Nya tider i hästaveln Gentester och genomisk selektion Sofia Mikko, HGEN Hippos avelsdagar 2018, Rovaniemi 22 mars 2018
The genome of the horse Sofia Mikko, HGEN Hippos avelsdagar 2018, Rovaniemi 22 mars 2018
Whole genome sequencing of the horse genome All nucleotides along the chromosmes are detected 2,680,000,000 nucleotides (2,68 Gbp) 20,000 protein coding genes Each individual has a unique DNAsequence Mutation = SNP Mutations create genetic variation and can be used as markers along the chromosomes Twilight var den första hästen aom sekvenserades Foto: NHGRI
The horse has 64 chromosomes = genome Exon Gene Intron Exon Foto: Terje Raudsepp TTGTTCAAATCAGTGTCCAAAT TTGTTCAAATCAGGGTCCAAAT Single Nucleotide Polymorphism(SNP) = mutation
Markers are analyzed on a SNP-chip Show genetic variation between individuals 50 000-670 000 markers per chip I.e. one marker each 4 000 to 40 000 nucleotide Genetic fingerprint"
Association study (GWAS) ee Ee eller EE
Association study (GWAS) Chestnut (ECA3) Black (ECA22) Grey(ECA25) Molly E. McCue et al. PLoS Genetics 2012
Petersen et al. 2013
Chromosome regions selected for performance The chromosome region comprise many candidate genes
Breed phylogeny Nordic Iberian Asian Middle East Draft & UK Sport horses USA Petersen et al. 2013
Inbreeding coefficient (F) Molly E. McCue et al. PLoS Genetics 2012
Inbreeding at DNA-level Kardos et al. 2017
Inbreeding at DNA-level Kardos et al. 2017
Outcrossing Old breeds Large population Crossbreeds Large phenotypic variation Low selektion pressure Inbreeding Modern breeds Small population Closed studbook Small phenotypic variation High selektion pressure
Breeding for performance Sofia Mikko, HGEN Hippos avelsdagar 2018, Rovaniemi 22 mars 2018
Breeding for performance How can we produce even better performing horses? What is the next step? New genomic methods! Coreograph (SWB) Foto: Carin Wrange
Coreographs blaze is inherited Balou du Rouet Balougraph Coreograph
Coreographs blaze is inherited Balou du Rouet Balougraph Coreograph so does the performance traits
Horse breeding today Traditional selection Breeders own choice Studbooks breeding goal Breeding value (EBV/BLUP) Support for traditional selection Pedigree + Young Horse Test + Competition data Statistical measument of the genetic component Foto: Sofia Mikko
Define the performance trait! Sustainability/health Conformation Temperament Ridability Jumping capacity Contant Q 1203 och Arnold Assarsson. Foto: Maria Håkansson. Jumping technique Dressage capacity Gaits Coreograph (SWB) Foto: Carin Wrange Cohinoor (SWB) Foto: Henrik Mikko
Selection of one trait Before selection Efter selektion Selekterad kromosomregion
Selection of one trait Before selection After selection => Fast breeding gain Selected chromosome region
Selection of two traits Before selection Efter selektion Selekterad kromosomregion
Selection of two traits Before selection After selection => Slower breeding gain Selected chromosome region
Longest shared ROHs in SWB and Exmoor SWB Exmoor
Different kinds of selection Marker assisted selection Genomic selection Few markers but each with large effect Markers with small effect are ignored Select on a small part of the chromosome Coat colours, trot-/pace gene, disease genes, etc Each marker has a small effect The sum of all markers Select on the whole genome Multifactorial traits Show jumping, t.ex. scope, dressage, eg. length of stride, temperament, conformation, etc
Genomic selection in horse breeding (GEBVs) >5000 individuals from young horse tests Reference population Linear description + DNA-markers A genetic fingerprint predicts what markers, i.e. chromosome regions, are linked to what trait
Genomic selection in horse breeding (GEBVs) >5000 individuals from young horse tests Reference population Closely related Selektions kandidater Foals Linear description + DNA-markers DNA markers A genetic fingerprint predicts what markers, i.e. chromosome regions, are linked to what trait
