Elektron-absorbtionspektroskopi för biomolekyler i UV-VIS-området

Storlek: px
Starta visningen från sidan:

Download "Elektron-absorbtionspektroskopi för biomolekyler i UV-VIS-området"

Transkript

1 Elektron-absorbtionspektroskopi för biomolekyler i UV-VIS-området Principer Koncentrationsmätning Detektion Kromoforer, kolorimetriska assays DNA Komparativ analys Proteinrening Jonbindning

2 Peptidgruppens absorbans π π* ε max 7000 n π* ε max 100

3 För proteiner: störst absorbans i regionen nm

4 Vad absorberar mer i UV hos ett protein? Trp Tyr Phe ε*10-4 för Trp: 0.5 / 280nm; Tyr: 0.1 / 280nm; Phe:0.01 / 260nm Flera aminosyrors sidokedjor absorberar < 230 nm, t ex Asp, Glu, Asn, Gln, Arg, His, men med mycket mindre ε vilket gör detektionen svår.

5 Empiriskt: Beer-Lamberts lag Andelen absorberat ljus är proportionell mot antalet absorberande molekyler -di/i = C ε dl Integrera: Med 10 som bas: ln (I 0 /I) = C ε l A (λ) = C ε (λ) l Maximal absorbtion: ε = 10 5 M -1 cm -1 (härledning i kompendiet) För en stark absorbent: ε = 10 4 M -1 cm -1 dvs 10% av allt ljus absorberas

6 Koncentrationsmätning A (λ) = ε (λ) l c Bestämning av ε : görs vanligen vid 280 nm, då beror detta främst av antalet Trp, Tyr, Phe OBS: strukturberoende! ph-beroende! HUR GÖRA?

7 Teoretisk uppskattning av extinktionskoefficienter Det är möjligt att få en god uppskattning av den molära extinktionskoefficienten från aminosyrasammansättningen vidph 6.5, 6.0 M guanidium hydrochlorid, 0.02 M fosfatbuffer, och våglängder >260 nm om proteinet innehåller tyrosin, tryptofan och/eller cystine (S-S) (cystein absorberar dåligt >260 nm) Följande ekvation används: ε(prot) = #(Tyr)* ε(tyr) + #(Trp)* ε(trp) + #(Cys)* ε(cys) Gill S.C., von Hippel P.H. "Calculation of protein extinction coefficients from amino acid sequence data." Anal. Biochem. 182: (1989).

8 MPVSASLACK NYDYDYDSIQ PYFYFDNDDFYHHQQGQT QPSAPSEDIW KKFELLPTPP LSPSRRQSLS TAEQLEMVSE FLGDDVVSQS FICDDADYSQ SFIKSIIIQD CMWSGFSAAA Number of amino acids: 120 Molecular weight: Theoretical pi: 4.01 Extinction coefficients: Extinction coefficients are in units of M -1 cm -1, at 280 nm. Ext. coefficient Abs 0.1% (=1 g/l) 1.575, assuming ALL Cys residues appear as half cystines Ext. coefficient Abs 0.1% (=1 g/l) 1.565, assuming NO Cys residues appear as half cystines Om utan W (2 st): Ext. coefficient Om utan W,Y (7 st): Ext. coefficient 1615 : 8 F inte tillräckligt!

9 Procedur för experimentell bestämning av extinktionskoefficienten: Fördelar / Nackdelar!

10 Kromoforer prostetiska grupper

11 ε*10-4 för Trp: 0.5 / 280nm; Tyr: 0.1 / 280nm; Phe:0.01 / 260nm

12 Kromoforer kan utnyttjas för att bestämma koncentrationen av biomolekyler - Specifik bindning till vissa strukturer / aminosyror - Mindre specifik bindning: massa, hydrofobicitet etc - ofta kolorimetrisk: ger en färg eller färgändring Kalibreringskurvor krävs! - Protein som liknar det analyserade

13 Analytiska assays använder ofta kromoforer: Lätt att analysera Enkel spektroskopi Billigt Kan automatiseras

14 Enkla analyser på papper/sticka

15 Lowrys metod och BCA-metoden Lowry: En molybdenförening reduceras (detektion vid 660 nm) genom koppar-katalyserad oxidation av aromater Används idag främst för analytisk bestämning av fenolhalter i livsmedel (t ex vin) Detektionsgräns 10 mikrogram protein / ml BCA: Cu2+ reduceras till Cu+ genom reaktion med peptidbindningar, Cu+ reagerar med BCA => absorbans vid 562 nm; detektionsgräns 0.5 mikrogram protein /ml

16 Bradfords metod Coomassie Brilliant Blue G-250 Absorbtionsspektrumet förändras vid inbindning till protein + Enkelt att använda, icke-toxiska reagens - Detektionsgräns 20 ug/ml - Beroende av att proteinet innehåller Arg eller Lys

17 Enzymatiska assays för detektion

18 Enzymkinetik: diagnostisk enzymologi Förutsättningar: allt i överskott utom det analyserade enzymet (PFK i detta fall)

19 Differens-spektra Buffertsubtraktion dra bort ursprungstillståndet för att se förändringen

20 Subtraktion av referensprov i spektrofotometern : dubbelstråleinstrumentet

21 Detektion upprening, isolering: känsligt! snabbt! tydligt! men kompletterande analys behövs oftast

22 Vad kan det vara för fördel/nackdel att detektera vid 220 nm?

23 Geldetektion

24 DNA: Nukleinsyrors absorbtion Varför varierar absorbansen med ph? Vid vilken våglängd är det klokt att analysera DNA-koncentration? Är det en känslig assay?

