KORTSVARSFRÅGOR 1. Vad menas med att ett DNA-fragment har blunt ends? (1p) Inget enkelsträngat DNA finns på DNA ändarna. 2. Vilken enzymatisk aktivitet har klenowenzymet och vad kan det användas till? (2p) Klenow syntetiserar DNA med hjälp av en primer, dntp s och ett templat. Klenow används ofta till att göra om sticky ends till blunt ends. Används även för att göra andra strängen i en cdna syntes. Kan också användas för att märka in DNA med radioaktivitet. 3.Varför bör man ha en internkontroll när man analyserar geneuttryck med hjälp av real-time PCR? (1p) För att kunna normalisera proverna som jämföres dvs kompensera för mängd utgångsmaterial. 4. qpcr: vilket prov A eller B innehåller mest templat? A: Ct=28, B: Ct=35 (1 p) A 5. Ge exempel på en basal transkriptionsfaktor och förklara vad de basala transkriptionsfaktorena har för funktion i gen aktivering. (2p). Svar t ex sigma faktorn i E coli eller TFIID i eukaryoter. Hjälper RNA polymeraset att hitta promotorn. 1
6. A) Du tror att protein A och B kan binda till varandra nämn 4 metoder du kan använda för att undersöka detta. (2p) Jäst två-hybrid GST-pulldown Biacore Mammalian två-hybrid Co-immunoprecipitation B) Du har protein C och vill veta om det finns något protein som kan interagera med detta protein. Beskriv kort hur du kan identifiera interagerande proteiner. (2p) Jäst två-hybrid systemet: Gör ett bait av protein C dvs fusering till Gal4-DBD. Transformera jäst med bait + ett cdna bibliotek fuserat till Gal-activation domain. Selektera fram kloner som växer i näringsmedium vilket saknar bland annat aminosyran histidin som bildas om protein C interagerar med ett annat protein. Isolera biblioteksplasmiden från jästklonen och sekvensera. 7. Draw the common domain structure of a typical nuclear receptor and explain at least four functions associated with these domains (3 p) AF-1 (activation function 1) ligandoberoende aktiveringsdomän, DBD (DNA binding region) medger bindning till specifik DNA-sekvens, dimerisering och kärnlokalisation, Hinge region, LBD (ligandbindande domän) binder ligand, coaktivator interaktion, ligandberoende aktiveringsdomän, dimerisering och kärnlokalisation. 2
8. Vilken är den principella skillnaden mellan monoklonala och polyklonala antikroppar? (3p) Polyclonal. Raised in a variety of animals by injecting purified antigen into the animal and then the serum collected. Contain antibodies that recognize and bind to a variety of epitopes on an antigen. Monoclonal. These antibodies are identical and bind to a single epitope. After an animal is injected with the antigen the B cells are removed and are fused to tumor cells in culture- therefore large amounts can be produced. High specificity therefore can give less background than polyclonal. 9. Du vill veta betydelsen av ett protein i en cell och vill därför därför minska uttrycket av detta protein. Hur kan du åstadkomma detta? (1p) Genom att använda sirna 10. Ungefär hur många unika gener tros finnas i det mänskliga genomet?(1p) Ca 22,000-25,000 unika gener (genomet) 3
11. You have cloned a promoter and identified some protein binding sites using footprinting. You want to know now which proteins bind to these sites. How do you proceed? (3p) Comparison of the binding sites with a database for transcription factor binding sites. EMSA with the identified labelled binding sites and either cell extracts or purified suspected proteins. In case of cell extract, the suspected proteins have to be identified by supershift with specific antibodies. Specificity can be shown by competition with unlabelled nucleotides and the use of labelled scrambled sequences. And/or ChIP assay with antibodies against the suspected protein and primers to amplify the binding region. 4
