Major Mouse Testing Program: Longevity

Storlek: px
Starta visningen från sidan:

Download "Major Mouse Testing Program: Longevity"

Transkript

1 Major Mouse Testing Program: Longévité Santé Longevity 01/01/15 Kartläggning av långsiktiga hälsoeffekter : Storskaliga tester på åldrade möss för att hitta de mest effektiva terapierna mot åldrande och åldersrelaterade sjukdomar. 1

2 Denna presentation är tillägnad Dr. L. Stephen Coles, M.D., January 19, 1941 December 3, 2014, som var en pionjär inom gerontologi och forskning inom livsförlängning. Stephen Coles sammanställde en mail-lista för experter på möss I USA med några nyckelpersoner som volontärer för projektet. Dessa skulle skapa diskussioner för att se vad som kunde uppnås och om detta kunde leda till resultat. Sändlistan Gerontologi Research Group som han drev under många år är en stor källa till inspiration för projektet. 01/01/15 Major Mouse Testing Program 2

3 En revolution har skett I nematoder ( C. elegans ) Livsförlängning: Revolutionen Revolutionerande upptäckt år 1980: 8 sätt att förlänga deras liv [1] År 1993, en mutation som dubblade livslängden, med god vitalitet [2] År 2003 tusentals studier på livslängd; ungefär 10% förlängde livet.[3] År 2008, En mutation fördubblade livslängden 10-falt! PAST Maskar och möss åldras på olika sätt Maskar har ett fixerat antal celler: Att förlänga cellens liv är nyckeln Möss är däggdjur och att regenerera vävnader är nyckeln. Revolutionen för livsförlängning har nått möss och ser lovande ut för människor. Revolutionen har nått möss, men få tester görs. Livsförlängande behandlingar som är hittills kända att ha effekter på mänskligt åldrande (tex läkemedlen aspirin, metformin, metoprolol, rapamycin) Livsförlängande genetiska mönster I möss hittades i familjer med minskad risk för åldersrelaterade sjukdomar (Laron-dvärgar, Foxo-3A, akt-1) Låt oss utföra ett stort antal parallella livslängsstudier på möss på sätt som kan överföras till människor. NOW 01/01/15 3 Major Mouse Testing Program

4 Översikt av testprogrammet Tidslinje - En studie med redan åldrade m ö ss kommer startas och pågå 18 månader. - En annan studie kräver att vi skapar nya stammar av möss och kommer pågå 38 månader. Resultaten kommer kollas upp 3 gånger och justeras så att de kan överföras på människor. De flesta resultat kommer komma kring 5 år efter att de startats. Folk för jobbet Vi har pratat med ett antal forskare och identifierat en grupp med rätt djurhållning och erfarenheter för att göra tester på livslängd och inom regenerativ medicin. Budget Den förväntade kostnaden för att hålla 1000 olika tester är 20M. Det finns också en direkt korrelation mellan finansiering, antalet tester och schema. Förväntade resultat Basert på tidigare erfarenhet förväntar vi oss 100 resultat av 1000 tester att vara positiva: - I nematoder, 10% av testerna var positiva (många tester gjordes) - I möss, ~10% (Svårt att uppskatta då få test har gjorts, ITP+Spindler) Förväntde fördelar: 1. Få till en förändring I samhället 2. Resultaten ska ge en generell överblick kring vad som förlänger liv. 3. Vi hoppas uppnå betydande livsförlängning. 4. Vi hoppas detta gäller människor. Applicera för att se effekt på människors livslängd Om vi startar våra testprogram detta år förväntar vi oss att se konkreta resultat på mindre än 10 år. 01/01/15 Major Mouse Testing Program 4

5 Vad testa?: Källor till interventioner Partiella resultat redan Flera ideer Longevity DB: över 1000 interventioner Databas som listar mänskliga gener kopplade till långt liv. För många av dem kan man testa om det finns en koppling till möss.. Lifespan Observation Database 3359 rapporterade fall av livsförlängning: I gnagare (114;ofta oklara med lovande resultat), nematoder (2400), andra arter. mer bekräftelser behövs hos möss. Facebook group: PotentialGerontodrugs över 300 inlägg just nu Varje inlägg är en potentiellt livsförlängande intervention som kan testas på möss. https://www.facebook.com/groups/gerontodrugs Andra källor Olika liknande databaser har hittats. Numerous relevant forums and mailing lists are analyzed. Vi har också låtit ett papper cirkulera påkonferenser för åldrandeforskning för att lista ideer.. Antalet interventioner är enormt. Analyser pågår för att bestämma prioriteringar. 01/01/15 Major Mouse Testing Program 5

6 Vad att testa?: typer av interventioner Läkemedelsbehandling för människor Läkemedelsbehandling hos möss. Läkemedelsbehandling hos mänskliga populationer som tros leda till långa friska liv hos människor. Konceptet: Om möss lever länge och är friska, detta är orsak att tro på ett kausalt samband mellan hälsa hos människor and och en sådan genterapi är förmodligen effektiv hos människor också.. Fundamentala forskningsresultat Olika behandlingar på möss : Normalt in vivo och in vitro resultat från möss, råttor, nematoder eller fruktflugor med betydande resultat på livslängd & den friska livstiden på något sätt som kan införliva hos människor.. Varierande behandlingar Mänskliga genvarianter För varianter som hittas I mänskliga populationer som tros leda till långa friska liv hos människor, och kan förlivas till en genterapie hos åldrade möss. Konceptet: Om möss lever länge och är friska, detta är orsak att tro på ett kausalt samband mellan hälsa hos människor and och en sådan genterapi är förmodligen effektiv hos människor också Genterapier för möss Databas för interventioner 01/01/15 Major Mouse Testing Program 6

7 Övergripande schema Fas I 1 år Bilda grupper Insamling av pengar Test som startar med redan åldrade möss Fas II 2 månader Fas III 14 månader Fas IV 18 månader Fas V 18 månader Förberedelse av utrustning Test av 40 till 400 terapier Bekräfta och optimera resultat Initiera protokoll hos människor Testen startar med att sätta upp en stamm av möss 2 månader 38 månader 18 månader 18 månader Förberedelse av utrustning Testa 60 till 600 behandlingar Bekräfta och optimera resultaten Initiera protokoll hos människor Antalet interventioner att testa beror på finansieringen 2 m (*) = 100 Behandlingar 10 positiva resultat 20 m (*) = 1000 Behandlingar 100positiva resultat Den finansiella uppskattning beräknas sidan 17. Förutom bedömning kommer antalet utförda tester vara den som tillåts av finansieringen. 01/01/15 7 Major Mouse Testing Program

8 preparation Fas III layout 6 månader 30 hanar 30 honor 18 månader 14 månader 18 månader: Behandling påbörjas? De positiva resultaten av fas III leder till fas IV : bekräfta resultat och finjustera, mössoch råttor i andra labb + Studera olika hälsoeffekter 32 månader gammal: Så, förlängde behandlingen livslängden jämfört med den stora kontrollgruppen som levde paralellt? Beslut för nästa steg Fas III a: Påbörja med unga möss. För de flesta genetiska och flera andra behandlingar. Fase III b: Testa I verkligheten Läkemedel, genetiskt, övrigt 01/01/15 Major Mouse Testing Program 8

9 Generell organisation Givare Tillgångar Resultat Grupp Longévité Santé, ILA Producenter av möss Möss Faciliteter 01/01/15 Major Mouse Testing Program 9

10 Nuvarande Att göra - lista Identifiera och dela upp möjliga interventioner Arbete pågår Hitta möjligheter till finansiering Idag Förfina testerna och metodologin med labben Arbete pågår Hitta labb anpassade för jobbet och gå igenom villkoren med dem Kontakta möjliga finansiärer. Gör generella avtal Beräkna kostnader för experiment (Utrustning & personal) Arbete pågår Detaljerad förhandling om finansiering Erhålla nödvändiga medel för att påbörja projektet Framtid 01/01/15 Major Mouse Testing Program 10

11 Grupper och laboratorier Laboratorier med djurhållning av högsta kvalitet (burar med individuella filter och ventilation) och specialiserad på regenerativ medicin och forskning kring åldrandeprocesser. Arlan Richardson 40 års erfarenhet i långvariga tester på gnagare (substanser och genterapier) Laboratory USA (Oklahoma) Alexandra Stolzing Regenerativ medicin & stamcellers åldrande Translational Centre for Regenerative Medicine Leipzig University (Leipzig) Jean-Marc Lemaitre Regenerative Medicine på möss och människoceller (stamceller och genterapi) Inserm i Frankrike (Montpellier) 01/01/15 Major Mouse Testing Program 11