25 Konformationsberoende: duplex single strand Vilket är Enzymic digest och vilket är Native DNA?

26 DNA detekteras i UV med interkalerad EtBr

27 Komparativ analys: substansidentifiering

28 Bindningsanalyser: mätning av binding av cancerinhibitor till RNA

29 Jonbindning - zinkfingrar Med konkurrerande kromofor (i e BAPTA) Med Co 2+ istället för Zn 2+

30 Summering!

Protein en livsviktig byggsten

Protein en livsviktig byggsten Protein en livsviktig byggsten Ingvar Bosaeus Enheten för klinisk nutrition Sahlgrenska universitetssjukhuset Göteborg KSLA 2015-02-19 Aminosyra Alpha Amino- grupp Fredrik Bertz Karboxyl- grupp 20 aa

Läs mer

Biokemisk Analys och Separationsteknik

Biokemisk Analys och Separationsteknik Biokemisk Analys och Separationsteknik Human Protein Atlas Proteinlokalisation i human vävnad Förarbete Produktion och kvalitetskontroll av detektionsreagens - I detta fall antikroppar Biokemisk Analys

Läs mer

Bestämning av fluoridhalt i tandkräm

Bestämning av fluoridhalt i tandkräm Bestämning av fluoridhalt i tandkräm Laborationsrapport Ida Henriksson, Simon Pedersen, Carl-Johan Pålsson 2012-10-15 Analytisk Kemi, KAM010, HT 2012 Handledare Carina Olsson Institutionen för Kemi och

Läs mer

Rening, inmärkning och användning av ett målprotein

Rening, inmärkning och användning av ett målprotein Rening, inmärkning och användning av ett målprotein Protein A / Fc co-crystal complex Protein A domain Antibody Protein A binding Protein A domain CH 3 CH 2 Deisenhofer 1981 Upplägg av labben Framtagning

Läs mer

Proteiner 2012-10-22. Äggvitan består av proteinet ovalbumin. Farmaceutisk biokemi. Insulin är ett proteinhormon. Gly. Arg. Met. Cys. His. Gly.

Proteiner 2012-10-22. Äggvitan består av proteinet ovalbumin. Farmaceutisk biokemi. Insulin är ett proteinhormon. Gly. Arg. Met. Cys. His. Gly. Proteiner Farmaceutisk biokemi Gly Arg His Ala Lys His Met Gly Asn Pro Cys Phe Lys Maria Norlin Kjell Wikvall Insulin är ett proteinhormon Äggvitan består av proteinet ovalbumin Image: Simon Howden / FreeDigitalPhotos.net

Läs mer

Laboration v.40 Detektion av Legionella pneumophilia med nestad PCR

Laboration v.40 Detektion av Legionella pneumophilia med nestad PCR Avdelningen för kemi och biomedicin Karlstads universitet Laboration v.40 Detektion av Legionella pneumophilia med nestad PCR Frågeställning: Vattenlednings system med tillväxt av Legionella pneumophilia

Läs mer

COMPARATIVE STUDY OF HYDROLYSIS PERFORMED WITH MODERN MICROWAVE TECHNIQUE AND THE TRADITIONAL METHOD

COMPARATIVE STUDY OF HYDROLYSIS PERFORMED WITH MODERN MICROWAVE TECHNIQUE AND THE TRADITIONAL METHOD Institutionen för medicinsk biokemi och mikrobiologi Biomedicinska analytikerprogrammet Examensarbete, 15 hp COMPARATIVE STUDY OF HYDROLYSIS PERFORMED WITH MODERN MICROWAVE TECHNIQUE AND THE TRADITIONAL

Läs mer

Proteinsyntesen. Anders Liljas Biokemi och strukturbiologi Lunds universitet

Proteinsyntesen. Anders Liljas Biokemi och strukturbiologi Lunds universitet Proteinsyntesen Anders Liljas Biokemi och strukturbiologi Lunds universitet Ett fundament i proteinsyntesen är strukturen av nukleinsyror. F. Crick, J. Watson & Wilkins Nobelpris i medicin 1962 Wikipedia

Läs mer

Proteinstruktur samt Hemoglobin

Proteinstruktur samt Hemoglobin Proteinstruktur samt Hemoglobin Biochemistry Kapitel 2 Kapitel 3 Structure and Function of the Human Body Kapitel 12 Proteinstrukturer Primärstruktur - ordningen på aminosyrorna (peptidbindningen) Sekundärstruktur

Läs mer

Biologisk enfald. enheten i mångfalden. Anders Liljas Biokemi och Strukturbiologi

Biologisk enfald. enheten i mångfalden. Anders Liljas Biokemi och Strukturbiologi Biologisk enfald enheten i mångfalden Anders Liljas Biokemi och Strukturbiologi Naturen har en enorm mångfald av livsformer. I luften, på land och i vattnet Charles Darwin (1809-1882) Darwin studerade

Läs mer

Immunteknologi, en introduktion. Hur man använder antikroppar för att mäta eller detektera biologiska händelser.

Immunteknologi, en introduktion. Hur man använder antikroppar för att mäta eller detektera biologiska händelser. Immunteknologi, en introduktion Hur man använder antikroppar för att mäta eller detektera biologiska händelser. Antikroppar genereras av b-lymphocyter, som är en del av de vita blodkropparna Varje ursprunglig

Läs mer

Syra/bas och Energi Kurskod 1BA001

Syra/bas och Energi Kurskod 1BA001 Institutionen för Laboratoriemedicin Biomedicinsk analytikerutbildningen Termin 2 Syra/bas och Energi Kurskod 1BA001 Laboration: Reduktion av pyruvat med NADH Ulla Andersson Ulla.K.Andersson@ki.se 1 Arbetsplan

Läs mer

Rening av proteiner: hur och varför?

Rening av proteiner: hur och varför? Rening av proteiner: hur och varför? (och lite biologiska grunder) Joakim Norbeck! norbeck@chalmers.se! Grunder! Plasmider! Protein-rening! Detektion!!!!! Mest relevanta sidor i "Cell" är 510-518 & 532-552!

Läs mer

Proteinstruktur och Hemoglobin

Proteinstruktur och Hemoglobin Proteinstruktur och Hemoglobin Biochemistry Kapitel 2 och 3 Structure and Function of the Human Body Kapitel 12 Proteinstrukturer Primärstruktur - ordningen på aminosyrorna (peptidbindningen) Sekundärstruktur

Läs mer

Från DNA till protein, dvs den centrala dogmen

Från DNA till protein, dvs den centrala dogmen Från DNA till protein, dvs den centrala dogmen DNA RNA Protein Biochemistry, kapitel 1 5 samt kapitel 29 31. Kapitel 2 5 samt 29 31 berörs även i kommande föreläsningar. ph, kapitel 1, gås igenom i separata

Läs mer

Baljväxtakademin. Lund 18 april 2012. Nutritionist Ulla Johansson www.idunmatochnaringskonsult.se

Baljväxtakademin. Lund 18 april 2012. Nutritionist Ulla Johansson www.idunmatochnaringskonsult.se Baljväxtakademin Lund 18 april 2012 Nutritionist Ulla Johansson www.idunmatochnaringskonsult.se Baljväxter, värda sin vikt i guld? Johannesbrödsträdets grekiska namn keration har gett namn åt måttet carat,