12. Describe four features that make C. elegans a good model system for (human) neurobiology. (4p) The overall set-up / network of the nervous system or brain is the same: sensory neuron (input), interneuron or brain (computation, comparison, processing, decision making), motor neuron (output) Many molecules that function in neurons are conserved between worms and humans (e.g. neurotransmitters, signal receptors, transport molecules, etc. etc.) One can analyze single cells of the nervous system with a technique called laser ablations - removing any particular neuron and then check which specific nervous system function is disturbed or absent The C. elegans nervous system is completely described with regard to numbers of neurons, their connectivity, cell types, and is very, very simple, yet at the same time displays all the features a nervous system needs to have (see first answer) One can mutate worms easily and then look at many, many different behaviors that are due to malfunctions in the nervous system: behavioral genetics help analyze nervous system / brain functions 13. Programmed cell death (apoptosis): The C. elegans protein CED-9 is a molecule that promotes cell survival. It does so by inhibiting the protein CED-3, a caspase-type protease that promotes programmed cell death by degrading all kinds of cellular proteins. What phenotypes with regard to cell survival/cell death would you expect in ced-3 (loss-of-function) mutant worms and in ced-9 (gain-of-function) mutant worms? What phenotypes with regard to cell survival/cell death would you expect in ced-9 (loss-of-function) ced-3 (loss-offunction) double mutant worms? Describe the reasons why you come to your respective conclusions. (2 + 2 = 4 p) ced-3 (loss-of-function) mutant worms: too many cells survive, because the cell death promoting functions of the protease/caspase CED-3 are defective ced-9 (gain-of-function) mutant worms: too many cells survive, because of overactivity of the cell survival promoting functions of CED-9 ced-9 (loss-of-function) ced-3 (loss-of-function) double mutant worms: too many cells survive, because of the loss of function of the cell death promoting functions of CED-3 (protease/caspase), which makes the regulation of CED-3 by its inhibitor CED-9 irrelevant (genetic and biochemical interaction epistasis: CED-3 acts after CED-9 in the pathway) 5
14. Vilken spektroskopisk teknik kan med fördel användas för att analysera sekundärstruktur hos proteiner? (1p) CD, eller cirkulär dikroism. 15. Why is a 2D crystal of a membrane protein an ideal object for transmission electron microscopy? (2p) It is thin most electrons will go through the specimen just effected by a phase shift described by the contrast transfer function (CTF). Many identical objects in a periodic arrangement electron crystallography, averaging over a large number of identical objects. 16. What techniques can be used to prepare RNA molecules for structural studies? (3p) - Solid-phase chemical synthesis (<40 nt) - Run-off in vitro transcription with T7 RNA polymerase - In vitro transcription with T7 RNA polymerase, followed by self-cleavage of 5 and 3 ribozyme sequences to liberate highly homogeneous RNA species 6
17. What are the requirements for a protein that you would like to crystallize? (3p) Protein must be: - correctly folded - soluble - stable - 95-98% pure - homogeneous - > 1mg/ml concentration - amount: at least 500 ul for the first trial 7