12 Speciellt tack till vår volontärgrupp: Volontärgrupp Huvudgrupp: Edouard Debonneuil, Rached Messaoudi, Valentin Socolov, Martin Dinov, Daniel Krochmal, Maciej Michalak, Nicoleta Reinald Med hjälp ifrån: Steve Coles (avliden), Johnny Adams, Daria Khaltourina, Matthew Scholtz, Didier Coeurnelle, Anton Kulaga, Paul Spiegel, Liz Parrish, Alexandru Chircu, Alexandre Blanc, Dmitri Borisoglebsky, Victor Björk, och många andra forskare och online volontärer. Longévité & Santé, Kvällsmöten för att organisera projektet på La Paillasse, Paris. Medhjälpare från olika länder och vid olika tillfällen 01/01/15 Major Mouse Testing Program 12

13 Tack för er uppmärksamhet! Den uppdaterade versionen av denna presentation finns på Vill du hjälpa till?, Donera genom paypal på Eller på xxx(under utveckling) om du är amerikansk medborgare. Kontakta för att föreslå specifik hjälp Specifik volontärtjänstgöring vi tänker på: Om du har erfarenhet kring tester av livlängd hos möss eller in vivo genterapitekniker, eller att hantera läkemedel I mat,eller något annat kring att designa projektets tillvägagångssätt. Om ni känner till källor till finansiering, som du tror motsvarar vad vi behöver, oeller är intresserade av att skriva brev för finansiering, kontakta oss. Presentera projektet på en konferens eller översätta till ett annat språk. Note: Vi är medvetna om att de olika urls/ s I denna slide inte är likadana. Vi jobbar för mer liknande namn på kommande presentationer (SLS stands for Sceaux Longévité Santé, ALA fö American Longevity Alliance, Ingen av de är vinstdrivande [Franska och amerikanska] associationer för International Longevity Alliance) 01/01/15 Major Mouse Testing Program 13

14 Appendix Recap på 3 slides. Lista på behandlingar på möss Tekniker för genterapi Övrigt 01/01/15 Edouard Debonneuil -- Mouse Lifespan Fast Track project 14

15 Idag är det mindre än 10 riktiga tester på gnagare per år Vårat mål: 1000 tester på mindre än 5 år I nematoder, 10% av tusentals tester är positiva På möss, ungefär 10% [5/67 av Spindler.S och 5/15 tester genom ITP, 1-2 gemensamt] : Interventions testing program, USA: - NDGA (Hanar, +10% livslängd) - Rapamycin (hanar, & honor, %) - Acarbose (Hanar, +22%) - Aspirin (hanar, +10%) - α-estradiol (Hanar, +10%) Aspirin: lägre mortalitet Bekräftat på människor (80 mg/day,mer än 5 år) Everolimus: testas på äldre(stärker effekt av influensavaccin) Metformin: Minskad mortalitet bevisat hos människor Andra resultat hos gnagare kollas upp (fullerener) 01/01/15 Major Mouse Testing Program 15

16 Förväntade Resultat 1 Upptäckter hos möss kan göra stor skillnad I hälsa hos människor Få till en förändring I samhället Applicerad biologi på livsförlänging flera terapier som kan förändra åldrandeprocessen, kan man mångdubbla livslängden hos möss? En brytning I forskning om livsförlängning Visa vad som förlänger livet och mekanismerna bakom. Tillsammans med mänsklig statistik, Vi hoppas ha användbara resultat inom 5 år. Betydande livsförlängning Bland de många förväntade resultaten, är förhoppningen att en del leder till en mycket stark livsförlängning. Ett nytt område inom farmaci: läkemedel för långtidshälsa Upptäcka nya användingsområden för redan existerande läkemedel. 01/01/15 Major Mouse Testing Program 16

17 Finansiering & Budget Notera: Kostnader justeras. Antalet tester beror på finansieringen. Fas III Anta att 400 terapier görs med gamla möss och 600 terapier behöver en ny stamm av möss; varje experiment behöver 60 möss (30 hanar och 30 honor) och varje av de 2 systemen (åldrade möss/nya stammar av möss) behöver en kontrollgrupp med 1000 möss (asymmetrisk design; 50% hane-hona). Anta att mushanteringen kostar 1.5 för varje mus och vecka (beror på hur de lever) och att möss lever I genomsnitt 27 månader. En snabb kalkyl ger att kostnaden att hantera möss är 1.5*(27*(600* )+9*(400* ))*(30.5/7) = 8 M Anta att varje åldrad mus kostar 100 och varje ung transgenisk mus kostar 30 att producera. Den initiella kostnaden är(600* )*100+(400* )*30 = 4.5 M Totalen för Fas III är 12.5 M Fas IV Anta att 10% av terapierna är fas III leder till en fas IV,och I genomsnitt för en terapi fas IV kostar det 6 gånger så mycket som fas III (förlivsförlängningen måste bli bekräftad och justerad). Kostnaen av fas IV är 12.5*10%*6 = 7.5 M Total Totalkostnaden för att testa 1000 terapier borde ligga runt = 20 M,enligt ovanstående antagande. De största kostnaderna är understrukna ovan 01/01/15 Major Mouse Testing Program 17

18 Terapier att testa på möss Exempel på terapier ifrån guppen på Facebook Control life extensions: aspirin, metformin, rapamycin, statins H I G H P R I O R I T Y Snell, Ames, IGF-1 mutationer vid hög ålder TA-65, other telomerase activator, and human telomerase variant TM5441 (fyrdubblar den friska livslängden; minskade nivåer av senescence marker PAI-1) Centrophenoxin/Meclofenoxate: minskade nivåer av lipofuscin & ej publicerad livsförlängning hos råttor. Pharmacoperones (inverterar GNRHRmutation) Neuraminidase 1 supplementation (rapporteras att delvis minska Alzheimer s sjukdom) GDF11 injektioner (rapporteras att delvis minska åldrande I hjärta och hjärna hos möss) D-Glucosamine (imiterar effekter av kalorirestriktion, rapporterad livsförlänging hos åldrade möss Dimethylaminoethanol (förlängda livstider rapporterade; lägre doser bör testas) Trehalose (förändrar autofagi; förändrar IGF-1 axis; clears proteins related neurodegener.) LysoSENS s nedbrytning av 7-ketoCholesterol (bör snart vara redo att testa) Genetisk stabilisering av transthyretin-strukturer)... [Många övriga.] M I D Biphosphonates (tas mot osteoroporos men verkar reducera mortalitet på andra sättet) Fullerenes supplementation hos råttor (+90% ökning I livslängd har apporterats) Tafamidis (behandling av familjära transthyretin-sjukdomar) NAD+ supplementation... [Många övriga] 01/01/15 Major Mouse Testing Program 18

19 Många lovande behandlingar! 1. Genterapier hos människor Genterapier hos möss. För varianter som hittas I mänskliga populationer som tros leda till långa friska liv hos människor, och kan förlivas till en genterapie hos åldrade möss. Konceptet: Om möss lever länge och är friska, detta är orsak att tro på ett kausalt samband mellan hälsa hos människor and och en sådan genterapi är förmodligen effektiv hos människor också. 2. Läkemedelsbehandling hos människor Läkemedelsbehandling hos möss. Läkemedelsbehandling hos mänskliga populationer som tros leda till långa friska liv hos människor. Konceptet: Om möss lever länge och är friska, detta är orsak att tro på ett kausalt samband mellan hälsa hos människor and och en sådan genterapi är förmodligen effektiv hos människor också. 3. Fundamentala forskningsresultat. Olika behandlingar på möss : Normalt in vivo och in vitro resultat från möss, råttor, nematoder eller fruktflugor med betydande resultat på livslängd & den friska livstiden på något sätt som kan införliva hos människor. 01/01/15 Major Mouse Testing Program 19