Genomic selection in horse breeding (GEBVs) >5000 individuals from young horse tests Reference population Closely related Selektions kandidater Foals Linear description + DNA-markers DNA markers A genetic fingerprint predicts what markers, i.e. chromosome regions, are linked to what trait Utvalda avels individer GEBVs fascilitates selection of the best breeding stock already at young age
Genomic selection in practice Cons: Reference population of at least 5000 horses Reference population Update regularily Phenotyping is crucial Constant environment Pros: Traits with low heratibility, eg. leg conformation Traits that are difficult to measure eg. ridablilty Traits expressed late in life eg. performance in competion Traits expressed in only one sex, eg. scrotal hernia Reduced risk of inbreeding (?) Shorter generation interval Faster breeding gain Coreograph (SWB) Foto: Sofia Mikko
How correct are gebvs? Depends on: Heratibility (h2) Number of individiuals in the reference population Number of chromosome segments in the genome
Cooperation give GEBVs with better accuracy Numbers from SRB cattle 0,3 Protein Udder health Fertility Mean of 17 traits Säkerhet 0,2 0,1 0 Sweden Sweden + Finland + Denmark Referenspopulation (SRB)
Heratibility of OCD Lina Jönsson et al. 2010 OC total: 0.13 Many significant QTL:s 0.09 0.32 0-47% prevalens in different half sibling families 800 genes are differentially regulated in OCD Ongoing studies 0.38 0.3 2 Illustration from Sandgren et al. 1993, Eq Vet J Suppl 16 pp. 31-37
KWPN calculates osteochondrosis index using genomic selection Large risk of osteochondrosis Small risk of osteochondrosis 80 90 100 110 120 Reference population: X-ray of 20 yerlings/stallion, in total 3000 individuals
KWPN calculates osteochondrosis index using genomic selection Before Keur X-ray Elite From 2016 Keur DNAtyping Elite Keur X-ray Elite
Genomic selection International collaboration Exchange of genotypes Exchange of young horse test- and competion data Joint calculations of GEBVs Studbook specific breeding programs focused on the breeding goal The studbooks can still keep their own specific breeding goals Coreograph (SWB) och The Dancing Queen (SWB) Foto: Sofia Mikko
Genetic study of performance traits in SWB Sofia Mikko, Åsa Viklund & Susanne Eriksson Sveriges lantbruksuniversitet
Genomewide association study (GWAS) of performance traits in SWB Aim of the study To find genomic regions with signatures of selektion in SWB Estimate population parameters and genetic association to performance traits. Sponsras by Stiftelsen Svensk Hästforskning The SWB approved stallion Contant Q 1203 and his rider Arnold Assarsson. Foto: Maria Håkansson.
180 160 140 120 100 80 60 40 20 0 SWB stallions, sorted by EBVs in show jumping Contendro I Cardento Hip Hop (SWB) Lux Z Balou du Rouet Feliciano (SWB) Heartbeat Camaro M Spender S (SWB) Corlensky G Orlando Cornetto Cassini II Cuper VDL Sheraton Aerline H (SWB) Casir Ask Ludwigs Champion Carson Ask Quintender Niveau (SWB) Camiell-Flamingo Z Caressini L Maloubet de Pleville (SF) Al Cantino Empire (ex Secret Pride) Manhattan Santa Cruz VDL Non Stop R Saint Amour Etrusco Jaguar Mail Callahan VDL Cartier Robin Z Easy Boy (SWB) Alcatraz Fetcher N (SWB) Dee Jost Van Dyke (SWB) Ronaldinho H (SWB) Carland Careful Balougraph Carême (SWB) Lucky Point HE (SWB) Szkopul Coriall Tornesch Laptop Cagancho Quite Easy Last Liberty Cortus Cathageno Radiator Guido (ex Gudo) Marwin Cyrano de Bergerac Haydn For Feeling A-Dur L'Acteur Hamilton (SWB) Chess (SWB) Briar (SWB) Lasandos Looping Nobel Belamour Qalle (SWB) Carte d'or Metall Magini (SWB) Santino Okeanos (SWB) Majim G Topaasch De la Gardie Lambourgini (SWB) Lord Alberth (SWB) Highlight Kennedy Alligator Fontaine Wilton Smashing Hit Quaterback Saigon (ex Swingo) Twiligt Sandreo Akribori Sandakan Johnson Channon (SWB) Daytona VDL (ex Wolters) Sandro Hit Sancisco Sir Donnerhall Richfield Friendship Damino SD (SWB) First Wish Skovens Rafael Florencio I Biggles (SWB) Figaro R Rambo (SWB) Dionysos Roven xx Blue Hors Zack Black Coffee (SWB) Rosevelt Santana Rubinrot Silvano Bocelli (SWB) Blue Hors Don Romantic Highlander Hohenstaufen II Blue Hors Hotline Don Primero His Highness De Noir Highcruiser Hermes (SWB) Loredes Eighty Eight Keys xx hindex dindex
180 160 140 120 100 80 60 40 20 0 SWB stallions, sorted by EBVs in dressage Bocelli (SWB) Don Primero Sir Donnerhall Florencio I Sandro Hit De Noir Sancisco Santana Blue Hors Don Romantic Highcruiser Skovens Rafael Briar (SWB) Channon (SWB) Rubinrot Hermes (SWB) Silvano His Highness Blue Hors Zack Black Coffee (SWB) Twiligt Quaterback First Wish Damino SD (SWB) L'Acteur Hohenstaufen II Johnson Friendship Sandakan Sandreo Dionysos Loredes Rosevelt Daytona VDL (ex Wolters) Blue Hors Hotline Smashing Hit Okeanos (SWB) Wilton Figaro R Metall Highlander Santino Kennedy Rambo (SWB) Highlight Ludwigs Champion Nobel Biggles (SWB) Carland Quite Easy Magini (SWB) Saigon (ex Swingo) Lambourgini (SWB) De la Gardie Belamour Last Liberty Casir Ask Topaasch Al Cantino Richfield Cassini II Corlensky G Qalle (SWB) Niveau (SWB) Hip Hop (SWB) Manhattan Easy Boy (SWB) A-Dur Fetcher N (SWB) Akribori VDL Sheraton Carême (SWB) Cuper Empire (ex Secret Pride) Dee Jost Van Dyke (SWB) For Feeling Cyrano de Bergerac Saint Amour Tornesch Contendro I Balou du Rouet Orlando Camaro M Cortus Cagancho Carte d'or Coriall Alcatraz Quintender Aerline H (SWB) Haydn Carson Ask Cartier Majim G Laptop Caressini L Cathageno Lasandos Radiator Balougraph Careful Spender S (SWB) Lux Z Lucky Point HE (SWB) Guido (ex Gudo) Callahan VDL Ronaldinho H (SWB) Eighty Eight Keys xx Santa Cruz VDL Heartbeat Feliciano (SWB) Looping Szkopul Roven xx Marwin Jaguar Mail Camiell-Flamingo Z Maloubet de Pleville (SF) Cardento Lord Alberth (SWB) Non Stop R Cornetto Chess (SWB) Alligator Fontaine Etrusco Hamilton (SWB) Robin Z hindex dindex
Two genetic clusters 380 SWB-horses, born 2010-2011 Cluster 2: EBV (gaits) = 97 EBV (jumping) = 123 cluster 1: EBV (gaits) = 117 EBV (jumping) = 84
Height in SWB
Show jumping
Signatures of selection in SWB but not Exmoor ponies Photographer: Johannes Walter
The gait gene affects locomotion pattern in the horse Andersson et al. 2012 Sveriges lantbruksuniversitet & Uppsala universitet
GWAS in Icelandic horse Samples were selected to study the genetics of insect bite hypersensitivity Collected data on other traits in the same horses Conformation, Young Horse test results, etc.
Judging of trot and pace in Icelandic horses Heratibility of pace = 0.60 Autosomal recessive inheritance
A scan of the genome pointed at ECA23. A point mutation in the gene DMRT3 result in a trunkated protein
The mutation was discovered in four- & fivegaited horses C/C C/A A/A total 4-gaited 3 103 46 152 5-gaited 0 2 103 105 Total 3 105 149 257
Performance of Swedish trotters Standardbred North Swedish dtraft Coldblood trotter
The DMRT3-mutation is also present in standardbreds Standardbreds C/C C/A A/A total 3 31 304 338
DMRT3 homozygote A/A standardbred DMRT3 homozygote A/A standardbred
DMRT3 heterozygote C/A standardbred DMRT3 heterozygote C/A standardbred
DMRT3 function
A breeding stallion Successful at the trotting races but not as good as breeding stallion Showed to be heterozygote C/A His A/A-offspring earned twice as much as his C/A-offspring
DMRT3 mutation in Coldblood trotters C/A-coldbloods perform as good as A/A. The A-allel was introduced in Coldblood trotters by crossbreeding with standardbreds The DMRT3 mutation is also present in other breeds.