Läs mer

Elektromagnetiska spektrumet SPEKTROSKOPI (2) UV-vis. Kromoforer. Hur analysera ofärgade ämnen? Procedur. Kemisk mätteknik CSL Analytisk kemi, KTH

Elektromagnetiska spektrumet SPEKTROSKOPI (2) UV-vis. Kromoforer. Hur analysera ofärgade ämnen? Procedur. Kemisk mätteknik CSL Analytisk kemi, KTH Elektromagnetiska spektrumet SPEKTROSKOPI (2) Kemisk mätteknik CSL Analytisk kemi, KTH UV-vis Elektronövergångar hos molekyler ger bandspektra. Kromofor, en del med dubbelbindningar. Mest som kvantitativ

Läs mer

TENTAMEN för KMB056 - Molekylär Bioteknik

TENTAMEN för KMB056 - Molekylär Bioteknik TENTAMEN för KMB056 - Molekylär Bioteknik 2013-01-15 em (V-salar) Totalt 60 poäng (Frågor 1-8: Joakim Norbeck, totalt 45 poäng; Frågor 9-12: Lisbeth Olsson, totalt 15 poäng). Betygsgränser: 30-38.5 poäng

Läs mer

Transkription och translation. DNA RNA Protein. Introduktion till biomedicin 2010-09-13. Jan-Olov Höög 1

Transkription och translation. DNA RNA Protein. Introduktion till biomedicin 2010-09-13. Jan-Olov Höög 1 Från DNA till protein, dvs den centrala dogmen DNA RNA Protein Biochemistry, kapitel 1 (delvis), kapitel 2 (ingående) samt kapitel 3 (delvis, kommer att behandlas mer) Transkription och translation Informationsflödet

Läs mer

Organisk kemi / Biokemi. Livets kemi

Organisk kemi / Biokemi. Livets kemi Organisk kemi / Biokemi Livets kemi Vecka Lektion 1 Lektion 2 Veckans lab Läxa 41 Kolhydrater Kolhydrater Sockerarter Fotosyntesen Bio-kemi 8C och D vecka 41-48 42 Kolhydrater Fetter Trommers prov s186-191

Läs mer

Riskbedömning Coomassie-infärgning av gel

Riskbedömning Coomassie-infärgning av gel Sida 1( 5) Riskbedömning Coomassie-infärgning av gel Utförd 2014-09-15 Av Charlotte Welinder på Bo Baldetorps grupp. Andrad senast 2014-09-19 Av Lars Ekblad Slutlig bedömning av hela metoden 1. Acceptabel

Läs mer

Biokemisk analys och separationsteknik VT08

Biokemisk analys och separationsteknik VT08 Biokemisk analys och separationsteknik VT08 Rening, inmärkning, analys av affinitetsliganden Z inför detektion av IgG Institutionen för Bioteknologi Kungliga Tekniska Högskolan Jesper Gantelius Marcus

Läs mer

Arbete TD5 Bestämning av transporttal

Arbete TD5 Bestämning av transporttal Arbete TD5 Bestämning av transporttal 1. INLEDNING Såväl positiva som negativa joner deltar samtidigt i transporten av ström i en elektrolytlösning. Med jonens transporttal avses den andel av den totala

Läs mer

Institutionen för laboratoriemedicin Bilaga 2 Biomedicinska analytikerprogrammet Analytisk Kemi och Biokemisk metodik Ht 2010, Termin 3

Institutionen för laboratoriemedicin Bilaga 2 Biomedicinska analytikerprogrammet Analytisk Kemi och Biokemisk metodik Ht 2010, Termin 3 Institutionen för laboratoriemedicin Bilaga 2 Biomedicinska analytikerprogrammet Analytisk Kemi och Biokemisk metodik Ht 2010, Termin 3 Laborationsdatum: 17 22 november 2010 Grupp: 2 Projekt: Rening och

Läs mer

bioscience explained Vol 2 No 2

bioscience explained Vol 2 No 2 Anders Hansson Så fungerar proteiner! Kompaktversion Grundläggande lektion Inledning -------------------------------------------- 1 Nerladdning av filer --------------------------------- 2 RasWin-----------------------------------------------

Läs mer

FluoroSpheres Kodnr. K0110

FluoroSpheres Kodnr. K0110 FluoroSpheres Kodnr. K0110 Femte upplaga Kalibreringspärlor för daglig övervakning av flödescytometer. Satsen innehåller reagenser för 40 kalibreringar. (105803-003) K0110/SE/TJU/2010.11.03 p. 1/7 Innehåll

Läs mer

Bestämning av en saltsyralösnings koncentration genom titrimetrisk analys

Bestämning av en saltsyralösnings koncentration genom titrimetrisk analys Bestämning av en saltsyralösnings koncentration genom titrimetrisk analys - Ett standardiseringsförfarande En primär standard En substans som genomgår EN reaktion med en annan reaktant av intresse. Massan

Läs mer

Koncentrationsbestämning med hjälp av spädningsteknik och spektrofotometri

Koncentrationsbestämning med hjälp av spädningsteknik och spektrofotometri Umeå universitet Biomedicinska Analytikerprogrammet Koncentrationsbestämning med hjälp av spädningsteknik och spektrofotometri Årskull: Laborationsrapport i Grundläggande laboratorievetenskap, termin 1

Läs mer

Sluttentamen Bke2/KE0003, 29:e Oktober 2003, 09 00-15 00 Max poäng = 94 p. Preliminär gräns för godkänd = 50 p (53 %).