19. a. Nämn två olika bakomliggande genetiska mekanismer till Down syndrom. (2p) b. Vid bedömning av upprepningsrisk är det viktigt att känna till den bakomliggande orsaken till Down syndrom i familjen. Varför? (1p) Svar a (2p) - Klassisk fristående trisomi 21 - mosaicism - Bakomliggande Robertsons translokation - Svar b (1p) Upprepningsrisken varierar! (Detta svar räcker för 1p) (- Klassisk fristående trisomi 21- låg upprepningsrisk - Mosaicism låg upprepningsrisk - En kvinnlig Robertsonsk translokationsbärare vars translokation involverar kromosom 21 har 10-15% risk att föda ett barn med Down syndrom, medan en manlig bärare löper en risk som är mindre än 1%. ) 20. a. Nämn två olika kliniska kännetecken på ärftlig cancer. (2p) b. Hur stor andel av all cancer beräknas vara ärftlig? (1p) c. Nämn en förutsättningen för att ett presymptomatiskt anlagsbärartest kan utföras? (1p) Svar 1a (2p) - låg debutålder - typisk släkthistoria (släktingar med samma eller associerad cancersjukdom) - multipla tumörer hos en individ Svar 1b (1p) - 5-10% Svar 1c (1p) - Att mutationen är identifierad hos en släkting med sjukdomen 8
21. Beskriv för- och nackdelar med in silico-studier. (2p) + inget labbarbete, ingen kostnad för reagens och personal - risk för dålig kvalitet på data, ofullständig dokumentation 23. Vad innebär det om två gener är ortologa? Ge ett exempel. (2p) Homologer som har uppstått genom artbildning tex generna för insulin hos människa och schimpans är varandras ortologer. 24. Beskriv tillkomsten av bioinformatiken som ett tvärvetenskapligt ämne. Diskutera runt behov och konsekvenser. (3p) Utveckling av molekylärbiologin och genomiska tekniker, massiv generering av data, behov av nya analysmetoder och statistik, tillkomst av databaser för biologisk information osv 9
BERÄTTARFRÅGOR 25. Du ska klona in sekvensen angiven nedan, i EcoRI sitet på plasmiden pbs. Du har tillgång till cdna från celler som uttrycker denna sekvens som kan användas som templat i PCR-reaktioner (både sense och antisense strand ges nedan). EcoRI klyver sekvensen GAATTC. Sekvensen som ska klonas: 5 CGCGAATGCGCGAATATGCGCGTATATGCGCGCTATGGGCCCCGTATATTGTGTGAGAGA 3 GCGCTTACGCGCTTATACGCGCATATACGCGCGATACCCGGGGCATATAACACACTCTCT GGGGAGAGAGGGAGAGAGGGCGCGCGAGAGAGTTTTAGGATGATTAGATAGATGATATGAGA CCCCTCTCTCCCTCTCTCCCGCGCGCTCTCTCAAAATCCTACTAATCTATCTACTATACTCT TGTATATTATATATTGGGCGCGCGTATTAGCGCTAGGCTCGATGCTAGCTGATGCGGCT 3 ACATATAATATATAACCCGCGCGCATAATCGCGATCCGAGCTACGATCGACTACGCCGA 5 A. Ange DNA-sekvensen på två stycken primers som kan användas för att amplifiera sekvensen med PCR och samtidigt få den flankerad av EcoRI sites. (4p) B. Beskriv dessutom vilka steg som måste utföras för att klona in PCRprodukten i EcoRI sitet i pbs samt rena fram den slutliga plasmiden. (3p) SV A. primer 1 5 GATCGAATTCCGCGAATGCGCGAATATGCG primer 2 5 GATCGAATTCAGCCGCATCAGCTAGCATC (Blå nucleotider = extra baser för att kunna klyva, kan vara andra) B. 1) Rena PCR produkten 2) Klyv vektor och PCR-produkt med EcoRI 3) Defosforylera vektorn 4) Värmeinaktivera både vektor och klyvd PCR-produkt. 5) Ligera PCR-produkt + vektor. 6) Transformera ligering 7) Plocka bakteriekoloni och starta kultur 8) Rena plasmid 10
26. Årets Nobelpris i medicin tilldelades de forskare som utvecklade knockouttekniken. Beskriv hur det går till att framställa en knockout-mus. (6p) SV. 1.Isolera en genomisk klon som innehåller genen som ska inaktiveras. 2. Bestäm hur genen ska inaktiveras. T.ex ta bort hela genen eller någon exon. 3. Gör targeting konstruktet dvs en vektor som innehåller homologa DNA regioner som flankerar den del som ska deleteras. Vektorn ska även innehålla positiv selektionsmarkör (vanligtvis neo) som ska ligga mellan de homologa regionerna och en negativ selektionsmarkör (vanligtvis tk) som ligger utanför en av de homologa regionerna. 4.Llinjärisera vektorn och transfektera in den i ES celler. 