The Central Dogma. Molekylär bioteknik. Sophia Hober. Secondary structure. Tertiary structure. Importance of correct fold. Quaternary structure

Relevanta dokument
Prokaryot proteinproduktion

Centrala Dogmat. DNA RNA Protein

Jonbyteskromatografi

Downstream Processing

Tunga metaller / Heavy metals ICH Q3d & Farmakope. Rolf Arndt Cambrex Karlskoga

Resultat av den utökade första planeringsövningen inför RRC september 2005

Rening, inmärkning och användning av ett målprotein

TN LR TT mg/l N b) 2,6-Dimethylphenole

The test can be performed on the following devices. In addition, the required cuvette and the absorption range of the photometer are indicated.

SHP / SHP-T Standard and Basic PLUS

Elektron-absorbtionspektroskopi för biomolekyler i UV-VIS-området

Tentamen Molekylärbiologi X3 (1MB608) 10 March, 2008 Page 1 of 5. Skriv svaren på varje fråga på SEPARATA blad.

SOLAR LIGHT SOLUTION. Giving you the advantages of sunshine. Ningbo Green Light Energy Technology Co., Ltd.

Viktig information för transmittrar med option /A1 Gold-Plated Diaphragm

The test can be performed on the following devices. In addition, the required cuvette and the absorption range of the photometer are indicated.

1. Compute the following matrix: (2 p) 2. Compute the determinant of the following matrix: (2 p)

Labokha AA et al. xlnup214 FG-like-1 xlnup214 FG-like-2 xlnup214 FG FGFG FGFG FGFG FGFG xtnup153 FG FGFG xtnup153 FG xlnup62 FG xlnup54 FG FGFG

Sustainability transitions Från pilot och demonstration till samhällsförändring

Isolda Purchase - EDI

Support Manual HoistLocatel Electronic Locks

Personnummer. DUGGA Molekylärbiologi T3 / HT p (G = 24 p)

Country report: Sweden

Room E3607 Protein bioinformatics Protein Bioinformatics. Computer lab Tuesday, May 17, 2005 Sean Prigge Jonathan Pevsner Ingo Ruczinski

Elektron-absorbtionspektroskopi för biomolekyler i UV-VIS-området

The present situation on the application of ICT in precision agriculture in Sweden

INSTALLATION INSTRUCTIONS

Affärsmodellernas förändring inom handeln

SWESIAQ Swedish Chapter of International Society of Indoor Air Quality and Climate

A QUEST FOR MISSING PULSARS

Immunteknologi, en introduktion. Hur man använder antikroppar för att mäta eller detektera biologiska händelser.

Tentamen Biokemi 2 KEM090

Iron VARIO PP mg/l Fe g) 1,10-Phenanthroline

Rättningstiden är i normalfall 15 arbetsdagar, annars är det detta datum som gäller:

Grass to biogas turns arable land to carbon sink LOVISA BJÖRNSSON

Materialplanering och styrning på grundnivå. 7,5 högskolepoäng

Protein en livsviktig byggsten

Supplementary Data. Figure S1: EIMS spectrum for (E)-1-(3-(3,7-dimethylocta-2,6-dienyl)-2,4,6-trihydroxyphenyl)butan-1-one (3d) 6'' 7'' 3' 2' 1' 6

Supplementary information for. MATE-Seq: Microfluidic Antigen-TCR Engagement Sequencing

ARC 32. Tvättställsblandare/Basin Mixer. inr.se

DUGGA Molekylärbiologi T2 / VT p (G = 25 p)

TEXTURED EASY LOCK BLOCK INSTALLATION GUIDE. australianpaving.com.au

Information technology Open Document Format for Office Applications (OpenDocument) v1.0 (ISO/IEC 26300:2006, IDT) SWEDISH STANDARDS INSTITUTE

FÖRBERED UNDERLAG FÖR BEDÖMNING SÅ HÄR

Fysisk aktivitet och hjärnan


FaR-nätverk VC. 9 oktober

The Finite Element Method, FHL064

Fade to Green. stegen mot grönare hudvårdsprodukter. Tomas Byström Produktutvecklare. Grönt ljus för Grön kemi?

PRESS FÄLLKONSTRUKTION FOLDING INSTRUCTIONS

Från DNA till protein, dvs den centrala dogmen

Emissions of Dioxins in Municipal Solid Waste Incineration. Professor Stellan Marklund Umeå University Sweden


Ett hållbart boende A sustainable living. Mikael Hassel. Handledare/ Supervisor. Examiner. Katarina Lundeberg/Fredric Benesch

GeoGebra in a School Development Project Mathematics Education as a Learning System

BRUKSANVISNING. Oscilla 910

Rening av proteiner: hur och varför?

