kursen skall ge fördjupade teoretiska

Läs mer

A - kan vara både fotosyntetiserande och kemosyntetiserande autotrofer

A - kan vara både fotosyntetiserande och kemosyntetiserande autotrofer Biologi 21.3.2012 1. Bilden visar klassificeringen av organismer. a) Ange de riken dit organismerna i punkterna A-F hör. b) Vilket särdrag är gemensamt för å ena sidan rikena A-B och å andra sidan rikena

Läs mer

Unga röster om eko. Lärarhandledning åk 4-8. På naturskyddsforeningen.se/skola hittar du allt material!

Unga röster om eko. Lärarhandledning åk 4-8. På naturskyddsforeningen.se/skola hittar du allt material! Unga röster om eko Ett skolmaterial om ekologisk odling och mat baserat på broschyren Unga röster om eko och filmen Byt till eko. På naturskyddsforeningen.se/skola hittar du allt material! Lärarhandledning

Läs mer

Dokumentet utvärderas en gång per läsår (vid internatet i juni) och uppdateras vid behov.

Dokumentet utvärderas en gång per läsår (vid internatet i juni) och uppdateras vid behov. Bilaga 1 till Utbildningsplanen Progression i skrivande, muntlig framställning, IKT och statistik i Biologprogrammet med inriktning biologisk mångfald, kommunikation och samhälle 240 hp och Biologprogrammet

Läs mer

TENTAMEN MEDICIN, MEDICINSK MIKROBIOLOGI 7,5 HP. Kurskod: MC1401. Kursansvarig: Nikolaos Venizelos (tfn: 070-255 85 20) Totalpoäng: 75

TENTAMEN MEDICIN, MEDICINSK MIKROBIOLOGI 7,5 HP. Kurskod: MC1401. Kursansvarig: Nikolaos Venizelos (tfn: 070-255 85 20) Totalpoäng: 75 TENTAMEN MEDICIN, MEDICINSK MIKROBIOLOGI 7,5 HP Kurskod: MC1401 Kursansvarig: Nikolaos Venizelos (tfn: 070-255 85 20) Datum: 2013-10-02 Skrivtid: 4 tim. Totalpoäng: 75 Poängfördelning: Nikolaos Venizelos

Läs mer

BIOLOGISK SYNTES AV PROTEIN

BIOLOGISK SYNTES AV PROTEIN UMEÅ UNIVERSITET LABORATIONSHANDLEDNING Biokemi Farmaceutisk kemi 1 Lars Backman 2011-09-09 BIOLOGISK SYNTES AV PROTEIN Utblick Våra gener innehåller all information som behövs för att tillverka en ny

Läs mer

Tentamen i Medicin B, Sjukdomslära med farmakologi del II, 2013-09-21 Kurskod MC1402 (prov 0900)

Tentamen i Medicin B, Sjukdomslära med farmakologi del II, 2013-09-21 Kurskod MC1402 (prov 0900) Tentamen i Medicin B, Sjukdomslära med farmakologi del II, 2013-09-21 Kurskod MC1402 (prov 0900) Kursansvarig: Per Odencrants Skrivtid: 4 tim Föreläsare: Torbjörn Noren, fråga 1-14, 16p. Birgitta Olsen,

Läs mer

ENGA01: Engelska grundkurs, 30 högskolepoäng Studiebeskrivning

ENGA01: Engelska grundkurs, 30 högskolepoäng Studiebeskrivning ENGA01: Engelska grundkurs, 30 högskolepoäng Studiebeskrivning Kursen består av följande delkurser vilka beskrivs nedan: Litteratur, 6 högskolepoäng Grammatik och översättning, 9 högskolepoäng Skriftlig

Läs mer

Grön Flagg Tema Närmiljö 2011-2012

Grön Flagg Tema Närmiljö 2011-2012 Grön Flagg Tema Närmiljö 2011-2012 Våra 5 mål Vi ska lära oss vad som gäller Allemansrätt Vi ska kunna hitta med hjälp av kartor och GPS Vi ska lära oss om vad man kan göra i naturen Vi ska lära oss vad

Läs mer

L iv e t s b ö r ja n

L iv e t s b ö r ja n L iv e t s b ö r ja n H u r h a r liv e t F R Ä M S T 4 O L I K A H Y P O T E S E R u p p k o m m it? S K A P E LS E TE O R IN : G U D S K A P A D E L I V U R A LS TR IN G S TE OR IN : L I V K A N U P

Läs mer

Försättsblad Tentamen

Försättsblad Tentamen Försättsblad Tentamen (Används även till tentamenslådan.) Måste alltid lämnas in. OBS! Eventuella lösblad måste alltid fästas ihop med tentamen. Institution Ekonomihögskolan, Kalmar Skriftligt prov i delkurs

Läs mer

2013-03- 28. Jordbruk är väl naturligt? Elin Röös. Enkla råd är svåra att ge. Källa: Naturvårdsverket, 2008, Konsum8onens klimatpåverkan

2013-03- 28. Jordbruk är väl naturligt? Elin Röös. Enkla råd är svåra att ge. Källa: Naturvårdsverket, 2008, Konsum8onens klimatpåverkan Jordbruk är väl naturligt? Elin Röös Enkla råd är svåra att ge Matproduktion genom tiderna Klimatpåverkan från olika sektorer Källa: Naturvårdsverket, 8, Konsum8onens klimatpåverkan 1 Växthuseffekten De