20 Ett exempel: transpose rs till möss Rs är en mänsklig variant av en gen somkodar för tubulin beta4b protein. Varianten motsvarar attha"t" någonstans. Den hittades i Framingham Heart Study, I Amerikanska medborgare, att de med 2 kopior av genen T har mindre hjärt-och-kärlrisker, mindre risk för cancer, och mindre risk för för tidig död än övriga, detta är statistiskt signifikant (p_value = 6e-53) Referens: https://www.ncbi.nlm.nih.gov/pmc/articles/pmc / Labbmöss som har samma gen! ("ortholog") detta indikerar att den har samma funktion I möss. Naturligt har de ett "C", inte ett "T". Därför vill vi ge samma variant, väldigt konkret, en del av denna gen i labmöss är "GCCGCATGTCTATGAAGGAGGTGGACGAACAGATGCTTAATGTCCAAAACA«, målet är att göra om den till "GCCGCATGTCTATGAAGGAGGTGGATGAACAGATGCTTAATGTCCAAAACA" genom att använda CRISPR teknologin. Om det gör att de lever längre (förbättrar deras hälsa etc)så indikerar det att det fungerar på människor Målet är att testa rs och andra potentiella medel (Vi har mer än 1400!). Vad som först kommer komma från mänsklig statistik och bekräftas hos möss borde fungera bra hos människor, så ganska troligt om inte projektet stoppas. - 5 år från nu kommer några personer (frst patienter och teknikintresserade äldre) kommer börja med genterapin och man kommer följa upp för att se om det är bra för deras hälsa., - Och potentiellt inom 10 år så kommer det bli vanligt to ta dessa genterapier för att leva längre I god hälsa 01/01/15 Major Mouse Testing Program 20

21 ålder: tekniker 1. Läkemedelskänsliga stammar av möss Varför skapa stammar av möss? Varför inte behandla normala, åldrade möss? Experter har förklarat att nuvarande tekniker för genterapi endast påverkar en mindre del av kroppen: även om en gen för långt liv introduceras, det ärosäkert om man kan få en betydande effekt med sådana tekniker, det finns en risk att förstöra det huvudsakliga testprogrammet dom föreslår att göra läkemedelskänsliga transgeniska möss (http://www.clontech.com/us/products/inducible_systems/protein) Teknik Fas 1 (6 månader): för varje testad genvariant, skapar man en stam av möss embryon sätts in i genvariant med läkemedelskänslig promoter med CRISPR-tekniken och sättas in i honor. Avkomman som innehåller mutationen för att bli korsade och producera 30 hanar och 30 honor. 30 hanar Fas 2 (18 månader): mössen matas och hushålls normalt. 30 honor De bör bete sig som kontrollen då inte genen är uttryckt. Fas 3 (14 månader): vid en ålder av 18 månader, ges de ett läkemedel? som sätter på genen. Deras överlevnadskurva jämförs med kontrollen Note: vi överger inte behandlingen av normala åldrade individer: a) Efter dessa 38 månader, fas IV: för de fall (10%?) som uppvisar en statistisk tydlig livsförlängning, genvarianten testas I åldrade rpttor och möss genom olika tekniker för genterapi (kommande slides) b) +In parallel under dessa 38 months, genterapitekniker (kommande slides) testas redan för de mest troliga generna för långt liv idag, för att göra de möjliga för människor, samt träna för a) 01/01/15 Major Mouse Testing Program 21

22 Gene age: Tekniker 3. Övergående genexpression vid 18 månader: minicircles burna av liposomala vektorer Innehåll Minicircles är DNA cirklar. Dom tenderar att ha högre effektivitet än AAVs för att de stimulerar inte immunsystemet och dom måste inte nå cellkärnan för att uttrycka önskad gen. Nackdelen är att behandlingen är övergående, det behövs regelbundna behandlingar, men detta är också en fördel eftersom det är en säkerhet att kunna stoppa behandlingar stoppa behandlingar om bieffekter dyker upp. Teknik Fas 1 (2 månader): för varje genvariant som blir testad: minicircles som innehåller genen produceras I tillräcklig kvantitet genom attmodifiera bakterier (en plasmid skapas I E. coli, de prokaryota delarna är förflyttade = minicircle) genom att använda CRISPRs; dom sätts in I liposomala vektorer och injiceras I unga djur för att se om det sprider sig. Fas 2 (14 månader): minicircles injiceras I 30 hanar och 30 honor, varannan vecka, startar vid en ålder av 18 månader. Deras överlevnad jämförs med kontrollgruppen. Att uppmärksamma test E. coli 30 males 30 females? Låg effektivitet: Även om effektiviteten är relativt hög för det nuvarande området för genterapi, är det fortfarande för lågt för att en livsförlängning ska upptäckas. Detta är anledningen till att vi först väljer livslängdsrelaterade gener baserat på teknik #1 som visades 2 sidor tidigare. Evolution: Området utvecklas snabbt. Dessa slides är därför enbart indikativa: Vi kanske väljer bättre tekniker när de kommer och är tydliga (microcircles, S/MAR elements ). 01/01/15 Major Mouse Testing Program 23

23 Gene age: Tekniker 4. Övriga En fråga om specificitet för vävnader För de flesta genvarianterna vi vill testa vet vi ej priorom det är vettigt att inrikta oss på ett visst organ. En familjär mutation som kan leda till ökad livslängd I olika populationer utan att veta om det beror på uttryck I en viss vävnad Därför är de tidigare sidorna om generella genterapier:som är uttryckta, så mycket som möjligt, genom kroppen. I sådana fall, såvida det inte redan demonstrerat att en genterapi förlänger livet, startar vi med tekniken #1: att ska en stam av möss och vänta hela deras livslängd. När målet är ett specifikt organ, så kan genterapi vara betydligt mer effektivt. Detta är typiskt för blodceller och leverceller. Ett snabbt växande område Precis som indikerat på den tidigare sliden, tekniken har förbättrats mycket inom området av genterapi. Det kan vara så att 6 månader efter att ett experiment startar, så kommer en betydligt bättre teknik Men det skulle vara värreatt behöva vänta årtionden på en sådan teknik. Det kan mycket väl vara så att tekniken #1 är ett konstgjortsätt att modellera en framtida genterapi som kan vara tillgänglig för gamla människor 5-10 år från nu. Från detta perspektiv så skulle den tekniken skulle vara mycket bättre än andra. (AAVs, minicircles eller andra inte så effektiva terapier.) 01/01/15 Major Mouse Testing Program 24

24 Referenser (sid 3) C elegans, revolutionen inom livsförlängning [1] Klass MR (1983). "A method for the isolation of longevity mutants in the nematode Caenorhabditis elegans and initial results". MECHANISMS OF AGEING AND DEVELOPMENT 22 (3-4): PMID [2] Kenyon C, Chang J, Gensch E, Rudner A, Tabtiang R (1993). "A C. elegans mutant that lives twice as long as wild type". Nature (journal) 366 (6454): PMID [3] Lee SS, Lee RY, Fraser AG, Kamath RS, Ahringer J, Ruvkun G (2003). A systematic RNAi screen identifies a critical role for mitochondria in C. elegans longevity. NAT GENET. PMID [4] Ayyadevara S, Alla R, Thaden JJ, Shmookler Reis RJ (2008). "Remarkable longevity and stress resistance of nematode PI3K-null mutants". AGING CELL 7 (1): PMID Den kommande revolutionen inom livslängder för möss Bartke A, Brown- Borg H (2004). Life extension in the dwarf mouse. CURR TOP DEV BIOL. 63: PMID Harrison, D. E., Strong, R., Sharp, Z. D., Nelson, J. F., Astle, C. M., Flurkey, K., Nadon, N. L., Wilkinson, J. E., Frenkel, K., Carter, C. S., Pahor, M., Javors, M. A., Fernandez, E. and Miller, R. A. (2009) Rapamycin fed late in life extends lifespan in genetically heterogeneous mice. NATURE 460: PMID Spindler SR, Mote PL, Li R, Dhahbi JM, Yamakawa A, Flegal JM, Jeske DR, Li R, Lublin AL (2013). β1-adrenergic receptor blockade extends the life span of Drosophila and long-lived mice. AGE. PMID Martin-Montalvo A, Mercken EM, Mitchell SJ, Palacios HH, Mote PL, Scheibye-Knudsen M, Gomes AP, Ward TM, Minor RK, Blouin MJ, Schwab M, Pollak M, Zhang Y, Yu Y, Becker KG, Bohr VA, Ingram DK, Sinclair DA, Wolf NS, Spindler SR, Bernier M, de Cabo R (2013). Metformin improves healthspan and lifespan in mice. NAT COMMUN. 4:2192. PMID /01/15 Major Mouse Testing Program 25

Med hopp om framtiden transposoner, DNA som flyttar sig själv

Med hopp om framtiden transposoner, DNA som flyttar sig själv Med hopp om framtiden transposoner, DNA som flyttar sig själv Jessica Bergman Populärvetenskaplig sammanfattning av Självständigt arbete i biologi VT 2008 Institutionen för biologisk grundutbildning, Uppsala

