Tentamen Molekylärbiologi T3 / HT VG = 64-80p G = 44-63p U = 0-43p

Transkript

1 ummer Tentamen Molekylärbiologi T3 / T KTSVASFÅG 1. Årets obelpris i medicin gavs för upptäckten av sia. Till vad brukar sia användas? (1p) sia används till att reducera mängden av ett specifikt ma, dvs uttryck av en viss gen i en cell. 2. Vilken enzymatisk aktivitet har alkaliskt fosfatas och vad är dess vanligaste användningsområde? (2p) Alkaliskt fosfatas spjälkar bort fosfatgrupper. Vanligaste användning är att ta bort fosfatgrupp från 5 ända av klyvd plasmid för att förhindra återligering utan fragment. 3. What kind of different primers can be used for first strand cda synthesis? (2p) Två olika typer av primer finns dels oligo-dt primer och random hexamers primers. ligo-dtbinder till polya svansen och random hexamers binder slumpmässigt till ma. 4. ämn tre metoder som kan användas för att bevisa en interaktion mellan två proteiner. (3p) Jäst två-hybrid GST-pulldown Biacore Mammalian två-hybrid o-immunoprecipitation 5. ämn sex olika steg med vilka genexpression kan regleras i eukaryoter (3p). På A nivå -4 steg: transkriptionskontroll, A processningskontroll, A transport och A lokalisering samt ma nedbrytning På protein nivå 2 steg: protein syntes och protein nedbyrtning. (se Alberts Figur 7-5) 1

2 ummer Tentamen Molekylärbiologi T3 / T Explain the difference between agonist and antagonist ligands? (2p) Agonist promote coactivator recruitment and transcriptional activation, antagonists prevent. 7. What are the 2 main types of antibodies used in immunohistochemistry and Western Blotting and briefly explain the differences? (3p) polyclonal. aised in a variety of animals by injecting purified antigen into the animal and then the serum collected. ontain antibodies that recognize and bind to a variety of epitopes on an antigen. The antigen is more likely recognized after denaturation so beneficial for Western blots monoclonal. These antibodies are identical and bind to a single epitope. After an animal is injected with the antigen the B cells are removed and are fused to tumor cells in culture- therefore large amounts can be produced. igh specificity therefore can give less background than polyclonal. 8. Mention an assay suitable for studying effects on gene expression of a compound. (1p) eal time qp or micro array 9. Vid framställning av knockoutmöss används vanligen både positiv och negativ selektion. A. Varför? B. Vilka är de vanligaste selektionsmarkörerna? (3p) SV. A. Eftersom homolog recombination sker väldigt sällan måste celler där det skett selekteras och för att förhindra att targeting konstruktet integreras slumpmässigt i genomet används negativ selektion. B. De vanligaste seletionsmarkörerna är: Positiv: eo som gör cellerna resistenta mot G418 egativ: SV-tk som gör cellerna känsliga för Gancyclovir. 2

3 ummer Tentamen Molekylärbiologi T3 / T Ungefär hur många unika gener tros finnas i det mänskliga genomet och hur många tros uttryckas i en typisk cell?(2p) a 22,000-25,000 unika gener (genomet), ca 10,000-15,000 olika gener uttryckta (transcripts/ma) per cell. (Men totalt ca 200, ,000 ma molekyler/cell, dvs flera av många) 11. You know that the two transcription factors estrogen receptor and p300 interact with each other in vitro. Furthermore, they both bind to the promoter of the ps2 gene. Which method do you use to test whether they are in the same complex on the promoter? (1p) e-hip analysis elegans worms and embryos are transparent. This feature made it possible to obtain what kind of information about development? (2p) - it was possible to describe the complete cell division patterns of all cells from the single cell to the adult. the complete cell division pattern, the cell lineage is know. all somatic cells are known and described. the cell number is known (558 at hatching in hermaphrodite, 959 in adult hermaphrodite) 13. Which methods can be used to visualize the expression pattern/tissue distribution of a gene in zebrafish embryos? ame each method and describe what can be visualized with each of the methods. (3p) In situ hybridization for visualization of ma distribution (1p) immunohisto(cyto)chemistry for visualization of protein distribution (1p) transgenic embryos: promoter-gfp fusion constructs microinjected into embryos to visualize tissue-specific promoter driven GFP expression (1p) e.g. shh promoter-gfp: GFP is observed under a fluorescence microscope where Shh is expressed during development. (also T-P, orthern blot analysis) 3