Average points for different gaits in gaits of standardbred with the genotypes A/A or C/A 5,50 ** 5,00 *** * 4,50 * 4,00 AA CA 3,50 3,00 Collected canter Extended canter Collected trot Extended trot Walk Jäderkvist et al 2015
Myostatin in thoroghbreds Hill et al. PLoS ONE 2010, Mackowski et al. ISAG 2010 Ratio of winners per distance Quick, sprinter Best at 1300 m 75% of 1000 m winners are C:C Perform well as 2-year olds The mutation give more and larger muscle fibers. Freq of homozygus C/C: 25% of UK, & 38% of AUS xx 0% of National Hunt xx 98% of QH <5% of Egyptian ox 38% of Shetland ponies Fast, middle distance Best at 1830 m 70% of C:T are winners at 1600-2400 m Stayer with stamina Best at 2230 m 90% of T:T wins at>1600 m Develop slowly
Myostatin in other breeds Donkey and American Standardbred are fixed for the wild type allele (T). The allele frequency of the sprintermutation (C) in French Trotters is 1%, which implies that 2% of them are carriers of the sprintermutationen. MSTN allele frequencies in some breeds Allelfrekvens 1,00 0,90 0,80 0,70 0,60 0,50 0,40 0,30 0,20 0,10 0,00 0,00 0,00 0,01 0,10 0,13 0,17 0,20 0,34 0,50 0,70 0,90 C T Ras Bower et al. Nature Genetics, 2012
What is myostatin doing? Myostatin = GDF8 (growth & differentiation factor 8) Mutation in cattle give More and larger muscle fibres Lower fertility Lower calf survival Increased stress susceptibility More difficulties when giving birth Several mutations in the gene One of the mutations is only present in Arabian and English Thoroughbreds
Genetic diseases and defects in the horse Sofia Mikko, HGEN Hippos avelsdagar 2018, Rovaniemi 22 mars 2018
Skeletal atavism Krumma ben in Shetland Pony Autosomal recessive inheritance Abnormally long ulna and fibula Small tubular ears Low prevalence, but approx 11 % unknown carriers in the breed Photo: Lisa Andersson Photo: Göran Dalin
Association study of Skeletal atavism 6 affected, 18 carriers, and 21 healthy (non-carriers) GWA could not detect any significant association Homozygosity mapping Whole genome sequencing Deletion of the gene SHOX Photo: Göran Dalin
Hoof Wall Separation Disease (HWSD) Found in Connemara Autosomal recessive Deletion in SERPIN1B Hoof capsule separates from the hoof wall Rotation of the hoof bone Not the same as White Line Disease
Equine Insect Bite Hypersensitivity (EIBH, sommareksem) One of the most common skin diseases in horses Present in many horse breeds The primary allergenes are proteins in the saliva of the midges Culicoides Itchy excema can cause open wounds, crusts, dandruff, and inflammation
Study of prevalence- and heratibility of EIBH Eriksson et al Animal 2007 Prevalence of 8% in Icelandic Horses born in Sweden 0-30% between half sibling groups Phenotype graded in four classes Heratibility was estimated at 14% (40-50% on the underlying, continous scale)
Tack! Coreograph (SWB) Foto: Carin Wrange
Färggenetik Sofia Mikko, HGEN Hippos avelsdagar 2018, Rovaniemi 22 mars 2018
Grottmålningar i Frankrike Pruvost et al. 2011 Brunblack Musblack Tigrerad
Utveckling av pigmentceller Pigmentcellerna vandrar från neurallisten Gener som påverkar pigmentbildning, påverkar också neurologiska funktioner, fertilitet, aptit etc.
Eumelanin/Feomelanin Foto: Roland Thunholm Svart, E- Fux, ee Extension-lokus, E, på ECA3 Melanocortin receptor 1 - MC1R Avgör om svart eller rött pigment bildas
Eumelanin/Feomelanin Brun, A- Svart, aa Svartbrun, a t Agouti signaling protein - ASIP, A, på ECA22q Binder till MC1R Avgör utbredningen av svart färg
Utspädda färger - gul Gulbrun Isabell Gulsvart Foto: Gränsbo stuteri aae-ccr Gulsvartbrun A-E-CCr aa t E-CCr Membrane associated transport protein - MATP, c cr, ECA21q, (eng. cream) Späder främst feomelanin hos heterozygoter, men även eumelanin hos homozygoter, s.k. codominant nedärvning eller ofullständig dominans.
Utspädda färger - gul eecrcr gulvit/cremello A-E-CrCr pärlvit/perlino Blå ögon Homozygot för gulanlaget BEC = Blue-Eyed Cream, blåögd gräddvit, gulvit/pärlvit Dessa är INTE albinos
Utspädda färger - Pearl Finns hos spanskättade hästar (PRE, lusitano, etc) MATP exon 4 mutation En tredje allel i gul-lokuset C > Cr > Prl N/N Normal färg N/Prl? Cr/Prl Pseudo BEC Prl/Prl En i grunden fux blir aprikos
Utspädda färger Albino OCA1, Tyrosinas - TYR, C C = normal produktion av melanin c = albino, inget pigment alls, röda ögon, ofta döva Det finns inga äkta albino hästar!