Läs mer

Stamceller är sådana celler som kan bli vilken sorts cell som helst Stamceller specialiserar sig så småningom till ex. muskelceller, blodceller,

Stamceller är sådana celler som kan bli vilken sorts cell som helst Stamceller specialiserar sig så småningom till ex. muskelceller, blodceller, Stamceller Vad är stamceller? Från början är vi bara en cell Den cellen delar på sig och blir 2 celler, 4 celler, 8 celler osv tills de är de 100 000 miljarder celler en vuxen människa består av Men alla

Läs mer

Sara Ekvall, doktorand Inst. för immunologi, genetik & patologi Uppsala universitet Handledare: Marie-Louise Bondeson & Göran Annerén

Sara Ekvall, doktorand Inst. för immunologi, genetik & patologi Uppsala universitet Handledare: Marie-Louise Bondeson & Göran Annerén Sara Ekvall, doktorand Inst. för immunologi, genetik & patologi Uppsala universitet Handledare: Marie-Louise Bondeson & Göran Annerén Celler & DNA Vår kropp är uppbyggd av ~100 000 miljarder celler I cellen

Läs mer

Klipp-och-klistra DNA: fixa mutationen med gen editering DNA, RNA och Protein

Klipp-och-klistra DNA: fixa mutationen med gen editering DNA, RNA och Protein Huntingtons sjukdom forsknings nyheter. I klartext Skriven av forskare För de globala HS medlemmarna. Klipp-och-klistra DNA: fixa mutationen med gen editering Forskare gör exakta ändringar av DNA i ett

Läs mer

Huntingtons sjukdom - en hjärnsjukdom

Huntingtons sjukdom - en hjärnsjukdom Huntingtons sjukdom forsknings nyheter. I klartext Skriven av forskare För de globala HS medlemmarna. Benmärgstransplantation vid Huntingtons sjukdom Benmärgstransplantation skyddar HS-möss från vissa

Läs mer

Forskning om diagnos och behandling vid Alzheimers sjukdom

Forskning om diagnos och behandling vid Alzheimers sjukdom Forskning om diagnos och behandling vid Alzheimers sjukdom Erik Portelius Sahlgrenska Universitetssjukhuset, PhD Institutionen för neurovetenskap och fysiologi vid Göteborgs Universitet Kompetensutveckling

Läs mer

Cover Page. The handle http://hdl.handle.net/1887/20257 holds various files of this Leiden University dissertation.

Cover Page. The handle http://hdl.handle.net/1887/20257 holds various files of this Leiden University dissertation. Cover Page The handle http://hdl.handle.net/1887/20257 holds various files of this Leiden University dissertation. Author: Fredriksson, Lisa Emilia Title: TNFalpha-signaling in drug-induced liver injury

Läs mer

Genterapi. Varför genomförs genterapi? Förutsättning för genterapi är att den genetiska skadan är känd!

Genterapi. Varför genomförs genterapi? Förutsättning för genterapi är att den genetiska skadan är känd! GENTERAPI - T3 HT 2009 Jan-Ingvar Jönsson Genterapi Överföring av terapeutisk (frisk) gen till sjuk cell eller vävnad Att reparera en skadad gen Att ersätta en skadad eller deleterad gen med en frisk gen

Läs mer

Selektion av resistenta bakterier vid väldigt låga koncentrationer av antibiotika.

Selektion av resistenta bakterier vid väldigt låga koncentrationer av antibiotika. Selektion av resistenta bakterier vid väldigt låga koncentrationer av antibiotika. Linus Sandegren Uppsala Universitet Inst. för Medicinsk Biokemi och Mikrobiologi linus.sandegren@imbim.uu.se Hur påverkas

Läs mer

Kancera AB 8 November 2011

Kancera AB 8 November 2011 Ursprung i Pharmacia & Karolinska Noterat på NASDAQ OMX First North februari 2011 20 läkemedelsutvecklare, 900 m2 laboratorier inom KI Science Park Kancera AB 8 November 2011 Kancera Fokuserar på elakartad

Läs mer

SShK Avelskonferens Lisbeth Plant. För frågor, kontakta:

SShK Avelskonferens Lisbeth Plant. För frågor, kontakta: SShK Avelskonferens 2013-11-24 Lisbeth Plant För frågor, kontakta: billisbeth@shaw.ca I slutet av 1960-talet skapade Barbara & Martin Packard Berner-Garde databasen. Databasen var deras dröm för Berner

Läs mer

HUGO-projektet. Kartläggningen av det mänskliga genomet

HUGO-projektet. Kartläggningen av det mänskliga genomet Vem är HUGO? HUGO-projektet Kartläggningen av det mänskliga genomet Kartläggning av genom Genom= allt DNA hos en organism. Kartläggningen sker genom att man bestämmer DNA-sekvensen för hela genomet och

Läs mer

Tentamen Biologi BI1112 Termin och år: Klockan:

Tentamen Biologi BI1112 Termin och år: Klockan: Tentamen Biologi BI1112 Termin och år: 120312 Klockan: 0800-13.15 Betygsgränser:!!! 50-66%! Betyg 3!!!!! 67-83%! Betyg 4!!!!! 84-100%! Betyg 5 Fråga 1-4 Cellbiologi Fråga 5-7 Genetik Fråga 8-10 Växtfysiologi!!!!

Läs mer

Slurapport för 2015 Ett unikt svenskt system för toleransbehandling av reumatoid artrit

Slurapport för 2015 Ett unikt svenskt system för toleransbehandling av reumatoid artrit Slurapport för 2015 Ett unikt svenskt system för toleransbehandling av reumatoid artrit Övergripande måluppfyllelse: Projektet startades med tre målsättningar, vilka samtliga har uppnåtts under projektets

Läs mer

Det magiska med färgat ljus

Det magiska med färgat ljus Huntingtons sjukdom forsknings nyheter. I klartext Skriven av forskare För de globala HS medlemmarna. Upplysning av framskridandet av Huntingtons sjukdom Forskare har använt sig av möss med upplysta hjärnceller

Läs mer

Facit tds kapitel 18

Facit tds kapitel 18 Facit tds kapitel 18 Testa dig själv 18.1 1. Arvsanlagen finns i cellkärnan. Inför celldelningen samlas de i kromosomer. 2. Det kemiska ämne som bär på arvet kallas DNA. 3. Instruktionerna i DNA är ritningar,

Läs mer

Schema för BL2011 Gener, celler och populationer / Schema för BL2018 Cell- och molekylärbiologi: Mikrobiologi 4.5 hp, VT 2015

Schema för BL2011 Gener, celler och populationer / Schema för BL2018 Cell- och molekylärbiologi: Mikrobiologi 4.5 hp, VT 2015 Stockholms universitet Version: 141210 Inst. för biologisk grundutbildning Schemaändringar kan förekomma www.big.su.se Schema för BL2011 Gener, celler och populationer / Schema för BL2018 Cell- och molekylärbiologi:

Läs mer

Nobelpriset i fysiologi eller medicin år 2012. John B. Gurdon och Shinya Yamanaka. för upptäckten att mogna celler kan omprogrammeras till pluripotens

Nobelpriset i fysiologi eller medicin år 2012. John B. Gurdon och Shinya Yamanaka. för upptäckten att mogna celler kan omprogrammeras till pluripotens PRESSMEDDELANDE 2012 10 08 Nobelförsamlingen vid Karolinska Institutet har idag beslutat att Nobelpriset i fysiologi eller medicin år 2012 gemensamt tilldelas John B. Gurdon och Shinya Yamanaka för upptäckten

Läs mer

Tarmflorabakterier och D-vitamin viktiga byggstenar för vår hälsa

Tarmflorabakterier och D-vitamin viktiga byggstenar för vår hälsa Tarmflorabakterier och D-vitamin viktiga byggstenar för vår hälsa Mjölksyrabakterierna Lactobacillus acidophilus NCFM och Bifidobacterium Lactis Bi-7 utgör tillsammans med D-vitamin viktiga beståndsdelar

Läs mer

A k t i e s p a r a r n a Lund 31/1-17 M I C H A E L O R E D S S O N VD

A k t i e s p a r a r n a Lund 31/1-17 M I C H A E L O R E D S S O N VD NYA LÄKEMEDEL HJÄLPER KROPPENS I M M UNFÖRSVAR BEKÄMPA CANCER A k t i e s p a r a r n a Lund 31/1-17 M I C H A E L O R E D S S O N VD I M M UNONKOLOGISKA LÄKEMEDEL REVOLUTIONERAR BEHANDLINGEN AV CANCER

Läs mer

VARGAR OCH DNA ANALYS

VARGAR OCH DNA ANALYS VARGAR OCH DNA ANALYS KAJ GRANLUND FIL.MAG, PENSIONÄR I DAG VARGAR, I MORGON NÅGOT NYTT Junseletiken Värmlandsvarg, Sverige Min jycke från 1965 Nord Odal ulven fra Norge Auli, Finland - När allt som

Läs mer

Cancer som en ämnesomsättningssjukdom del 1

Cancer som en ämnesomsättningssjukdom del 1 Cancer som en ämnesomsättningssjukdom del 1 Artiklarna skrivna av Dr Georgia Ede (översättning S E Nordin) Thomas Seyfried PhD, en hjärncancerforskare med över 25 års erfarenhet inom området, gav en banbrytande

Läs mer

Genetisk variation är livsviktig för vitaliteten och ganska snabbt även en förutsättning för överlevnaden hos en art.