Sluttentamen Bke2/KE0003, 29:e Oktober 2003, 09 00-15 00 Max poäng = 94 p. Preliminär gräns för godkänd = 50 p (53 %). Sluttentamen Bke2/KE0003, 29:e Oktober 2003, 09 00-15 00 Max poäng = 94 p. Preliminär gräns för godkänd = 50 p (53 %). Besvara varje fråga på separat papper! Ange tydligt längst upp på varje papper både

Läs mer

UTTAGNING TILL KEMIOLYMPIADEN 2004

UTTAGNING TILL KEMIOLYMPIADEN 2004 UTTAGNING TILL KEMILYMPIADEN 2004 TERETISKT PRV 20040323 Provet omfattar 6 uppgifter, till vilka du ska ge fullständiga lösningar, om inte annat anges. Inga konstanter ges i problemtexten. Dessa hämtas

Läs mer

GRUNDARBETEN I KEMI I

GRUNDARBETEN I KEMI I GRUNDARBETEN I KEMI I ARBETSBESKRIVNING NAMN: INLÄMNAD: GODKÄND: 2 3 ARBETE I. GASBRÄNNARE OCH LÅGREAKTIONER Resultat Undersökt förening Lågans färg Uppgifter 1. Förklara kort varför lågorna har olika

Läs mer

DNA-labb / Plasmidlabb

DNA-labb / Plasmidlabb Översikt DNA-labb Plasmidlabb Preparation och analys av -DNA från Escherichia coli Varför är vi här idag? Kort introduktion till biokemi och rekombinant DNA- teknologi Vad skall vi göra idag? Genomgång

Läs mer

Biomolekyler & Levande organismer består av celler. Kapitel 3 & 4

Biomolekyler & Levande organismer består av celler. Kapitel 3 & 4 Biomolekyler & Levande organismer består av celler Kapitel 3 & 4 Samma typer av biomolekyler i alla celler Proteiner och byggstenarna aminosyror Kolhydrater Lipider Nukleotider och nukleinsyror Dessa ämnesgrupper

Läs mer

Produkter för medfödda metabola sjukdomar

Produkter för medfödda metabola sjukdomar Produkter för medfödda metabola sjukdomar Barn och vuxna December 2011 Nutricia Nordica AB är ett nutritionsföretag med fokus på klinisk nutrition för barn och vuxna. Vår ambition är att med god service

Läs mer

Fotoelektriska effekten

Fotoelektriska effekten Fotoelektriska effekten Bakgrund År 1887 upptäckte den tyska fysikern Heinrich Hertz att då man belyser ytan på en metallkropp med ultraviolett ljus avges elektriska laddningar från ytan. Noggrannare undersökningar

Läs mer

Hållbara foder och välfärd för fisk och människa

Hållbara foder och välfärd för fisk och människa Hållbara foder och välfärd för fisk och människa Kristina Snuttan Sundell och Eva Brännäs Zoologisk institutionen och Vattenbrukscentrum Väst Göteborgs Universitet Institutionen för vilt, fisk och miljö

Läs mer

Tillämpning av olika molekylärbiologiska verktyg för kloning av en gen

Tillämpning av olika molekylärbiologiska verktyg för kloning av en gen IFM/Kemi Linköpings Universitet September 2011/LGM Projektlaboration i genteknik Tillämpning av olika molekylärbiologiska verktyg för kloning av en gen Innehållsförteckning Inledning... 3 Amplifiering

Läs mer

Proteinernas uppbyggnad, funktion och indelning. Niklas Dahrén

Proteinernas uppbyggnad, funktion och indelning. Niklas Dahrén Proteinernas uppbyggnad, funktion och indelning Niklas Dahrén Proteiner ü Namnet protein härstammar från det grekiska ordet protos som betyder den första. ü Anledningen 5ll namnet är a6 proteiner 7digt

Läs mer

VITT BRÖD MED FULLKORNSPRESTANDA!

VITT BRÖD MED FULLKORNSPRESTANDA! VITT BRÖD MED FULLKORNSPRESTANDA! The Green Bakery AB, 2007 Vad är Växtkraft? Växtkraft är ett mjöl som baseras på ett urval av biologiskt odlade spannmål av högsta kvalitet Avgörande för urvalet är näringsinnehållet

Läs mer

HEMTENTAMEN BIOKEMI 1, 6 hp 15-21 mars kl 9.00 2011 Grupp 2

HEMTENTAMEN BIOKEMI 1, 6 hp 15-21 mars kl 9.00 2011 Grupp 2 Bilaga 2 HEMTENTAMEN BIOKEMI, 6 hp 5-2 mars kl 9.00 20 Grupp 2 . a) Vid punkt (I) föreligger glycin främst i helt protoniserad form eftersom lösningens ph vid denna punkt är lägre än glycins båda pka-värden.

Läs mer

Frå n åminosyror till proteiner

Frå n åminosyror till proteiner Frå n åminosyror till proteiner Table of Contents Generellt om aminosyror... 2 Struktur och klassificering av aminosyror... 2 Alifatiska... 2 Aromatiska... 2 Polära, oladdade... 2 Positivt laddade... 2

Läs mer

Protein. Struktur. Enzymer. Transport. kanaler och pumpar PROTEINER. Hormoner. syrabasbalans. Antikroppar. Vätskebalans

Protein. Struktur. Enzymer. Transport. kanaler och pumpar PROTEINER. Hormoner. syrabasbalans. Antikroppar. Vätskebalans Proteiner Protein Struktur Transport Enzymer kanaler och pumpar PROTEINER Hormoner syrabasbalans Vätskebalans Antikroppar Proteinbehov hos idrottare Ökad muskeltillväxt, både b styrkeidrotter och uthållighet

Läs mer

Översättning från Tyska av utlåtande nr 421-433938/02 från TÜV angående Clouth-OIL-EX. Sidan 2 (7) Institut für Umweltschutz und Energietechnik

Översättning från Tyska av utlåtande nr 421-433938/02 från TÜV angående Clouth-OIL-EX. Sidan 2 (7) Institut für Umweltschutz und Energietechnik Översättning från Tyska av utlåtande nr 421-433938/02 från TÜV angående Clouth-OIL-EX. Sidan 2 (7) TÜV Rheinland Sicherheit und Umweltschutz Institut für Umweltschutz und Energietechnik Institut für Umweltschutz

Läs mer

Insulin. Kod nr. K6219. En enzymimmunoassay för kvantitativ mätning av insulin i humana kliniska prov. Kitet innehåller reagens till 96 testbrunnar.

Insulin. Kod nr. K6219. En enzymimmunoassay för kvantitativ mätning av insulin i humana kliniska prov. Kitet innehåller reagens till 96 testbrunnar. Insulin Kod nr. K6219 En enzymimmunoassay för kvantitativ mätning av insulin i humana kliniska prov. Kitet innehåller reagens till 96 testbrunnar. (106017-006) K6219/SE/CKJ/2009.06.17 s. 1/16 1 AVSEDD

Läs mer

Rättningsmall fråga 1: a) b) mellan N och Ca (0.5p); Ca och C (0.5p). c) vid ph 5: NH 3 + ------ COOH (0.5p); vid ph 9: NH 2 ------ COO - (0.

