Major Mouse Testing Program: Longevity

Storlek: px
Starta visningen från sidan:

Download "Major Mouse Testing Program: Longevity"

Transkript

1 Major Mouse Testing Program: Longévité Santé Longevity 01/01/15 Kartläggning av långsiktiga hälsoeffekter : Storskaliga tester på åldrade möss för att hitta de mest effektiva terapierna mot åldrande och åldersrelaterade sjukdomar. 1

2 Denna presentation är tillägnad Dr. L. Stephen Coles, M.D., January 19, 1941 December 3, 2014, som var en pionjär inom gerontologi och forskning inom livsförlängning. Stephen Coles sammanställde en mail-lista för experter på möss I USA med några nyckelpersoner som volontärer för projektet. Dessa skulle skapa diskussioner för att se vad som kunde uppnås och om detta kunde leda till resultat. Sändlistan Gerontologi Research Group som han drev under många år är en stor källa till inspiration för projektet. 01/01/15 Major Mouse Testing Program 2

3 En revolution har skett I nematoder ( C. elegans ) Livsförlängning: Revolutionen Revolutionerande upptäckt år 1980: 8 sätt att förlänga deras liv [1] År 1993, en mutation som dubblade livslängden, med god vitalitet [2] År 2003 tusentals studier på livslängd; ungefär 10% förlängde livet.[3] År 2008, En mutation fördubblade livslängden 10-falt! PAST Maskar och möss åldras på olika sätt Maskar har ett fixerat antal celler: Att förlänga cellens liv är nyckeln Möss är däggdjur och att regenerera vävnader är nyckeln. Revolutionen för livsförlängning har nått möss och ser lovande ut för människor. Revolutionen har nått möss, men få tester görs. Livsförlängande behandlingar som är hittills kända att ha effekter på mänskligt åldrande (tex läkemedlen aspirin, metformin, metoprolol, rapamycin) Livsförlängande genetiska mönster I möss hittades i familjer med minskad risk för åldersrelaterade sjukdomar (Laron-dvärgar, Foxo-3A, akt-1) Låt oss utföra ett stort antal parallella livslängsstudier på möss på sätt som kan överföras till människor. NOW 01/01/15 3 Major Mouse Testing Program

4 Översikt av testprogrammet Tidslinje - En studie med redan åldrade m ö ss kommer startas och pågå 18 månader. - En annan studie kräver att vi skapar nya stammar av möss och kommer pågå 38 månader. Resultaten kommer kollas upp 3 gånger och justeras så att de kan överföras på människor. De flesta resultat kommer komma kring 5 år efter att de startats. Folk för jobbet Vi har pratat med ett antal forskare och identifierat en grupp med rätt djurhållning och erfarenheter för att göra tester på livslängd och inom regenerativ medicin. Budget Den förväntade kostnaden för att hålla 1000 olika tester är 20M. Det finns också en direkt korrelation mellan finansiering, antalet tester och schema. Förväntade resultat Basert på tidigare erfarenhet förväntar vi oss 100 resultat av 1000 tester att vara positiva: - I nematoder, 10% av testerna var positiva (många tester gjordes) - I möss, ~10% (Svårt att uppskatta då få test har gjorts, ITP+Spindler) Förväntde fördelar: 1. Få till en förändring I samhället 2. Resultaten ska ge en generell överblick kring vad som förlänger liv. 3. Vi hoppas uppnå betydande livsförlängning. 4. Vi hoppas detta gäller människor. Applicera för att se effekt på människors livslängd Om vi startar våra testprogram detta år förväntar vi oss att se konkreta resultat på mindre än 10 år. 01/01/15 Major Mouse Testing Program 4