Utspädda färger - Silver PMEL17 - SILV (Z), ECA6 Späder endast svart pigment Apelkastade Ingen synlig effekt på fuxar Silversvart Silverbrun Silverfux (anlagsbärare) Mushroom är inte silver
Multiple Congenital Ocular Anomalies (MCOA) Andersson et al. BMC Genet 2008, Mamm Genome 2011 Heterozygoter: cystor i ögat, ingen nedsatt syn påvisad Homozygoter: cystor i ögat, vidöppna ögon, deformerad pupill, synproblem Homozygot silver
Utspädda färger Black (eng. Dun Dn) Fullt fungerande TBX3 på ECA8 Dominant Melanosomer endast på utsidan av hårstrået Distinkt ål, grepp, zebratecken Brunblack Musblack Rödblack Isabellblack Zebratecken
Black Ej black Ej black D/- d1/d1 d2/d2
Ej Black d1/d1 Ej black (eng. Dun) dn Vissa föl har ål, grepp, och zebratecken som försvinner med fölpälsen
Hemizygot (d1/d2)
Avblekbar skimmel Grey G, STX17 på ECA25q Dominant, autosomal, regulatorisk gen Epistatisk över alla andra färger Associerad med melanom och vitiligo Homozygoter blir snabbare vita och får mer melanom och vitiligo Svartfödda får oftare melanom än brunfödda skimlar Sparrow skimlar av långsammare
Konstantskimmel Konstantskimmel (eng. Roan) Rn Dominant, epistatisk KIT-genen, okänd mutation, ECA3q Rn/Rn är troligen ej letal Färgväxlare Färgat huvud
Brokiga färger - Tobiano Tobiano To, KIT, ECA3q Dominant De vita fälten breder ut sig från ryggen (dorsal) Jämna kanter ToTo har paw prints Ofta fyra vita fötter och tvåfärgad svans
Brokiga färger - Sabino Sabino Sb, KIT, ECA3q KIT-mutation förklarar 95% av sabino Ojämna kanter, ofta stickelhåriga Crop-outs
Vita mönster KIT-genen Hollet al. 2010 1 2 3 4 5 6 7 8 9 10 1112 13 14 15 16 17 18 19 20 21 S187RfsX10 W12 xx Vit spräcklig
Vita mönster Dominant vit Haase et al. 2007 Dominant vit KIT, W/+, ECA3q Många KIT-mutationer i olika raser Föds vita Mer vitt om hästen är ee (fux) Vissa har lite pigmentering Mörka ögon xx exon13 W2/+ Föl Vuxen
KIT-genen 1 2 3 4 5 6 7 8 9 10 1112 13 14 15 16 17 18 19 20 21 K236X W3 1996 Vit ox r.spl? W7 2005 xx Vit spräcklig S187RfsX10 W12 xx Vit spräcklig G286R W6 2004 Vit xx 4bp del W10 2000 QH Alla vita och fläckiga C533R W15 2005 ox A602V G654R W4 W2 1912 1946 Vit Vit xx Camarillo G597R W9 2006 Holst Vit W17 2010 Y717X W1 1957 Vit FM T732QfsX9 W5 1984 xx Sb-likn Del exon 17 SB1 Sabino r.spl? W8 xx Vit spräcklig 54bp del r.spl W14 W13 1996 xx K830I W16 2003 r.spl? W11 1997 Tyskt kbl Vit Inversion 70kb Nedströms Tobiano
Vita mönster - Tigrerad Leopard- Lp, ECA1q Vit sclera, hårlös hud är prickig, randiga hovar Variabel penetrans, dominant Heterozygoter - prickiga Homozygoter mer vita Vanligt med ögonsjukdomar
Brokiga färger Bukskäck Bukskäck = Splashed White Spl MITF- & PAX-generna doppade i vit färg Heterozygoter oregelbunden bläs, vita fötter Homozygoter & fuxar blir mer vita Kopplat till dövhet
Vita mönster MITF prom1 & PAX3 C70Y Hauswirth et al. 2012
Brokiga färger - Overo Overo O, EDNRB, ECA17 Dominant Flikiga fläckar Homozygoter får OLWS, föds vita och dör i kolik inom något dygn Bland frame overos är 95 % anlagsbärare
Kombinerade skäckfärger
Vita mönster Vita tecken Var går gränsen mellan mycket vita tecken och skäck?
Tack! Coreograph (SWB) Foto: Carin Wrange