Genetisk variation är livsviktig för vitaliteten och ganska snabbt även en förutsättning för överlevnaden hos en art. Naturens behov av genetisk variation Genetisk variation är livsviktig för vitaliteten och ganska snabbt även en förutsättning för överlevnaden hos en art. Då vi benämner en art i naturen som utrotningshotad

Läs mer

Tiaminas och tiaminbrist i Östersjön. Svante Wistbacka Åbo Akademi

Tiaminas och tiaminbrist i Östersjön. Svante Wistbacka Åbo Akademi Tiaminas och tiaminbrist i Östersjön Svante Wistbacka Åbo Akademi Tiamin -Ett vattenlösligt vitamin i B-vitamin gruppen (vitamin B1) -Essentiell komponent i flera coenzym involverade i energimetabolismen

Läs mer

GODA ANLEDNINGAR. till att bevara ditt barns stamceller. Ge ditt barn en gåva för livet samla och bevara stamceller från navelsträngen

GODA ANLEDNINGAR. till att bevara ditt barns stamceller. Ge ditt barn en gåva för livet samla och bevara stamceller från navelsträngen Ring 040-15 22 22 eller gå in på stemcare.se om du vill bevara ditt barns stamceller 5 GODA ANLEDNINGAR till att bevara ditt barns stamceller Ge ditt barn en gåva för livet samla och bevara stamceller

Läs mer

Kvartalsrapport 3, 2012

Kvartalsrapport 3, 2012 Kvartalsrapport 3, 2012 Karo Bio 24 oktober 2012 Förutsättningar för positivt kassaflöde 2013 Kostnadsnivån har sänkts väsentligt Totalt 20,9 (52,8) MSEK i kostnader under Q3 2012 Intäkter på 8,1 (0) MSEK

Läs mer

Genetisk testning av medicinska skäl

Genetisk testning av medicinska skäl Genetisk testning av medicinska skäl NÄR KAN DET VARA AKTUELLT MED GENETISK TESTNING? PROFESSIONELL GENETISK RÅDGIVNING VAD LETAR MAN EFTER VID GENETISK TESTNING? DITT BESLUT Genetisk testning av medicinska

Läs mer

Använda kunskaper i biologi för att granska information, kommunicera och ta ställning i frågor som rör hälsa, naturbruk och ekologisk hållbarhet.

Använda kunskaper i biologi för att granska information, kommunicera och ta ställning i frågor som rör hälsa, naturbruk och ekologisk hållbarhet. Arvet och DNA Lokal pedagogisk planering årkurs 9 Syfte Naturvetenskapen har sitt ursprung i människans nyfikenhet och behov av att veta mer om sig själv och om sin omvärld. Kunskaper i biologi har stor

Läs mer

Mönster. Ulf Cederling Växjö University Ulf.Cederling@msi.vxu.se http://www.msi.vxu.se/~ulfce. Slide 1

Mönster. Ulf Cederling Växjö University Ulf.Cederling@msi.vxu.se http://www.msi.vxu.se/~ulfce. Slide 1 Mönster Ulf Cederling Växjö University UlfCederling@msivxuse http://wwwmsivxuse/~ulfce Slide 1 Beskrivningsmall Beskrivningsmallen är inspirerad av den som användes på AG Communication Systems (AGCS) Linda

Läs mer

Vad är repetitionslängd?

Vad är repetitionslängd? Huntingtons sjukdom forsknings nyheter. I klartext Skriven av forskare För de globala HS medlemmarna. Ny analys visar att den korta CAG-längden inte spelar roll Storleken är inte allt: forskning tyder

Läs mer

Vad händer i ett genetiskt laboratorium?

Vad händer i ett genetiskt laboratorium? 12 utveckla nya metoder eller låta sådana prover delta i kvalitetskontrollprogram, såvida inte patienten har uttryckt att man inte vill att ens prov ska vara del av sådan verksamhet. Som alla andra sparade

Läs mer

Nobelpriset i fysiologi eller medicin 2012

Nobelpriset i fysiologi eller medicin 2012 Nobelpriset i fysiologi eller medicin 2012 De öppnade en värld av möjligheter Årets Nobelpristagare har visat att livets väg inte behöver vara enkelriktad. De har upptäckt att kroppens vuxna celler kan

Läs mer

GODA ANLEDNINGAR. till att bevara ditt barns stamceller. Ge ditt barn en gåva för livet samla och bevara stamceller från navelsträngen

GODA ANLEDNINGAR. till att bevara ditt barns stamceller. Ge ditt barn en gåva för livet samla och bevara stamceller från navelsträngen Ring 040-692 23 27 eller gå in på stemcare.se om du vill bevara ditt barns stamceller 5 GODA ANLEDNINGAR till att bevara ditt barns stamceller Ge ditt barn en gåva för livet samla och bevara stamceller

Läs mer

Bilaga III. Ändringar i relevanta avsnitt av produktresumé, märkning och bipacksedel

Bilaga III. Ändringar i relevanta avsnitt av produktresumé, märkning och bipacksedel Bilaga III Ändringar i relevanta avsnitt av produktresumé, märkning och bipacksedel 20 PRODUKTRESUMÉ Detta läkemedel är föremål för utökad övervakning. Detta kommer att göra det möjligt att snabbt identifiera

Läs mer

Läkemedelsprövningar och slutsatser

Läkemedelsprövningar och slutsatser Huntingtons sjukdom forsknings nyheter. I klartext Skriven av forskare För de globala HS medlemmarna. TRACK-HD avslöjar betydande förändringar hos pre-symtomatiska mutationsbärare och personer med HS Ettårsrapporten

Läs mer

En sax för gener kan få Nobelpris

En sax för gener kan få Nobelpris En utskrift från Dagens Nyheters nätupplaga, DN.se, 2015 09 28 11:56:30 Artikelns ursprungsadress: http://www.dn.se/nyheter/vetenskap/en sax for gener kan fa nobelpris/ En sax för gener kan få Nobelpris

Läs mer

Genetik en sammanfattning

Genetik en sammanfattning Genetik en sammanfattning Pär Leijonhufvud $\ BY: 3 februari 2015 C Innehåll Inledning 2 Klassisk genentik 2 Gregor Mendel munken som upptäckte ärftlighetens lagar....... 2 Korsningsrutor, ett sätt att

Läs mer

Crafoordpriset i biovetenskaper 2015

Crafoordpriset i biovetenskaper 2015 RAFOORDPRISE I BIOVEENSKAPER 2015 POPULÄRVEENSKAPLI INFORMAION rafoordpriset i biovetenskaper 2015 rafoordpriset i biovetenskaper 2015 går till genetikerna Richard Lewontin, USA, och omoko Ohta, Japan,

Läs mer

Människor, möss och medicinsk etik. Anders Nordgren Professor i bioetik Centrum för tillämpad etik Linköpings universitet

Människor, möss och medicinsk etik. Anders Nordgren Professor i bioetik Centrum för tillämpad etik Linköpings universitet Människor, möss och medicinsk etik Anders Nordgren Professor i bioetik Centrum för tillämpad etik Linköpings universitet Etik och moral Etymologiskt: Etik från grekiskan: sedvänja Moral från latinet: sedvänja

Läs mer

Sammanfattning av riskhanteringsplan (RMP) för Cerdelga (eliglustat)

Sammanfattning av riskhanteringsplan (RMP) för Cerdelga (eliglustat) EMA/743948/2014 Sammanfattning av riskhanteringsplan (RMP) för Cerdelga (eliglustat) VI.2 Sektionerna av den offentliga sammanfattningen Detta är en sammanfattning av riskhanteringsplanen (RMP) för Cerdelga,