4 ummer Tentamen Molekylärbiologi T3 / T What is codon usage and why is it important when over-expressing heterologous proteins for structural studies? (2p) With the exception of Met and Trp (which are encoded by single codons), in the standard genetic code each amino acid is encoded two or more synonymous codons. owever, not all isoacceptor transfer As (tas that recognize the different synonymous codons for each amino acid) are equally abundant in the ta pool of a given organism; accordingly, different "preferred" synonymous codons for a given amino acid can be recognised in the genome of different organisms. This phenomenon is called codon usage bias and can have a strong impact on heterologous protein production for structural studies. This is because the codon usage of the organism from which the gene to be expressed derives (for example, human) can be significantly different from that of the host organism used for its expression (for example, E. coli), often resulting in low yields of recombinant protein. Two ways to overcome this problem are: (1) co-expression of ta isoacceptors for codons that are rarely found within the protein-coding genes of the host organism (for example, tas recognising Arg codons AGA, AGG and GA that are rarely used in E. coli but common in human genes) and (2) use of a synthetic gene coding for the protein of interest, whose DA sequence has been optimised to match the specific codon usage of the host organism. 4

5 ummer Tentamen Molekylärbiologi T3 / T edanstående diagram visar tre idealiserade cirkulärdikroism spektra. Identifiera vilken typ av sekundärstruktur de representerar: (3p) A= B= = A=alfa, B=beta, =annan A B nm Varför kan den instrumentella upplösningen hos ett modernt transmissionselektronmikroskop (1-2 Å) i allmänhet inte uppnås för ett biologiskt preparat (3Å eller sämre)? (2p) Biologiskt material är mycket känsligt för elektronstrålen. Det innebär att dosen måste hållas låg vilket innebär att bilderna innehåller mycket brus. 17. Which steps are necessary in a crystal structure determination? (4p) Protein preparation rystallization and testing crystals Data collection Determination of phases Model building efinement Validation of the resulted structure 5

6 ummer Tentamen Molekylärbiologi T3 / T bonds (4p) Use a similar drawing as the template above and connect, with dotted lines, the atoms involved in hydrogen bonds (minimum four hydrogen bonds per assignment) found in a. Alpha helices b. Parallel beta sheets a. α-helix: b. Parallel beta sheets: (5) (9) (6) (10)

7 ummer Tentamen Molekylärbiologi T3 / T Förklara följande termer; (4p) a) Inversion b) eciprok translokation c) Mosaicism d) Deletion a) Strukturell intra-kromosomal avvikelse. Efter två kromosombrott på samma kromosom sker en rotation av det interstitiella kromosomsegment. b) Ett ömsesidigt utbyte av kromsommaterial mellan två eller flera kromosomer. c) Individ bestående av flera olika cellinjer (som härstammar från samma zygot). d) Förlust av kromosommaterial. 20. Beskriv kortfattat positionskloning. (4p) Identifiera kromosomregion (genom kromosombrott eller kopplingsanalys) Identifiera generna i regionen (databaser) Utse kandidatgener Prioritera och mutationsscreena i patientmaterial (Bekräfta) 21. Vad innebär det om två gener är homologa? Ge ett exempel. (2p) De har ett gemensamt evolutionärt ursprung. omologa gener kan vara ortologa eller paraloga. Exempel på ortologa gener är insulingenen i människa och schimpans. 23. Vad innebär det om två gener är paraloga? Ge ett exempel. (2p) omologa gener som har uppstått genom genduplikation. Exempel på paraloga gener är hemoglobin α1, α2, β1, β2 och myoglobin i det mänskliga genomet. Ett annat exempel är humana Eα och Eβ. 24. Ge två exempel på språk/plattformar som är vanligt använda inom bioinformatiken?(2p) Java, Perl, Python 7