5.Odla ES cellerna med G418 och gancyclovir och klona celler som överlever selektionen. 6. Genotypa ES klonerna med Southern blot analys och välj ut en klon som har den önskade mutationen. 7. Injecera ES celler i blastocyster och inplantera den i en mushona. 8. De möss som föds kallas chimära möss och de har celler både från ES klonen och blastosysten. 9. Avla chimära möss med svarta möss. Om avkomman är brun så kan de mössen ha mutationen och i så fall så är en genkopia muterad dvs mössen är heterocygota. 10.Avla heterocygota möss och deras avkomma kan innehålla homocygota möss (knockout möss) 11
27. Give three examples of non-covalent interactions in proteins and describe them shortly (one-two sentences). (6p) - Hydrogen bond: bond between a hydrogen donor (e.g. amide-nh) and a hydrogen acceptor (e.g. amide-c=o). The distance between donor and acceptor atom is approximately 3 Å. - Ionic interaction: Ionic bond between the side-chain of a negatively charged residue (e.g. glutamate) and the side-chain of a positively charged residue (e.g. arginine). - Other electrostatic interactions: interaction of permanent dipoles with charged groups or other permanent dipoles. - Van der Waals interaction: attractive interaction between temporary dipoles. Van der Waals interactions can be made by all kinds of atoms. - Hydrophobic interaction: increased interaction of hydrophobic groups caused by the exclusion of unfavorable contacts between hydrophobic groups and a polar/charged environment. 12
28. Beräkna risken för patienten att vara bärare av ett autosomalt recessivt anlag om: a) en förälder har sjukdomen b) ett syskon har sjukdomen c) ett syskonbarn har sjukdomen d) en farbror har sjukdomen e) en kusin har sjukdomen Rita släkttavla och ange hur du har beräknat risken. (5p) Svar: a) 100% b) 2/3 c) 1/2 d) 1/3 e) 1/4 13
14
15
29. Estrogen receptor alpha is the major target in the treatment of breast cancer. It was reported that ERalpha can be activated by phosphorylation at serine 118 (S-118) by glycogen synthase kinase 3. In order to block ERalpha activity in breast cancer a company wants to develop an inhibitor for glycogen synthase kinase 3 (the enzyme that phosphorylates ERalpha). In an assay they mix the enzyme, the potential inhibitor and ERalpha, purify the ERalpha peptide that is supposed to be phosphorylated and analyze is by mass spectrometry. In figure 1 you can see a detail from the mass spectrum (the b-ions are removed!). A, Please confirm the expected sequence QLSPFLQPHR by manual sequencing! (3p) B, Please indicate the phosphorylation site and explain why do you think this site is phosphorylated. (1p) C, Please explain how mass spectrometry can be used in diagnositics of the glycogen synthase kinase 3 activity status in breast cancer patients. (2p) (molecular weights of some amino acids: S: 87, G: 57, T: 101, Y: 163, H: 137, A: 71, R: 175, K: 147, M: 131, D: 115, W: 186, Q 128, P 97, F 147, phosphorylation: +80) I 1302 175 1174 202 312 409 537 650 439 625 894 797 1061 1077 1200 m/z Figure 1: Fragment spectrum of the peptide m/z 1302 of ERalpha. 16
1b, Phosphorylation adds an extra mass of 80 Da to a serine site (87) so that the difference between the previous amino acid and a ps is 167. 1c, Active glycogen synthase kinase 3 phosphorylates estrogen receptor alpha at serine 118. In case of high activity of this enzyme in breast cancer one can expect to find high amount of phosphorylated ERalpha. The phosphorylation status of ERalpha, however, can be monitored by mass spectrometry. 175=R 137=H 97=P Sequence: Q(I/L)pSPF(I/L)QPHR 128=Q I 113=I/L 147=F 1302 97=P 167=87+80=pS 175 113=I/L 1174 312 128=Q 1061 409 894 537 650 202 797 439 625 1077 1200 m/z 17