Rättningsmall fråga 1: a) b) mellan N och Ca (0.5p); Ca och C (0.5p). c) vid ph 5: NH 3 + ------ COOH (0.5p); vid ph 9: NH 2 ------ COO - (0. Tentamen Bke1, 10p, 25e Maj 1999. Riktmärke för godkänt 50% (53p av totalt 106 möjliga). Börja svara på varje fråga på ett nytt papper (detta underlättar rättningen av skrivningarna)! Glöm ej kodnummer

Läs mer

Differensen mellan EU:s import och export i areal 39 M Ha

Differensen mellan EU:s import och export i areal 39 M Ha Differensen mellan EU:s import och export i areal 39 M Ha Differensen består av Fodergrödor m.a.o soja Här tröskas soja Soja-importen till EU Är värd 200 Miljarder kr per år vilket är en kostnad för jordbruket

Läs mer

Cellen och biomolekyler

Cellen och biomolekyler Cellen och biomolekyler Alla levande organismer är uppbyggda av celler!! En prokaryot cell, typ bakterie: Saknar cellkärna Saknar organeller En eukaryot djurcell: Har en välavgränsad kärna (DNA) Har flera

Läs mer

Omtentamen Läkarutbildningen T1:B höstterminen 2012 1(21) 2013-02-04 Kurskod: 8LAG10

Omtentamen Läkarutbildningen T1:B höstterminen 2012 1(21) 2013-02-04 Kurskod: 8LAG10 Omtentamen Läkarutbildningen T1:B höstterminen 2012 1(21) Jill Sandberg, 24 år, är frisk och lever sedan flera år i ett fast förhållande. Hon är normalviktig och fick mens första gången när hon var drygt

Läs mer

PRODUKTER. Distributors of Ultimate Nutrition Sweden and Finland.

PRODUKTER. Distributors of Ultimate Nutrition Sweden and Finland. PRODUKTER ULTIMATE N AMINO ACIDS ULTIMATE NUTRITION AMINO2002 100tabs 532014-020 Neutral 330tabs 532015-020 Neutral Rena aminosyror i en lättupptaglig form. Perfekt för dig som inte gillar proteindrinkar.

Läs mer

Biogasanläggning Energibesparing med avloppsvatten. 2008-09-05 Peter Larsson ver 2

Biogasanläggning Energibesparing med avloppsvatten. 2008-09-05 Peter Larsson ver 2 Biogasanläggning Energibesparing med avloppsvatten 2008-09-05 Peter Larsson ver 2 Biogasanläggning Förutsättningar Processprincip Processparametrar Driftprincip och anläggningsutförande Biogas Anläggningskostnad

Läs mer

BIOLOGISKA TESTMETODER

BIOLOGISKA TESTMETODER Emma Larsson 831230 6221 Biologiskt aktiva naturprodukter i läkemedelsutveckling, 5p, HT 2007 Inst. F. Läkemedelskemi, avd. f. Farmakognosi Uppsala Universitet BIOLOGISKA TESTMETODER In vivo vs. in vitro

Läs mer

tisdag 8 oktober 13 Carl Von Linné

tisdag 8 oktober 13 Carl Von Linné Carl Von Linné Carl Von Linné Svensk Botanikprofessor. Carl Von Linné Svensk Botanikprofessor. Utformade ett taxonomi system. Carl Von Linné Svensk Botanikprofessor. Utformade ett taxonomi system. Taxonomi:

Läs mer

UPDATE HÖST 2015. DeNovix ny leverantör Spektrofotometer och fluorometer i samma instrument Sidan 3

UPDATE HÖST 2015. DeNovix ny leverantör Spektrofotometer och fluorometer i samma instrument Sidan 3 HÖST 2015 UPDATE DeNovix ny leverantör Spektrofotometer och fluorometer i samma instrument Sidan 3 Azure Imagingsystem Detektion av kemiluminiscens: Dags att avskaffa mörkerrummet Sidan 4 - på reningsmetoder

Läs mer

Analytisk kemi och Biokemisk metodik, 7.5hp

Analytisk kemi och Biokemisk metodik, 7.5hp Institutionen för Laboratoriemedicin Biomedicinska Analytikerprogrammet Analytisk kemi och Biokemisk metodik, 7.5hp Laborationer Simuleringsprogram för T3 HT 2010 ADRESS BESÖKSADRESS TELEFON Karolinska

Läs mer

UTTAGNING TILL KEMIOLYMPIADEN 2013 TEORETISKT PROV nr 1. Läkemedel

UTTAGNING TILL KEMIOLYMPIADEN 2013 TEORETISKT PROV nr 1. Läkemedel UTTAGNING TILL KEMIOLYMPIADEN 2013 TEORETISKT PROV nr 1 Provdatum: torsdagen den 15 november Provtid: 120 minuter Hjälpmedel: Räknare, tabell- och formelsamling. Redovisning görs på svarsblanketten som

Läs mer

GCACCACCGGCAAGCTGCCCGTGCC CTGGCCCACCCTCGTGACCACCCTGACC TACGGCGGT TGCAGTGCTTCAGCCGCTACCCCGA CCACATGAAGCAGCCGACTTCTTCAAGT CCGCCATTT -35

GCACCACCGGCAAGCTGCCCGTGCC CTGGCCCACCCTCGTGACCACCCTGACC TACGGCGGT TGCAGTGCTTCAGCCGCTACCCCGA CCACATGAAGCAGCCGACTTCTTCAAGT CCGCCATTT -35 TAGTTATTAATAGTAATCAATTACG GGGTCATTAGTTCATAGCCCATATATGG AGTTCCGCG TTACAACTTACGGTAAATGGCCGCC TGGCTGACCGCCCAACGACCCCCGCCCA TTGACGTCA ATATGACGTATGTTCCCATAGTAAC GCCAATAGGGAC TTGACA TTGACGTCAATGGGTGGAG TATAAT

Läs mer

Kinetik. Föreläsning 1

Kinetik. Föreläsning 1 Kinetik Föreläsning 1 Varför kunna kinetik? För att till exempel kunna besvara: Hur lång tid tar reaktionen till viss omsättningsgrad eller hur mycket produkt bildas på viss tid? Hur ser reaktionens temperaturberoende

Läs mer

Hur påverkar valet av analysmetod för metaller i jord min riskbedömning?