8 ummer Tentamen Molekylärbiologi T3 / T BEÄTTAFÅG 25. A) Ge förslag på två primers som kan användas för att amplifiera nedanstående sekvens med P. (4p) B) Beskriv hur man kan gå till väga för att klona DA-sekvensen till plasmiden pgem-t-easy (dvs TA cloning) samt verifierat att kloningen fungerat. Ange alla enzymer som du kommer att använda. ita gärna figur. (3p) GAGTTGGTAGGTGGAGTTGAGTGTGGTTAGTGGAT TTGTGAGGTAGTGAAAGTTGAATGAGTAGGATGGTAG 5 GAGTTGGTAGGTGG 3 sense 5 GTAGATGTATG 3 antisense 1) P produkt renas på agarosgel 2) Produkten ligeras till pgem-t-easy med T4-DA ligas. 3) Ligeringen transformeras in i E.oli och stryks ut på LB-Amp plattor. 4) Bakteriekollonier odlas upp i närvaro av ampicillin. 5) Plasmid preppas med kit. 6) Plasmid klyvs med lämpligt enzym som finns i polylinker av pgem-t- Easy. T. ex EcoI. 7) Klyvningen separeras på agarosgel vid sidan av DA storleksmarkör 8) Utvärdera om den utklyvda produkten har förväntad storlek. 8

9 ummer Tentamen Molekylärbiologi T3 / T A protein sometimes is not able to fold even though the folded state is the energetically favored state. Explain this situation in terms of energy and describe possible ways to overcome such a barrier. (6p) free energy G Energy barrier E G f Unfolded state ative (folded) state G f is the free energy of folding. G f is generated when the protein is brought from the unfolded (high energy state) into to folded state (low energy state). If G f is positive then no net energy is needed to bring the protein into the folded state (folding is spontaneous). owever, if there is an energy barrier E then the protein will only fold, if this energy is added to the system. Folding intermediates can be trapped for instance by formation of incorrect disulfide bonds or aggregation via exposed hydrophobic areas. Two principle strategies exist to overcome energy barriers: adding energy to the system or lowering the energy barrier. Wrongly formed disulfide bonds can be reopened by addition of mercaptoethanol or through the action of protein disulfide isomerases. Protein complexes like chaperones assist proteins either to fold correctly (by lowering energy barriers) or help proteins to unfold in order to reverse incorrect folding. 9

10 ummer Tentamen Molekylärbiologi T3 / T Describe at least four biological processes where programmed cell death is relevant for normal development to occur. Give reasons why programmed cell death is important in the respective cases. (4p) removal of cells in the interdigital space between fingers and toes important for the respective limb ends to fulfill their functions neurons that do not at all or do not properly connect to other neurons or muscles (via synapse formation) are removed important to avoid an informational dead-end situation, where a neuron cannot pass on relevant information T and B cells that do not fit properly into a mounting immune response are removed important for the organized and successive specificity enhancing qualities of mammalian immune responses, following the concept better dead than wrong removal of cells in the tail of the tadpole, when it changes into an adult frog, which only has a tail stump 10

11 ummer Tentamen Molekylärbiologi T3 / T A) verexpression and enhanced activity of the epidermal growth factor receptor (EGF) is often observed in human cancers. EGF is a tyrosine phosphotransferase (kinase) and abnormal EGF-kinase activity is related to poor prognosis. Upon binding of the ligand EGF undergoes autophosphorylation (self phosphorylation), an important step in EGF signal transduction. Figure 1 shows the fragment spectra of the peptide (PDYQQDFFPK) generated from isolated EGF. Please confirm the predicted sequence and mark the phosphorylation site. (4p) 1364 I m/z Figure 1: Fragment spectrum. (m/z A=71, P=97, V=99, I,=113, =114, D=115, M=131, =137, F=147, K=129/147, Q=128, Y=163, phosphorylation = +80) B) A pharmaceutical company wants to produce inhibitors against EGF-kinase for cancer therapy. Please explain briefly how mass spectrometry can help to identify an inhibitor compound. (2p) A) K = 147 P = = 97 F = = 147 F = = 147 D = = 115 Q = = 128 Q = = 128 Y = = 243 fosforylerad -80 = 163 D = = 115 P = = 97 B) EGF genomgår autofosforylering då ligand binder till receptorn. Masspektrometri kan användas för att undersöka om ett ämne förhindrar denna autofosforylering och vara ett möjligt läkemedel mot cancer. 11