EU gemensamma regler för drönare. Rémi Vesvre

Measuring child participation in immunization registries: two national surveys, 2001

Kombinerad träning kan muskeln bli snabb, stark och uthållig på samma gång?

Swedish framework for qualification

Thesis work at McNeil AB Evaluation/remediation of psychosocial risks and hazards.

Kunskapslyftet. Berndt Ericsson. Esbo Utbildning, arbetsliv och välfärd Ministry of Education and Research. Sweden

Regional Carbon Budgets

Lignin i pulverpannor

LUNDS TEKNISKA HÖGSKOLA Institutionen för Elektro- och Informationsteknik

Den framtida redovisningstillsynen

Fossilförbannelse? Filip Johnsson Institutionen för Energi och Miljö Pathways to Sustainable European Energy Systems

Installation Instructions

1. Varje bevissteg ska motiveras formellt (informella bevis ger 0 poang)

SkillGuide. Bruksanvisning. Svenska

Luftfartsavdelningen Sektionen för flygutbildning MANUALER VÄLKOMNA EN KORT SAMMANFATTNING AV INNEHÅLLET I RESPEKTIVE MANUAL

EU gemensamma regler för drönare. Rémi Vesvre

Examensarbete Introduk)on - Slutsatser Anne Håkansson annehak@kth.se Studierektor Examensarbeten ICT-skolan, KTH

) / (c l) -A R ) = (A L. -ε R. Δε = (ε L. Tentamen i Biomätteknik (TFKE37), 9 januari Uppgift 1 (10p)

Module 6: Integrals and applications

CHANGE WITH THE BRAIN IN MIND. Frukostseminarium 11 oktober 2018

Forskningstrender inom mekanisk fogning vid Centre for Joining and Structures Svets- och fogningsteknik, Elmia

Tentamen 12/ Medicinsk Teknik Fördjupningskurs Implantat och biomaterial, 7E1112 (KTH), MTF003 (KI)

Analytical Approaches to Neurodegenerative Disease Protein Aggregation

Till sökande för KRAV-certifiering av produkter från fiske. To applicants for KRAV certification of seafood products from capture fisheries

Boiler with heatpump / Värmepumpsberedare

Kursplan. NA3009 Ekonomi och ledarskap. 7,5 högskolepoäng, Avancerad nivå 1. Economics of Leadership

Beijer Electronics AB 2000, MA00336A,

D-RAIL AB. All Rights Reserved.

Instruction Manual. Svenska, English. Power Bank. Model: PRBN

Retention of metals and metalloids in Atleverket treatment wetland Sylvia Waara & Tatsiana Bandaruk

Non-toxic antifouling methods to combat marine bio fouling on leisure boats in the Baltic Odd Klofsten Boatwasher Sweden AB

balans Serie 7 - The best working position is to be balanced - in the centre of your own gravity! balans 7,45

Time (min)

Salmonella control in pig production in Sweden. Helene Wahlström, Zoonosiscenter, SVA

Consumer attitudes regarding durability and labelling

12.6 Heat equation, Wave equation

Studieteknik för universitetet 2. Books in English and annat på svenska

Förbundsutskott 32, broar och tunnlar

Processimulering --- I teori och i praktik

Exam Molecular Bioinformatics X3 (1MB330) - 1 March, Page 1 of 6. Skriv svar på varje uppgift på separata blad. Lycka till!!

Preschool Kindergarten

SAMMANFATTNING AV SUMMARY OF

The Arctic boundary layer

Från DNA till protein, dvs den centrala dogmen

Transkript:

The Central Dogma Molekylär bioteknik DNA CGCGGATTCATTAGCTGAAGCTAAAGTCTTAGCTCTGAG GCGCCTAAGTAATCGACTTCGATTTCAGAATCGAGACTC Replication Måndagen den 3/11 mrna Transcription CGCGGAUUCAUUAGCUGAAGCUAAAGUCUAGCUCUGAG Translation Sophia Hober sophia@biotech.kth.se telefon nr: 553 783 30 A D S Q A K L A V L K D L Q A T R L GV S D T Folding protein Secondary structure Tertiary structure antiparallell "-sheet parallell "-sheet!-helix Quaternary structure Importance of correct fold PrP c PrP Sc