5 Vad testa?: Källor till interventioner Partiella resultat redan Flera ideer Longevity DB: över 1000 interventioner Databas som listar mänskliga gener kopplade till långt liv. För många av dem kan man testa om det finns en koppling till möss.. Lifespan Observation Database 3359 rapporterade fall av livsförlängning: I gnagare (114;ofta oklara med lovande resultat), nematoder (2400), andra arter. mer bekräftelser behövs hos möss. Facebook group: PotentialGerontodrugs över 300 inlägg just nu Varje inlägg är en potentiellt livsförlängande intervention som kan testas på möss. https://www.facebook.com/groups/gerontodrugs Andra källor Olika liknande databaser har hittats. Numerous relevant forums and mailing lists are analyzed. Vi har också låtit ett papper cirkulera påkonferenser för åldrandeforskning för att lista ideer.. Antalet interventioner är enormt. Analyser pågår för att bestämma prioriteringar. 01/01/15 Major Mouse Testing Program 5

6 Vad att testa?: typer av interventioner Läkemedelsbehandling för människor Läkemedelsbehandling hos möss. Läkemedelsbehandling hos mänskliga populationer som tros leda till långa friska liv hos människor. Konceptet: Om möss lever länge och är friska, detta är orsak att tro på ett kausalt samband mellan hälsa hos människor and och en sådan genterapi är förmodligen effektiv hos människor också.. Fundamentala forskningsresultat Olika behandlingar på möss : Normalt in vivo och in vitro resultat från möss, råttor, nematoder eller fruktflugor med betydande resultat på livslängd & den friska livstiden på något sätt som kan införliva hos människor.. Varierande behandlingar Mänskliga genvarianter För varianter som hittas I mänskliga populationer som tros leda till långa friska liv hos människor, och kan förlivas till en genterapie hos åldrade möss. Konceptet: Om möss lever länge och är friska, detta är orsak att tro på ett kausalt samband mellan hälsa hos människor and och en sådan genterapi är förmodligen effektiv hos människor också Genterapier för möss Databas för interventioner 01/01/15 Major Mouse Testing Program 6

7 Övergripande schema Fas I 1 år Bilda grupper Insamling av pengar Test som startar med redan åldrade möss Fas II 2 månader Fas III 14 månader Fas IV 18 månader Fas V 18 månader Förberedelse av utrustning Test av 40 till 400 terapier Bekräfta och optimera resultat Initiera protokoll hos människor Testen startar med att sätta upp en stamm av möss 2 månader 38 månader 18 månader 18 månader Förberedelse av utrustning Testa 60 till 600 behandlingar Bekräfta och optimera resultaten Initiera protokoll hos människor Antalet interventioner att testa beror på finansieringen 2 m (*) = 100 Behandlingar 10 positiva resultat 20 m (*) = 1000 Behandlingar 100positiva resultat Den finansiella uppskattning beräknas sidan 17. Förutom bedömning kommer antalet utförda tester vara den som tillåts av finansieringen. 01/01/15 7 Major Mouse Testing Program

8 preparation Fas III layout 6 månader 30 hanar 30 honor 18 månader 14 månader 18 månader: Behandling påbörjas? De positiva resultaten av fas III leder till fas IV : bekräfta resultat och finjustera, mössoch råttor i andra labb + Studera olika hälsoeffekter 32 månader gammal: Så, förlängde behandlingen livslängden jämfört med den stora kontrollgruppen som levde paralellt? Beslut för nästa steg Fas III a: Påbörja med unga möss. För de flesta genetiska och flera andra behandlingar. Fase III b: Testa I verkligheten Läkemedel, genetiskt, övrigt 01/01/15 Major Mouse Testing Program 8

9 Generell organisation Givare Tillgångar Resultat Grupp Longévité Santé, ILA Producenter av möss Möss Faciliteter 01/01/15 Major Mouse Testing Program 9

10 Nuvarande Att göra - lista Identifiera och dela upp möjliga interventioner Arbete pågår Hitta möjligheter till finansiering Idag Förfina testerna och metodologin med labben Arbete pågår Hitta labb anpassade för jobbet och gå igenom villkoren med dem Kontakta möjliga finansiärer. Gör generella avtal Beräkna kostnader för experiment (Utrustning & personal) Arbete pågår Detaljerad förhandling om finansiering Erhålla nödvändiga medel för att påbörja projektet Framtid 01/01/15 Major Mouse Testing Program 10