Hur påverkar valet av analysmetod för metaller i jord min riskbedömning? Hur påverkar valet av analysmetod för metaller i jord min riskbedömning? Anja Enell och David Bendz, SGI På säker grund för hållbar utveckling Syfte med presentationen En sammanställning av vilka metoder

Läs mer

Estelle Larsson Membrane Extraction Group Division of Organic Chemistry 9/16/2010 1

Estelle Larsson Membrane Extraction Group Division of Organic Chemistry 9/16/2010 1 Inspirationsföreläsning KEMA00 Om nyttan av att kunna kemi när man arbetar med miljöfrågor 9/16/2010 1 Estelle Larsson Doktorand i miljövetenskap med inriktning mot analytisk kemi 9/16/2010 2 Min forskning

Läs mer

Biokemisk och immunologisk karaktärisering av pepsin-spjälkade mjölkallergener

Biokemisk och immunologisk karaktärisering av pepsin-spjälkade mjölkallergener UPTEC X 13 020 Examensarbete 30 hp Augusti 2013 Biokemisk och immunologisk karaktärisering av pepsin-spjälkade mjölkallergener Kristoffer Jonasson Molecular Biotechnology Programme Uppsala University

Läs mer

Användning av kol och energikällor

Användning av kol och energikällor Bio 2. Biokemiska reaktioner och metabolism Liv Föröka sig, överföra information, energi från näringsmolekyler, anpassa sig till omgivningen För att leva och fortleva behöver cellen Kopiera och uttrycka

Läs mer

Solens energi alstras genom fusionsreaktioner

Solens energi alstras genom fusionsreaktioner Solen Lektion 7 Solens energi alstras genom fusionsreaktioner i dess inre När solen skickar ut ljus förlorar den också energi. Det måste finnas en mekanism som alstrar denna energi annars skulle solen

Läs mer

3 Håret ser genast friskare ut och omedelbart i bättre kondition. Ett långvarigt skydd slätar ut fjällskiktet och skyddar mot ytterligare skador.

3 Håret ser genast friskare ut och omedelbart i bättre kondition. Ett långvarigt skydd slätar ut fjällskiktet och skyddar mot ytterligare skador. I århundraden har Hawaiis urinvånare använt den väldoftande fruktjuicen från ingefärsplantan Awapuhi för att ge fukt åt hår och hud. Förtrollade av plantans välgörande ämnen, etablerade John Paul DeJoria

Läs mer

Info r prov i cellbiologi Biologi B

Info r prov i cellbiologi Biologi B Info r prov i cellbiologi Biologi B 1. Samma typer av biomolekyler i alla celler s.23-28, 30 a. Lipider, hur det är byggda och egenskaper. Miceller. - Lipider = ej vattenlösliga, fetter och fettliknande

Läs mer

Energi, katalys och biosyntes (Alberts kap. 3)

Energi, katalys och biosyntes (Alberts kap. 3) Energi, katalys och biosyntes (Alberts kap. 3) Introduktion En cell eller en organism måste syntetisera beståndsdelar, hålla koll på vilka signaler som kommer utifrån, och reparera skador som uppkommit.

Läs mer

Apotekarprogrammet i Göteborg KBT210 - galenisk farmaci 15 hp, 1(7) Excel-övning 0 Litteratursökning med datorns hjälp

Apotekarprogrammet i Göteborg KBT210 - galenisk farmaci 15 hp, 1(7) Excel-övning 0 Litteratursökning med datorns hjälp Apotekarprogrammet i Göteborg KBT210 - galenisk farmaci 15 hp, 1(7) Om Excel-övningarna Övningarna i Excel är inte avsedda att vara en nybörjarkurs utan syftar till att träna upp användningen av Excel

Läs mer

Life Science Special. Realtidsanalys av celler. Nya minibioreaktorer! On-line mätning av glukos i bioreaktorer. Säker frysförvaring i gasfas av celler

Life Science Special. Realtidsanalys av celler. Nya minibioreaktorer! On-line mätning av glukos i bioreaktorer. Säker frysförvaring i gasfas av celler Realtidsanalys av celler Sid 2-3 Nya minibioreaktorer! Sid 5 On-line mätning av glukos i bioreaktorer Sid 6 Säker frysförvaring i gasfas av celler Sid 9 KingFisher - DNA/RNA rening med magnetkulor Sid

Läs mer

Förekomst och rening av prioriterade ämnen, metaller samt vissa övriga ämnen i dagvatten

Förekomst och rening av prioriterade ämnen, metaller samt vissa övriga ämnen i dagvatten Svenskt Vatten Utveckling - Rapport Nr 2010-06 Förekomst och rening av prioriterade ämnen, metaller samt vissa övriga ämnen i dagvatten Henrik Alm, Agata Banach, Thomas Larm 1 Motiven bakom vattenpolitiken

Läs mer

5. Transkriptionell reglering OBS! Långsam omställning!

5. Transkriptionell reglering OBS! Långsam omställning! Reglering: 1. Allosterisk reglering Ex. feedbackinhibering en produkt i en reaktionssekvens inhiberar ett tidigare steg i samma sekvens 2. Olika isoformer i olika organ 3. Kovalent modifiering Ex. fosforylering

Läs mer

OBS: Alla mätningar och beräknade värden ska anges i SI-enheter med korrekt antal värdesiffror. Felanalys behövs endast om det anges i texten.

OBS: Alla mätningar och beräknade värden ska anges i SI-enheter med korrekt antal värdesiffror. Felanalys behövs endast om det anges i texten. Speed of light OBS: Alla mätningar och beräknade värden ska anges i SI-enheter med korrekt antal värdesiffror. Felanalys behövs endast om det anges i texten. 1.0 Inledning Experiment med en laseravståndsmätare

Läs mer

ETT EXEMPEL PÅ PROTEINKRISTALLISERING

ETT EXEMPEL PÅ PROTEINKRISTALLISERING KRISTLLISERING V LYSOZYM ETT EXEMPEL PÅ PROTEINKRISTLLISERING Laboration i kursen Experimentell Kemi Gävle 15:e augusti 2013 Handledare: nna Frick, Göteborgs Universitet (anna.frick@chem.gu.se) KRISTLLISERING

Läs mer

Clear Magic Ultra Lågabsorberande Lins

Clear Magic Ultra Lågabsorberande Lins Duralens - Högkvalitativ Lins Absorberar 0,0% Konstruerad för hög hållbarhet och noggrannhet Tillverkad med högsta precision Godkänd och använd av ledande maskintillverkare Black Magic Lågabsorberande

Läs mer

Tentamen i Fotonik - 2013-04-03, kl. 08.00-13.00

Tentamen i Fotonik - 2013-04-03, kl. 08.00-13.00 FAFF25-2013-04-03 Tentamen i Fotonik - 2013-04-03, kl. 08.00-13.00 FAFF25 - Fysik för C och D, Delkurs i Fotonik Tillåtna hjälpmedel: Miniräknare, godkänd formelsamling (t ex TeFyMa), utdelat formelblad.