Läs mer

TENTAMEN för KMB056 - Molekylär Bioteknik

TENTAMEN för KMB056 - Molekylär Bioteknik TENTAMEN för KMB056 - Molekylär Bioteknik 2011-10-22 em (V-salar) Totalt 60 poäng (Frågor 1-8: Joakim Norbeck, totalt 45 poäng; Frågor 9-12: Lisbeth Olsson, totalt 15 poäng). Betygsgränser: 30 poäng =

Läs mer

Område: Ekologi. Innehåll: Examinationsform: Livets mångfald (sid. 14-31) I atomernas värld (sid.32-45) Ekologi (sid. 46-77)

Område: Ekologi. Innehåll: Examinationsform: Livets mångfald (sid. 14-31) I atomernas värld (sid.32-45) Ekologi (sid. 46-77) Område: Ekologi Innehåll: Livets mångfald (sid. 14-31) I atomernas värld (sid.32-45) Ekologi (sid. 46-77) Undervisningen i kursen ska behandla följande centrala innehåll: Frågor om hållbar utveckling:

Läs mer

Rörelse är bästa pillret. Hans Lingfors Distriktsläkare, MD Habo vårdcentral Primärvårdens FoU-enhet, Jönköping

Rörelse är bästa pillret. Hans Lingfors Distriktsläkare, MD Habo vårdcentral Primärvårdens FoU-enhet, Jönköping Rörelse är bästa pillret Hans Lingfors Distriktsläkare, MD Habo vårdcentral Primärvårdens FoU-enhet, Jönköping Rörelse har effekt på: Symtom och upplevd hälsa Biologiska riskmarkörer Sjukdom och död www.fyss.se

Läs mer

CRISPR - revolutionerande genteknik. Magnus Lundgren Uppsala Universitet

CRISPR - revolutionerande genteknik. Magnus Lundgren Uppsala Universitet CRISPR - revolutionerande genteknik Magnus Lundgren Uppsala Universitet magnus.lundgren@icm.uu.se Magnus Lundgren Född 1975 i Malmö Uppväxt i Malmö, Ockelbo, Gävle Bor med sambo & barn i Uppsala Studerat

Läs mer

Fakta om tuberös skleros (TSC)

Fakta om tuberös skleros (TSC) Fakta om tuberös skleros (TSC) Tuberös skleros är en medfödd genetisk sjukdom som karaktäriseras av tumörliknande förändringar i hjärnan och olika organ i kroppen. Förändringarna kan vara allt från små

Läs mer

Lärarhandledning gällande sidorna 6-27 Inledning: (länk) Läromedlet har sju kapitel: 5. Celler och bioteknik

Lärarhandledning gällande sidorna 6-27 Inledning: (länk) Läromedlet har sju kapitel: 5. Celler och bioteknik Senast uppdaterad 2012-12-09 55 Naturkunskap 1b Lärarhandledning gällande sidorna 6-27 Inledning: (länk) Celler och bioteknik C apensis Förlag AB Läromedlet har sju kapitel: 1. Ett hållbart samhälle 2.

Läs mer

Evidensgrader för slutsatser

Evidensgrader för slutsatser Bilaga 4 Evidensgrader för slutsatser Statens beredning för medicinsk utvärdering (SBU) Om flera stora studier, från olika centra och med en för frågan lämplig design och högt bevisvärde, givit samma resultat

Läs mer

Sammanfattning Arv och Evolution

Sammanfattning Arv och Evolution Sammanfattning Arv och Evolution Genetik Ärftlighetslära Gen Information om ärftliga egenskaper. Från föräldrar till av komma. Tillverkar proteiner. DNA (deoxiribonukleinsyra) - DNA kan liknas ett recept

Läs mer

GENKOMB - en metod att hitta målprotein för läkemedel.

GENKOMB - en metod att hitta målprotein för läkemedel. ENKOMB - en metod att hitta målprotein för läkemedel. Erik urell dam meur Jakub Westholm i samarbete med strazeneca Disposition Biologisk bakgrund: cellen och arvsmassan proteinsyntes genuttryck och genuttrycksdata

Läs mer

en snabb- GUIDE till ebas

en snabb- GUIDE till ebas en snabb- GUIDE till ebas Vad är ebas? Sveriges Elevråd använder sig av ett system för medlemshantering som heter ebas. Det är först när er organisation har kompletta uppgifter i ebas och ni har skickat

Läs mer

Försämras upplevd arbetsförmåga vid ökad ålder bland anställda vid Umeå Universitet

Försämras upplevd arbetsförmåga vid ökad ålder bland anställda vid Umeå Universitet Försämras upplevd arbetsförmåga vid ökad ålder bland anställda vid Umeå Universitet Ulf Hägglund, Esculapen företagshälsovård AB, Umeå ulf.arne@esculapen.se Handledare Bernt Karlsson ABCentrum NUS Projektarbete

Läs mer

Arvet och DNA. Genetik och genteknik

Arvet och DNA. Genetik och genteknik Arvet och DNA Genetik och genteknik Genetik Du är inte en kopia utav någon av dina föräldrar utan en unik blandning av egenskaper från båda dina föräldrar. Genetik är den del av biologin som handlar om

Läs mer

Biologiskt kön i ett evolutionärt perspektiv

Biologiskt kön i ett evolutionärt perspektiv Biologiskt kön i ett evolutionärt perspektiv inte så statiskt som vi tror? Sören Nylin, Zoologi Are boys and girls really that different? Twenty years ago, doctors and researchers didn t think so. It's

Läs mer

10 tips för ökad försäljning

10 tips för ökad försäljning 10 tips för ökad försäljning Innehållsförteckning Tips 1 Kundvård...3 Tips 2 Vad har du egentligen på gång?...4 Tips 3 Ställ jobbiga frågor...5 Tips 4 När tiden inte räcker till...6 Tips 5 Låt kunden skriva

Läs mer

GODKÄND BETYGSKRITERIER BIOLOGI

GODKÄND BETYGSKRITERIER BIOLOGI BETYGSKRITERIER BIOLOGI GODKÄND Växter känna till växtens grundproblem och hur växten tacklar problemen jämfört med djuren känna till att växterna har utvecklats successivt från enkla alger till blomväxter

Läs mer

CELLFABRIKEN AB (PUBL)

CELLFABRIKEN AB (PUBL) CELLFABRIKEN AB (PUBL) Bokslutskommuniké 2001 Inledande tumörstudier in vivo visar mycket intressanta resultat Bolagsköp förväntas ge positivt rörelseresultat Reaförluster på Columna-aktier och goodwill-avskrivningar

Läs mer

Bevarande och uthålligt nyttjande av en hotad art: flodkräftan i Sverige

Bevarande och uthålligt nyttjande av en hotad art: flodkräftan i Sverige Bevarande och uthålligt nyttjande av en hotad art: flodkräftan i Sverige Lägesrapport 2015-12-08 Här kommer den 4:e lägesrapporten från forskningsprojektet Bevarande och uthålligt nyttjande av en hotad

Läs mer

Arv + miljö = diabetes?

Arv + miljö = diabetes? Arv + miljö = diabetes? Kristina Lejon universitetslektor, immunologi, Institutionen för klinisk mikrobiologi Vad är det som gör att vi får diabetes? Anna Möllsten var nyss inne på den frågan och visade

Läs mer

6. Riksdagen ställer sig bakom det som anförs i motionen om att Sverige ska verka för

6. Riksdagen ställer sig bakom det som anförs i motionen om att Sverige ska verka för Enskild motion Motion till riksdagen 2015/16:572 av Åsa Westlund (S) Hormonstörande ämnen Förslag till riksdagsbeslut 1. Riksdagen ställer sig bakom det som anförs i motionen om att prioritera arbetet

Läs mer

ACAS - ADAPTIVE COMPETENCY ASSESSMENT SURVEY - Copyright Dansk & Partners

ACAS - ADAPTIVE COMPETENCY ASSESSMENT SURVEY - Copyright Dansk & Partners ACAS - ADAPTIVE COMPETENCY ASSESSMENT SURVEY - En kartläggning av kostigarna i organisationen görs med metoden ACAS Adaptive Competence Assessment Survey Kostigarna = de informella vägarna för kompetensöverföring

Läs mer

Utvärdering av ADL-träning efter stroke

Utvärdering av ADL-träning efter stroke Utvärdering av ADL-träning efter stroke Susanne Guidetti Med dr., leg.arbetsterapeut 1) Sektionen för arbetsterapi, Institutionen neurobiologi, vårdvetenskap och samhälle, Karolinska Institutet 2) Arbetsterapikliniken,

Läs mer

Totalt finns det alltså 20 individer i denna population. Hälften, dvs 50%, av dem är svarta.