Läs mer

Områden om människokroppen. Celler

Områden om människokroppen. Celler Celler Vad är en cell? Var finns celler, hur och när upptäcktes dem? Hur många celler består en människa av. Vad finns det för olika typer av celler i människokroppen. Förklara skillnaden mellan cell,

Läs mer

Kärlekstema. vecka 11-13. inlämning: torsdag 1 april (v.13)

Kärlekstema. vecka 11-13. inlämning: torsdag 1 april (v.13) Kärlekstema vecka 11-13 inlämning: torsdag 1 april (v.13) Under några veckor kommer vi att arbeta övergripande med temat kärlek, där momenten läsa, skriva, tala, lyssna finns med. arbetsgång: Välj minst

Läs mer

KPU - studiefordringar för antagningsämnen i grundskolans årskurs 7 9 HT 14

KPU - studiefordringar för antagningsämnen i grundskolans årskurs 7 9 HT 14 Sida 1 (6) Nämnden för lärarutbildning (NLU) KPU - studiefordringar för antagningsämnen i grundskolans årskurs 7 9 HT 14 Undervisningsämne Studiefordringar för ämne I, 90 hp Studiefordringar för ämne II

Läs mer

Lärarhandledning gällande sidorna 6-27 Inledning: (länk) Läromedlet har sju kapitel: 5. Celler och bioteknik

Lärarhandledning gällande sidorna 6-27 Inledning: (länk) Läromedlet har sju kapitel: 5. Celler och bioteknik Senast uppdaterad 2012-12-09 55 Naturkunskap 1b Lärarhandledning gällande sidorna 6-27 Inledning: (länk) Celler och bioteknik C apensis Förlag AB Läromedlet har sju kapitel: 1. Ett hållbart samhälle 2.

Läs mer

ÄLTA SKOLAS LOKALA KURSPLAN

ÄLTA SKOLAS LOKALA KURSPLAN 1(12) Älta skolas mål för förskoleklass Exempel på genomförande Strävansmål mot år 2 kunna några vanliga vilda växter i Sverige kunna några vanligt förekommande tamdjur i Sverige, samt namnge deras ungar

Läs mer

Vad är ekologi? botanik

Vad är ekologi? botanik diskussionsunderlag botanik Botanik är det område inom biologin som studerar växtriket. Botanik omfattar tillväxt, reproduktion, ämnesomsättning, utveckling, sjukdomar, ekologi och evolution av växter.

Läs mer

Provmoment: Ladokkod: Tentamen ges för:

Provmoment: Ladokkod: Tentamen ges för: Finansiell ekonomi Provmoment: Ladokkod: Tentamen ges för: Namn: (Ifylles av student) Personnummer: (Ifylles av student) Tentamensdatum: 27/3 2015 Tid: 14:00 19:00 21FE1B Nationalekonomi 1-30 hp, omtentamen

Läs mer

Karbon 360-290 Ma Pangaea Kolets tidsålder De första reptilerna Groddjur dominerar Nedisning

Karbon 360-290 Ma Pangaea Kolets tidsålder De första reptilerna Groddjur dominerar Nedisning Livets utveckling på jorden - 6 Lars Holmer 2000 Föreläsning 6 Reptiler Karbon 360-290 Ma Pangaea Kolets tidsålder De första reptilerna Groddjur dominerar Nedisning SEPM 2 Perm 290-245 Ma Pangaea färdigbildad

Läs mer

Tentamen i Grundläggande programmering STS, åk 1 lördag 2002-05-25

Tentamen i Grundläggande programmering STS, åk 1 lördag 2002-05-25 Tentamen i Grundläggande programmering STS, åk 1 lördag 2002-0-2 Skrivtid: 09.00 14.00 Hjälpmedel: Inga Lärare: Anders Berglund. Elena Fersman besöker tentan vid två tillfällen: cirka kl. 10.30 samt cirka

Läs mer

Kursens mål. Ekonomihögskolan. Kunskap och förståelse. kurs/er på grundnivå som förkunskapskrav

Kursens mål. Ekonomihögskolan. Kunskap och förståelse. kurs/er på grundnivå som förkunskapskrav Ekonomihögskolan SYSA12, Informatik: Informationssystem och verksamhet, 30 högskolepoäng Informatics: Information Systems and Business, 30 credits Grundnivå / First Cycle Fastställande Kursplanen är fastställd

Läs mer

Därför är vissa träd mer värdefulla än andra

Därför är vissa träd mer värdefulla än andra Därför är vissa träd mer värdefulla än andra Projektet Värna skyddsvärda träd ska öka kunskapen om trädens värde. Sexton kommuner i Västra Götaland och Halland vill gemensamt visa hur träden är en del

Läs mer

Eko-målet. På lördag är det dags igen!!! med siktet på en hållbar utveckling. GRUNDAD 2006 NR 29 Maj 2014

Eko-målet. På lördag är det dags igen!!! med siktet på en hållbar utveckling. GRUNDAD 2006 NR 29 Maj 2014 Eko-målet med siktet på en hållbar utveckling GRUNDAD 2006 NR 29 Maj 2014 På lördag är det dags igen!!! Ekomatsligan 2013 Ludvika nu på plats 38 Våra ekologiska varor: Vetemjöl Havregryn Mjölk Filmjölk

Läs mer