Läs mer

EXPERIMENTELLT PROV 2008-03-12

EXPERIMENTELLT PROV 2008-03-12 EXPERIMENTELLT PROV 2008-03-12 Provet omfattar en uppgift, som redovisas enligt anvisningarna. Provtid: 180 minuter. Hjälpmedel: Miniräknare. OBS! EJ tabell- och formelsamling. Lämna en marginal om minst

Läs mer

VIKTIGT ATT DU FYLLER I DETTA PÅ SAMTLIGA SIDOR SOM LÄMNAS IN!

VIKTIGT ATT DU FYLLER I DETTA PÅ SAMTLIGA SIDOR SOM LÄMNAS IN! 1 1. Vilken elektronkonfiguration har kväve? What is the ground-state electronic configuration of nitrogen? 1s 2 2s 2 2p x 2p y 2p z 1s 2 2s 2 2p 4 1s 2 2s 2 2p 2 1s 2 2s 2 2p 6 E 1s 2 2s 2 2p 2 x 2p 2

Läs mer

1. a) Förklara, genom användning av något lämpligt kemiskt argument, varför H 2 SeO 4 är en starkare syra än H 2 SeO 3.

1. a) Förklara, genom användning av något lämpligt kemiskt argument, varför H 2 SeO 4 är en starkare syra än H 2 SeO 3. Lösning till tentamen 2008 12 15 för Grundläggande kemi 10 hp Sid 1(5) 1. a) Förklara, genom användning av något lämpligt kemiskt argument, varför H 2 SeO 4 är en starkare syra än H 2 SeO 3. b) Beräkna

Läs mer

Molekylärbiologisk diagnostik av tarmparasiter

Molekylärbiologisk diagnostik av tarmparasiter Molekylärbiologisk diagnostik av tarmparasiter Vad, När, Var och Hur? Jessica Ögren Länssjukhuset Ryhov Juni 2012 Molekylärbiologiska metoder De senaste två decennierna har molekylärbiologiska tekniker

Läs mer

UTTAGNING TILL KEMIOLYMPIADEN 2005

UTTAGNING TILL KEMIOLYMPIADEN 2005 UTTAGNING TILL KEMIOLYMPIADEN 005 TEORETISKT PROV 005-0-14 Provet omfattar 6 uppgifter, till vilka du ska ge fullständiga lösningar, om inte annat anges. Konstanter som inte ges i problemtexten, hämtas

Läs mer

Citronsyracykelns reaktioner sker i mitokondriematrix. Mitokondrierna kan sägas vara cellens kraftstationer p g a den stora produktionen av ATP.

Citronsyracykelns reaktioner sker i mitokondriematrix. Mitokondrierna kan sägas vara cellens kraftstationer p g a den stora produktionen av ATP. CITRONSYRACYKELN: Krebscykeln Trikarboxylsyrecykeln Citronsyracykelns reaktioner sker i mitokondriematrix. Mitokondrierna kan sägas vara cellens kraftstationer p g a den stora produktionen av ATP. Mitokondrierna

Läs mer

530117 Materialfysik vt 2014. 3. Materials struktur 3.8 Biomaterials struktur. [Mitchell 1.5, Poole-Owens: Introduction to Nanotechnology mm.

530117 Materialfysik vt 2014. 3. Materials struktur 3.8 Biomaterials struktur. [Mitchell 1.5, Poole-Owens: Introduction to Nanotechnology mm. 530117 Materialfysik vt 2014 3. Materials struktur 3.8 Biomaterials struktur [Mitchell 1.5, Poole-Owens: Introduction to Nanotechnology mm.] Biomaterial Med biomaterial avses material som Är en del av

Läs mer

Vilka pollen har högt näringsvärde för bin och pollinerande insekter? - en litteraturstudie

Vilka pollen har högt näringsvärde för bin och pollinerande insekter? - en litteraturstudie Vilka pollen har högt näringsvärde för bin och pollinerande insekter? - en litteraturstudie Ingemar Fries Ekologiska institutionen SLU, Uppsala Vilka pollen har högt näringsvärde för bin och pollinerande

Läs mer

Utveckling av Laser- och Ultraljudsbaserade metoder för förbättrad processövervakning. Tania Irebo tania.irebo@swerea.se

Utveckling av Laser- och Ultraljudsbaserade metoder för förbättrad processövervakning. Tania Irebo tania.irebo@swerea.se Utveckling av Laser- och Ultraljudsbaserade metoder för förbättrad processövervakning Tania Irebo tania.irebo@swerea.se Innehåll Vad vi gör på APMO (Analytisk Processövervakning) - våra tekniker : LUS,

Läs mer

Gauss Linsformel (härledning)

Gauss Linsformel (härledning) α α β β S S h h f f ' ' S h S h f S h f h ' ' S S h h ' ' f f S h h ' ' 1 ' ' ' f S f f S S S ' 1 1 1 S f S f S S 1 ' 1 1 Gauss Linsformel (härledning) Avbilding med lins a f f b Gauss linsformel: 1 a

Läs mer

Molekylärgenetiskt verktyg för diagnos av T- resp. B-cellslymfom i vävnad/paraffin Diagnostik av Lymfom. Olika ingångar för B-, resp. T-cellslymfom Metodiker: - Morfologi (Mikroskopi) - Immunohistokemi

Läs mer

Tentamen i Fotonik - 2014-04-25, kl. 08.00-13.00

Tentamen i Fotonik - 2014-04-25, kl. 08.00-13.00 FAFF25-2014-04-25 Tentamen i Fotonik - 2014-04-25, kl. 08.00-13.00 FAFF25 - Fysik för C och D, Delkurs i Fotonik Tillåtna hjälpmedel: Miniräknare, godkänd formelsamling (t ex TeFyMa), utdelat formelblad.