Totalt finns det alltså 20 individer i denna population. Hälften, dvs 50%, av dem är svarta. EVOLUTION Tänk dig att det på en liten ö i skärgården finns 10 st honor av den trevliga insekten långvingad muslus. Fem av dessa är gula med svarta fläckar och fem är helsvarta. Det är samma art, bara

Läs mer

Lärarhandledning. På liv & död...

Lärarhandledning. På liv & död... Lärarhandledning På liv & död... VEM HAR RÄTT TILL MEDICIN? Studielmaterialet På liv & död - Vem har rätt till medicin? består av ett elevmagasin och en kort lärarhandledning. Syftet med materialet är

Läs mer

en snabb- GUIDE till ebas

en snabb- GUIDE till ebas en snabb- GUIDE till ebas 1. Logga in Börja med att logga in på www.ebas.sverigeselevkarer.se. Välj Sveriges Elevkårer och skriv in ert förenings-id som användarnamn och lösenordet som ni har fått skickat

Läs mer

UVIS. Ett nationellt center för avbildning med tyngdpunkt inom translationell medicin. Jan Grawé. Uppsala Universitet

UVIS. Ett nationellt center för avbildning med tyngdpunkt inom translationell medicin. Jan Grawé. Uppsala Universitet UVIS Ett nationellt center för avbildning med tyngdpunkt inom translationell medicin Jan Grawé Rudbecklaboratoriet b t Uppsala Universitet Science For Life Laboratory (SciLifeLab) En satsning på storskalig

Läs mer

Hearing med Lars-Erik Eriksson vd Clinical Laserthermia Systems AB

Hearing med Lars-Erik Eriksson vd Clinical Laserthermia Systems AB Hearing med Lars-Erik Eriksson vd Clinical Laserthermia Systems AB Lars-Erik: Hej, välkomna till denna webbhearing. Ni är nu välkomna att ställa frågor! Tänk på att ni måste vara inloggade som deltagare

Läs mer

Serdolect 4 mg, 12 mg, 16 mg, 20 mg tablett 4.3.2015, Version 4.0

Serdolect 4 mg, 12 mg, 16 mg, 20 mg tablett 4.3.2015, Version 4.0 Serdolect 4 mg, 12 mg, 16 mg, 20 mg tablett 4.3.2015, Version 4.0 OFFENTLIG SAMMANFATTNING AV RISKHANTERINGSPLANEN VI.2 Delområden av en offentlig sammanfattning VI.2.1 Information om sjukdomsförekomst

Läs mer

1IK430 Brukarorienterad design

1IK430 Brukarorienterad design 1IK430 Brukarorienterad design Projektarbete i 1IK430 Följande text är en förklaring av projektarbetet som ingår i kursen 1IK430 Brukarorienterad design, 15 högskolepoäng Enligt kursplanen, ska studenten,

Läs mer

Startsida Styrelse Lokalförening Medlem Utbilningar Terapeuter Handledare Litteratur Arkiv Länkar

Startsida Styrelse Lokalförening Medlem Utbilningar Terapeuter Handledare Litteratur Arkiv Länkar 1 av 9 2009 09 17 21:22 Startsida Styrelse Lokalförening Medlem Utbilningar Terapeuter Handledare Litteratur Arkiv Länkar Insomnia Ett område inom sömnforskningen som har rönt stor uppmärksamhet under

Läs mer

Appendix 1 - Vad som ska ingå i de olika delmålen

Appendix 1 - Vad som ska ingå i de olika delmålen Appendix 1 - Vad som ska ingå i de olika delmålen Delmål 1 ligger under v3 för kamratgranskning (17/11) och slutlig inlämning v4 (24/11). Det är lämpligt om innehållet i vecka 1 och 2 är skrivet till vecka

Läs mer

Nina Fransén Pettersson doktorand, immunologi, Institutionen för klinisk mikrobiologi. Filmer och färgbilder till detta föredrag kan ses på

Nina Fransén Pettersson doktorand, immunologi, Institutionen för klinisk mikrobiologi. Filmer och färgbilder till detta föredrag kan ses på Kan man se diabetes? Nina Fransén Pettersson doktorand, immunologi, Institutionen för klinisk mikrobiologi Filmer och färgbilder till detta föredrag kan ses på www.medfak.umu.se/forskning/forskningens-dag/-forskningens-dag-2012/

Läs mer

Läkemedel. måndag 18 november 13. Ett projekt av Jonas, Jakob, Daniel och Mukti

Läkemedel. måndag 18 november 13. Ett projekt av Jonas, Jakob, Daniel och Mukti Läkemedel Ett projekt av Jonas, Jakob, Daniel och Mukti Ett projekt av Jonas, Jakob, Daniel och Mukti Vad har läkemedel tillfredsställt? God hälsa Sjukdomar och infektioner Droger Cancer, Alzheimer, AIDS

Läs mer

Kvartalsrapport 2, 2012

Kvartalsrapport 2, 2012 Kvartalsrapport 2, 2012 Karo Bio 13 juli 2012 Transformeringen av Karo Bio fortskrider Genomförda kostnadsbesparingar och säkrade intäkter sänker nettokostnadsnivån till 11-13 MSEK / kvartal i slutet av

Läs mer

Individanpassad behandling av tumörsjukdomar NYA VÄGAR FÖR INDIVIDUALISERAD MALIGNT MELANOM. malignt melanom

Individanpassad behandling av tumörsjukdomar NYA VÄGAR FÖR INDIVIDUALISERAD MALIGNT MELANOM. malignt melanom Vid Sahlgrenska universitetssjukhuset och Sahlgrenska Akademin pågår utveckling av en ny analysplattform där patientens egen tumör är den biomarkör som avgör val av framtida behandling. För att uppnå detta

Läs mer

Falls and dizziness in frail older people

Falls and dizziness in frail older people Falls and dizziness in frail older people Predictors, experiences and the effects of a case management intervention Ulrika Olsson Möller Paper I Prevalence and predictors of falls and dizziness in people

Läs mer

Enbrel ger en bestående förbättring av livskvaliteten för patienter med psoriasis

Enbrel ger en bestående förbättring av livskvaliteten för patienter med psoriasis P R E S S M E D D E L A N D E FÖR OMEDELBAR PUBLICERING/ DEN 23 SEPTEMBER Enbrel ger en bestående förbättring av livskvaliteten för patienter med psoriasis Ett års behandling med läkemedlet Enbrel gav

Läs mer

Biologi breddning (mikrobiologi och immunologi) Kurskod: BI 1203-A Poäng: 50 Program: Förkunskapskrav: Biologi A och Biologi B

Biologi breddning (mikrobiologi och immunologi) Kurskod: BI 1203-A Poäng: 50 Program: Förkunskapskrav: Biologi A och Biologi B KURSBESKRIVNING Ämne: Biologi Kurs: Biologi breddning (mikrobiologi och immunologi) Kurskod: BI 1203-A Poäng: 50 Program: NV Förkunskapskrav: Biologi A och Biologi B Mål Kurserna Biologi breddning A och

Läs mer

FTEA21:3 Spr akfilosofi F orel asning III Martin J onsson

FTEA21:3 Spr akfilosofi F orel asning III Martin J onsson FTEA21:3 Språkfilosofi Föreläsning III Martin Jönsson Att lära Fyra argument mot tanken att mening är någonting mentalt. En semantisk princip (principen att mening fixerar referens) En ny filosofisk fråga

Läs mer

Utvärdering av IVIG behandling vid post-polio syndrom. Kristian Borg

Utvärdering av IVIG behandling vid post-polio syndrom. Kristian Borg Utvärdering av IVIG behandling vid post-polio syndrom Kristian Borg Div of Rehabilitation Medicine, Karolinska Institutet and Danderyd University Hospital Stockholm Sweden Pågående denervation som kompenseras

Läs mer

Neonikotinoiders effekt på rapsbaggar Resultat från svenska undersökningar. Barbara Ekbom, SLU, Inst. f. ekologi

Neonikotinoiders effekt på rapsbaggar Resultat från svenska undersökningar. Barbara Ekbom, SLU, Inst. f. ekologi Neonikotinoiders effekt på rapsbaggar Resultat från svenska undersökningar Barbara Ekbom, SLU, Inst. f. ekologi Metabolisk resistens Resistenta insekter kan avgifta eller förstora giftet snabbare än känsliga

Läs mer

Fysisk aktivitet på Recept som behandlingsmetod inom hälso- och sjukvården

Fysisk aktivitet på Recept som behandlingsmetod inom hälso- och sjukvården Fysisk aktivitet på Recept som behandlingsmetod inom hälso- och sjukvården Stefan Lundqvist Leg sjukgymnast Varför r skall vi arbeta med fysisk aktivitet/ FaR och andra levnadsvanor? Medicinska, hälsoskäl

Läs mer

ÄGGSTOCKSCANCER FAKTABLAD. Vad är äggstockscancer (ovarialcancer)?