The angles in a peptide bond Levinthals paradox!random fit to a native fold!result: Folding time will exceed the estimated life time of the universe A=100 aa, every aa has 2 conf. -> 10 7 years Levinthal, C. (1969) How to fold graciously Ramachandran plot Folding - a self assembly-process!all Folding information in the polypeptide chain!no extrinsic factors needed!no input of energy needed Anfinsen, C. B., et al (1961) Proc. Natl. Acad. Sci. USA 47, 1309-1314 To fold or not to fold Why study protein folding? Unfolded Stabilizing factors! H-bonds! Van der Waals interactions! Covalent bonds Native! Total energy (100 a.a.)! 4000-6000 [kcal / mol]! Conformational stability #G! -10 [kcal / mol]! A single hydrogen bond up to #G! -10 [kcal / mol]!to understand protein function!to perform protein design!to predict 3-D structures!to refold product proteins

Two-state model of protein folding Jigsaw puzzle model U N K eq = N U Nucleation model U I I I1 I2 I3 N The Molten Globule!Condensed, in a globular form!contains secondary structure!stabilized by non-specific hydrophobic interactions!topology close to native!rate limiting step Molten globule model

Experimental methods to study stability and folding (1) UNSPECIFIC:!Spectroscopic methods Absorbance spectra of HCAII Absorbance: Electronic excitation of the aromatic residues Tertiary structures Fluorescence: Electronic excitation and emission of the aromatic residues Tertiary structures Freskgård P.-O. (1994) Thesis Fluorescence emission spectra of HCAII Experimental methods to study stability and folding (2) UNSPECIFIC:!Spectroscopic methods Circular Dichroism proteins absorb right and left handed polarized light differently Freskgård P.-O. (1994) Thesis!Near UV (250-320 nm) Tertiary structures Aromatic residues Cysteines!Far UV (170-250 nm) Secondary structures!, "... Circular Dichroism CD spectra for various secondary structures!-helix "-sheet "-turn random coil

Far UV Circular Dichroism Near UV Circular Dichroism Denatured hprp Reduced hprp Reduced hprp Oxidized hprp Oxidized hprp Jackson G.S. et al (1999) Science 283, 1935-1937 Jackson G.S. et al (1999) Science 283, 1935-1937 Experimental methods to study stability and folding (3) SPECIFIC:!Probes Fluorescent probes covalently bound depends on environment Chemical reactivity probes accessibility Cysteines accessibility, charged reactants (IAA) Experimental methods to study stability and folding (4) SPECIFIC:!NMR, measuring the H-bonds Pulse labeled NMR Quenched hydrogen exchange NMR!Disulfide exchange folding Natural probes following folding by trapping the disulfide intermediates Pulse labeled NMR Disulfide exchange folding Unfolding conditions D 2 O Refolding conditions t= from 1 ms D H 2 O Refolding D H H + Analysis by NMR Roder et al 1988 Nature

Separation of IGF-I variants with various disulfides by gel electrophoresis Experimental methods to study stability and folding (5) SPECIFIC:!Protein engineering should not affect the native structure Remove specific interactions Measure changes in energetics during folding Measure changes in stability Change tryptophane residues for phenylalanine Measure changes in fluorescence during folding Protein engineering to understand protein folding Using CD spectroscopy for kinetic measurements Far UV measures the secondary structure content Fluorescence emission measures the tertiary structure content

Strategier för rekombinant proteinproduktion i Escherichia coli Prokaryotic cell Extracellulär produktion Intracellulär produktion Proteinet är stabilt och lösligt!proteinrening Escherichia coli Proteinet bryts ner! byta bakteriestam! byta ut känsliga amino syror i proteinet! optimera odlingsbetingelser Proteinet är stabilt!lysering av cellerna!proteinrening Proteinet är lösligt Proteinet bildar inklusionskroppar Proteinet bryts ner! byta bakteriestam! byta ut känsliga amino syror i proteinet! optimera odlingsbetingelser!lysering av cellerna!proteinrening!upplösning av inklusionskroppar!renaturering!proteinrening Prokaryotic Cell Wall Expressionsvektor Gram+ Gram- antibiotikaresistensgen-för att plasmiden ska stanna i cellen målprotein-det proteiner som egentligen önskas affinitetssvans-för att underlätta detektion/rening replikationsstart (ORI)-för att plasmiden ska replikeras signalsekvens-för att proteinet ska exporteras ut ur cellen promotor- för att den önskade DNA-sekvensen ska transkriberas till RNA och sedan translateras till ett protein Production of a protein Extracellular, secreted THE PURIFICATION PROBLEM S Product +little contaminants -some proteins impossible to secrete Intracellular Product +higher yields -more contaminants than when secreted -/+may lead to inclusion bodies