Läs mer

UTTAGNING TILL KEMIOLYMPIADEN 2001

UTTAGNING TILL KEMIOLYMPIADEN 2001 UTTAGNING TILL KEMIOLYMPIADEN 2001 TEORETISKT PROV 2001-04-03 Provet omfattar 6 uppgifter, till vilka du ska ge fullständiga lösningar, om inte annat anges. Du får poäng för korrekt löst deluppgift, även

Läs mer

TENTAMEN för KMB056 - Molekylär Bioteknik

TENTAMEN för KMB056 - Molekylär Bioteknik TENTAMEN för KMB056 - Molekylär Bioteknik 2012-10-23 em (V-salar) Totalt 60 poäng (Frågor 1-9: Joakim Norbeck, totalt 45 poäng; Frågor 10-11: Lisbeth Olsson, totalt 15 poäng). Betygsgränser: 30 poäng =

Läs mer

Pilottest av mikrobiell nedbrytning 2012 2014

Pilottest av mikrobiell nedbrytning 2012 2014 Pilottest av mikrobiell nedbrytning 2012 2014 Teori Försöksuppställning Erfarenheter På säker grund för hållbar utveckling Samverkansprojekt mellan SGI, SGU, Alingsås kommun och Alingsås Tvätteri Teori

Läs mer

få se en naturvetenskaplig forskningsmiljö och träffa människorna i den miljön.

få se en naturvetenskaplig forskningsmiljö och träffa människorna i den miljön. Martin Andersson 780920-1978 Kurs 3, Professionen Lärarutbildningen Malmö högskola NO-relaterat studiebesök Jag tänkte att mina gymnasieelever skulle få göra ett studiebesök på en universitetsavdelning

Läs mer

KI Biobank Tjänstekatalog

KI Biobank Tjänstekatalog KI Biobank Tjänstekatalog Version: 1, 2011 KI Biobank är en core facilitet som erbjuder service för provinsamling, provförvaring och provdistribution. Innehåll KI Biobank...4 Kontakt...4 Öppettider...4

Läs mer

BASÅRET KEMI B BIOKEMI VT 2012. GENETISK INFORMATION 191-210 (sid. 157-177)

BASÅRET KEMI B BIOKEMI VT 2012. GENETISK INFORMATION 191-210 (sid. 157-177) BASÅRET KEMI B BIOKEMI GENETISK INFORMATION 191-210 (sid. 157-177) DNA/RNA, Transkription, Translation VAR I CELLEN SKER DETTA? Replikation - kopiering av DNA, sker i cellkärnan Transkription - avläsa

Läs mer

Cyanocobalamin, B12. Shahed Humam. Farmakognosi, biologisk aktiva naturprodukter i läkemedelsutveckling 7,5 hp. Uppsala universitet

Cyanocobalamin, B12. Shahed Humam. Farmakognosi, biologisk aktiva naturprodukter i läkemedelsutveckling 7,5 hp. Uppsala universitet Cyanocobalamin, B12 Farmakognosi, biologisk aktiva naturprodukter i läkemedelsutveckling 7,5 hp Uppsala universitet Shahed Humam 1 Sammanfattnig: Vitamin B12 förekommer naturligt i livsmedel, främst lever,

Läs mer

Minican resultatöversikt juni 2011

Minican resultatöversikt juni 2011 Sidan av Minican resultatöversikt juni Sammanställt från arbetsmaterial SKBModelCanisterProgressReport Dec_Issue -4-7 MINICAN microbe report Claes Taxén Siren Bortelid Moen Kjell Andersson Översikt över

Läs mer

Torskolan i Torsås Mars 2007. Matematik. Kriterier för betyget godkänd. Metoder: Arbetssätt. Muntligt. Problemlösning

Torskolan i Torsås Mars 2007. Matematik. Kriterier för betyget godkänd. Metoder: Arbetssätt. Muntligt. Problemlösning Torskolan i Torsås Mars 2007 Matematik Kriterier för betyget godkänd Metoder: Arbetssätt Ta ansvar för sin egen inlärning. Göra läxor. Utnyttja lektionstiden (lyssna, arbeta). Utnyttja den hjälp/stöd som

Läs mer

Detektionens roll i det totala brandskyddskonceptet Miljön i tunnlarna Schakt Längd(-er) på tunnlar

Detektionens roll i det totala brandskyddskonceptet Miljön i tunnlarna Schakt Längd(-er) på tunnlar Detektion i kabel- och energidistributionstunnlar Lämplig lösning beror på Detektionens roll i det totala brandskyddskonceptet Miljön i tunnlarna Schakt Längd(-er) på tunnlar Sid 1 Detektionens roll i

Läs mer

Prislista. Fasta bränslen och askor

Prislista. Fasta bränslen och askor Prislista Fasta bränslen och askor 0 I dagens energi- och miljömedvetna samhälle blir det allt viktigare att använda effektiva biobränslen i väl fungerande pannor. Likväl finns det stora miljövinster om

Läs mer

Studieplan och bedömningsgrunder i Matematik för åk 7 Moment Bedömningsgrunder för uppnåendemålen Begreppsbildning Tal och räkning

Studieplan och bedömningsgrunder i Matematik för åk 7 Moment Bedömningsgrunder för uppnåendemålen Begreppsbildning Tal och räkning Moment Begreppsbildning Mätningar och enheter Algebra och ekvationer Studieplan och bedömningsgrunder i Matematik för åk 7 Bedömningsgrunder för uppnåendemålen känna igen naturliga tal kunna positiva heltal:

Läs mer

Rubella-IgM-ELA Test PKS medac. Svenska

Rubella-IgM-ELA Test PKS medac. Svenska RubellaIgMELA Test PKS medac Enzym immunoassay med PipetteringsKontrollSystem (PKS) för detektion av IgMantikroppar mot rubellavirus (röda hund) Svenska 0123 135PKSVPSW/111104 TILLVERKARE medac Gesellschaft

Läs mer

PRELIMINÄRA FÖRELÄSNINGSDISPOSITIONER Cellens Byggstenar och Livets Molekyler

PRELIMINÄRA FÖRELÄSNINGSDISPOSITIONER Cellens Byggstenar och Livets Molekyler Medicinsk biokemi och biofysik Cellens struktur och funktion (CSOF) Avsnitt 1, Cellens byggstenar och livets molekyler VT07 PRELIMINÄRA FÖRELÄSNINGSDISPOSITIONER Cellens Byggstenar och Livets Molekyler

Läs mer

dricksvattenberedningen

dricksvattenberedningen Norovirus och andra magtarmsjukevirus i dricksvattenberedningen kan det innebära en risk idag eller imorgon? Fredrik Nyström, Erik Dalin & Per-Eric Lindgren Institutionen för klinisk och experimentell

Läs mer