ÄGGSTOCKSCANCER FAKTABLAD. Vad är äggstockscancer (ovarialcancer)? ÄGGSTOCKSCANCER FAKTABLAD Vad är äggstockscancer (ovarialcancer)? ENGAGe ger ut en serie faktablad för att öka medvetenheten om gynekologisk cancer och stödja sitt nätverk på gräsrotsnivå. Äggstockscancer

Läs mer

LPP Nervsystemet, hormoner och genetik

LPP Nervsystemet, hormoner och genetik LPP Nervsystemet, hormoner och genetik Det är bara hormonerna och han är full av hormoner är två vanliga uttryck med ordet hormon, men vad är egentligen hormoner och hur påverkar de kroppen? Vi har ett

Läs mer

Linnéuniversitetets mål och strategier med relevans för Familjen Kamprads stiftelse

Linnéuniversitetets mål och strategier med relevans för Familjen Kamprads stiftelse Linnéuniversitetets mål och strategier med relevans för Familjen Kamprads stiftelse Beslutat av Rektor Inledning 3 Gemensamma mål och strategier 4 Det fortsatta arbetet 7 2 (7) Inledning Familjen Kamprad

Läs mer

Handfunktion ur ett 20- årsperspektiv, vad har vi lärt? Ann-Christin Eliasson, arbetsterapeut

Handfunktion ur ett 20- årsperspektiv, vad har vi lärt? Ann-Christin Eliasson, arbetsterapeut Handfunktion ur ett 20- årsperspektiv, vad har vi lärt? Ann-Christin Eliasson, arbetsterapeut Beskriva 1994 Behandlings effekter 2004 Evidens 2014 1994 -Vad Vadär ärklumpig klumpigmotorik motorik? 6 year

Läs mer

Fakta om spridd bröstcancer

Fakta om spridd bröstcancer Fakta om spridd bröstcancer Världens vanligaste kvinnocancer Bröstcancer står för närmare 23 procent av alla cancerfall hos kvinnor och är därmed världens vanligaste cancerform bland kvinnor i såväl rika

Läs mer

Allmänt om bakterier

Allmänt om bakterier Bakterier Allmänt om bakterier Bakterier är varken djur eller växter De saknar cellvägg och klorofyll De är viktiga nedbrytare - bryter ner döda växter och djur En matsked jord = 10 miljarder bakterier

Läs mer

PROJEKTDIREKTIV. Genomizer. Dokumenthistorik version datum utförda förändringar utförda av granskad

PROJEKTDIREKTIV. Genomizer. Dokumenthistorik version datum utförda förändringar utförda av granskad PROJEKTDIREKTIV Genomizer Dokumenthistorik version datum utförda förändringar utförda av granskad 1.1 20140410 Formulerat om kraven på leverabeln Teknisk dokumentation, samt ändrat formateringen av punkterna

Läs mer

Göran Adlén. @trendspanaren

Göran Adlén. @trendspanaren Göran Adlén VAD HAR JAG LÄRT MIG AV DE HÄR FEMTON ÅREN? JU LÄNGRE JAG LEVER, DESTO MINDRE FRAMTID FINNS DET ATT OROA SIG FÖR Ashleigh Brilliant TRENDER ÄR LÅNGSAMMA OCH OFÖRUTSÄGBARA TRENDER ÄR LÅNGSAMMA

Läs mer

Falls and dizziness in frail older people

Falls and dizziness in frail older people Falls and dizziness in frail older people Predictors, experience and effect of an intervention Ulrika Olsson Möller Leg sjukgymnast, doktorand Mars 2013 Andelen äldre kommer att öka Våra mest sjuka äldre

Läs mer

Fakta om kronisk myeloisk leukemi (KML) sjukdom och behandling

Fakta om kronisk myeloisk leukemi (KML) sjukdom och behandling Fakta om kronisk myeloisk leukemi (KML) sjukdom och behandling Om leukemier Kronisk myeloisk leukemi (KML) är en form av leukemi ett samlande begrepp för flera cancersjukdomar som angriper de blodbildande

Läs mer

Sammanfattning av programmet UID FutureMap

Sammanfattning av programmet UID FutureMap Sammanfattning av programmet UID FutureMap Världen behöver en ny, socialt hållbar arbetsmodell. Människans fria, trygga medvetande och hälsa skadas av de ekonomiska modeller, som styr världen sedan flera

Läs mer

Stefan Widgren, SVA. Har EHEC bakterien kommit för att stanna? Konferens tisdag 25 oktober 2011, 10.00 17.00

Stefan Widgren, SVA. Har EHEC bakterien kommit för att stanna? Konferens tisdag 25 oktober 2011, 10.00 17.00 VTEC på djur i Sverige Stefan Widgren, SVA Har EHEC bakterien kommit för att stanna? Konferens tisdag 25 oktober 2011, 10.00 17.00 Kungl. Skogs och Lantbruksakademien, Stockholm Definitioner EHEC = Enterohemorrhagisk

Läs mer

Risk- och nyttovärdering - allmänt om risker med genförändring beträffande livsmedel och foder. Christer Andersson Livsmedelsverket

Risk- och nyttovärdering - allmänt om risker med genförändring beträffande livsmedel och foder. Christer Andersson Livsmedelsverket Bild 1 Risk- och nyttovärdering - allmänt om risker med genförändring beträffande livsmedel och foder Christer Andersson Livsmedelsverket Lund 2015-11-11 Bild 2 Historisk bakgrund för modern växtförädling

Läs mer

Li#eratur och empiriska studier kap 12, Rienecker & Jørgensson kap 8-9, 11-12, Robson STEFAN HRASTINSKI STEFANHR@KTH.SE

Li#eratur och empiriska studier kap 12, Rienecker & Jørgensson kap 8-9, 11-12, Robson STEFAN HRASTINSKI STEFANHR@KTH.SE Li#eratur och empiriska studier kap 12, Rienecker & Jørgensson kap 8-9, 11-12, Robson STEFAN HRASTINSKI STEFANHR@KTH.SE Innehåll Vad är en bra uppsats? Söka, använda och refera till litteratur Insamling

Läs mer

PARTNER-studien. Du har bjudits in för att delta i den här studien eftersom du är den HIV-negativa partnern i förhållandet.

PARTNER-studien. Du har bjudits in för att delta i den här studien eftersom du är den HIV-negativa partnern i förhållandet. Deltagarinformation och informerat samtycke för den HIV-negativa partnern PARTNER-studien PARTNER-studien är en studie som riktar sig till par där: (i) den ena partnern är HIV-positiv och den andra är

Läs mer

Vad är Fabrys sjukdom? Information om Fabrys sjukdom

Vad är Fabrys sjukdom? Information om Fabrys sjukdom Vad är Fabrys sjukdom? Information om Fabrys sjukdom Inledning Fabrys sjukdom (även känd som Anderson-Fabrys sjukdom efter de två forskare som upptäckte sjukdomen) är en sällsynt genetisk sjukdom. Orsaken

Läs mer

Fakta äggstockscancer

Fakta äggstockscancer Fakta äggstockscancer Varje år insjuknar drygt 800 kvinnor i Sverige i äggstockscancer (ovariecancer) och omkring 600 avlider i sjukdomen. De flesta som drabbas är över 60 år och före 40 år är det mycket

Läs mer

Riskbedömning av hormonstörande ämnen

Riskbedömning av hormonstörande ämnen Riskbedömning av hormonstörande ämnen Anna Beronius, PhD Institutionen för Tillämpad Miljövetenskap (ITM) Stockholms Universitet anna.beronius@itm.su.se Illustration by Estella Larsson Beronius Hormonstörande

Läs mer

Fördom 1: Det kan aldrig vara bra att ta läkemedel

Fördom 1: Det kan aldrig vara bra att ta läkemedel Säkra läkemedel? Säkra läkemedel? Det finns många missuppfattningar om läkemedel. Bristande kunskap kan göra att behandlingen inte genomförs på rätt sätt och därmed leda till försämrad hälsa och livskvalitet.

Läs mer