Interaktioner Affinity chromatography Negativa laddningar Hydrofoba ytor! Powerful unit operation! Product concentration and!!! purification in a single step Positiva laddningar Yta med specifik affinitet! Ideal technology as early capture! step in bioprocesses Benefits of affinity chromatography Fermentation Cell disruption Initial sample preparation Chromatography 1 Chromatography 2 Chromatography 3 Fermentation Cell disruption Initial sample preparation Affinity chromatography +/- with affinity chromatography + high specificity fewer purification steps necessary products in low concentration can be purified - expensive limited amount of ligands ligand stability column cleaning Polishing Polishing Final product Final product Affinity chromatography Two possibilities Gene fusion Native target Tag Target Target Affinitetssvansar används för att underlätta rening / detektion Anpassas efter vilka förhållanden som målproteinet tål under framreningen + General method for many targets + Several tag fusion systems available - Specific cleavage necessary to remove tag + Recovery of native target - New ligand for each target (or group)

Production of a protein Extracellular, secreted Några väl använda affinitetsvansar S Handle Product S Product Handle S Product Intracellular Handle Product Product Handle Product +little contaminants -some proteins impossible to secrete +higher yields -more contaminants than when secreted -/+may lead to inclusion bodies ProteinA 31kDa binder IgG elueras med lågt ph Z 7kDa binder IgG elueras med lågt ph ABP 5-25kDa binder HSA elueras med lågt ph GST 25kDa binder glutation elueras med glutation His6 6 aa binder metalljoner elueras med imidazol eller lågt ph Biotin 13kDa binder avidin elueras med biotin FLAG-peptid 8 aa binder till mono- elueras med lågt ph klonal antikropp elleredta För att kunna rena fram det önskade målproteinet behöver ibland fusionssvansen klyvas bort Enzymatiska metoder: mer specifika dyrare fysiologiska förhållanden Kemiska metoder: mer ospecifika billigare kräver ofta ofysiologiska förhållanden Ibland måste fusionssvansen klyvas bort för att målproteinet ska bli användbart Exempel på enzymatiska klyvningsmetoder: Trombin H64Subtilisin Enterokinas Trypsin Proteas 3C klyver efter Arg, beroende av 3D-strukuren klyver efter Ala-His-Tyr, mindre beroende av 3D-strukt. klyver efter(asp) 3-5-Lys, mycket selektivt klyver efter Arg och Lys, för oselektivt för många appl. klyver efter Leu-Glu-Thr-Leu-Phe-Gln, mycket selektivt Ionexchange chromatography För att kunna rena fram det önskade målproteinet måste fusionssvansen ibland klyvas bort Exempel på kemiska klyvningsmetoder: CNBr klyver efter Met, ej om Met finns i målproteinet Hydroxylamin klyver mellan Asn och Gly, kan modifiera produkten

Gelfiltration Strategy for production and recovery 1) Fermentation Absorbance 2) Isolation 3) Solubilization Time or Volume 4) Renaturation native misfolded aggregated Inclusion bodies Aggregates of partly folded proteins Affected by the rate of expression Mainly non-covalently bound + the protein is protected from degradation - solubilization is needed Cell breakage Recovery (1) " Separation of inclusion bodies from the cell debris: 1.Sonication or high pressure homogenization 2.Centrifugation 3.Washing (when expression levels are low) " Solubilization of the cell and the inclusion body: 1.Urea or GdmCl 2. Centrifugation d=0.2-1.5!m (E. coli"2!m) Recovery (2) Concerns when solubilizing the inclusion bodies " Avoid interference with the coming purification methods " Inhibit proteases " Avoid chemical reactivity towards labile amino acids " If thiol groups are present add reducing agent Suggested solution 6M GdmHCl (charged) or 8M Urea (contaminated with isocyanate) 100mM Tris ph 8 100mM DTT Refolding (1) The main problem is aggregation " Low protein concentration ("!M) " Stepwise dilution before removal of denaturant by dialysis " Additives stoichiometric amounts of PEG (MW 350) 0.5-1M L-arginine detergents, for instance Lauryl-maltoside, CHAPS co-factors suiting your protein glycerol <20 % EtOH <30 % " Chemical modifications of the protein to increase the solubility

Characterization of purified and refolded targets "Purity / Homogeneity "Folded? Circular dichroism Absorbance NMR... Thereafter: "Specific assays enzymaic activity affinity... Disulfide formation (1) Air oxidation, catalyzed by metal ions + cheap - slow - nonreversible, problems with dimer-formation and mismatched disulfides - oxidation of Met and Cys Alternatively block all free cysteines reversible (sulfitolysis) purify under denaturating conditions disulfide formation Cole, R. D. (1967) Methods Enz. 11, 206-208 Disulfide formation (2) Disulfide exchange - expensive (in large scale) + reversible system, mismatched disulfides can be reduced 5:1 or 10:1 of GSSG:GSH (0.1-10mM), since the effective molarity of protein cysteines are higher, protein disulfides will be favoured