11 Grupper och laboratorier Laboratorier med djurhållning av högsta kvalitet (burar med individuella filter och ventilation) och specialiserad på regenerativ medicin och forskning kring åldrandeprocesser. Arlan Richardson 40 års erfarenhet i långvariga tester på gnagare (substanser och genterapier) Laboratory USA (Oklahoma) Alexandra Stolzing Regenerativ medicin & stamcellers åldrande Translational Centre for Regenerative Medicine Leipzig University (Leipzig) Jean-Marc Lemaitre Regenerative Medicine på möss och människoceller (stamceller och genterapi) Inserm i Frankrike (Montpellier) 01/01/15 Major Mouse Testing Program 11

12 Speciellt tack till vår volontärgrupp: Volontärgrupp Huvudgrupp: Edouard Debonneuil, Rached Messaoudi, Valentin Socolov, Martin Dinov, Daniel Krochmal, Maciej Michalak, Nicoleta Reinald Med hjälp ifrån: Steve Coles (avliden), Johnny Adams, Daria Khaltourina, Matthew Scholtz, Didier Coeurnelle, Anton Kulaga, Paul Spiegel, Liz Parrish, Alexandru Chircu, Alexandre Blanc, Dmitri Borisoglebsky, Victor Björk, och många andra forskare och online volontärer. Longévité & Santé, Kvällsmöten för att organisera projektet på La Paillasse, Paris. Medhjälpare från olika länder och vid olika tillfällen 01/01/15 Major Mouse Testing Program 12

13 Tack för er uppmärksamhet! Den uppdaterade versionen av denna presentation finns på Vill du hjälpa till?, Donera genom paypal på Eller på xxx(under utveckling) om du är amerikansk medborgare. Kontakta för att föreslå specifik hjälp Specifik volontärtjänstgöring vi tänker på: Om du har erfarenhet kring tester av livlängd hos möss eller in vivo genterapitekniker, eller att hantera läkemedel I mat,eller något annat kring att designa projektets tillvägagångssätt. Om ni känner till källor till finansiering, som du tror motsvarar vad vi behöver, oeller är intresserade av att skriva brev för finansiering, kontakta oss. Presentera projektet på en konferens eller översätta till ett annat språk. Note: Vi är medvetna om att de olika urls/ s I denna slide inte är likadana. Vi jobbar för mer liknande namn på kommande presentationer (SLS stands for Sceaux Longévité Santé, ALA fö American Longevity Alliance, Ingen av de är vinstdrivande [Franska och amerikanska] associationer för International Longevity Alliance) 01/01/15 Major Mouse Testing Program 13

14 Appendix Recap på 3 slides. Lista på behandlingar på möss Tekniker för genterapi Övrigt 01/01/15 Edouard Debonneuil -- Mouse Lifespan Fast Track project 14

15 Idag är det mindre än 10 riktiga tester på gnagare per år Vårat mål: 1000 tester på mindre än 5 år I nematoder, 10% av tusentals tester är positiva På möss, ungefär 10% [5/67 av Spindler.S och 5/15 tester genom ITP, 1-2 gemensamt] : Interventions testing program, USA: - NDGA (Hanar, +10% livslängd) - Rapamycin (hanar, & honor, %) - Acarbose (Hanar, +22%) - Aspirin (hanar, +10%) - α-estradiol (Hanar, +10%) Aspirin: lägre mortalitet Bekräftat på människor (80 mg/day,mer än 5 år) Everolimus: testas på äldre(stärker effekt av influensavaccin) Metformin: Minskad mortalitet bevisat hos människor Andra resultat hos gnagare kollas upp (fullerener) 01/01/15 Major Mouse Testing Program 15

16 Förväntade Resultat 1 Upptäckter hos möss kan göra stor skillnad I hälsa hos människor Få till en förändring I samhället Applicerad biologi på livsförlänging flera terapier som kan förändra åldrandeprocessen, kan man mångdubbla livslängden hos möss? En brytning I forskning om livsförlängning Visa vad som förlänger livet och mekanismerna bakom. Tillsammans med mänsklig statistik, Vi hoppas ha användbara resultat inom 5 år. Betydande livsförlängning Bland de många förväntade resultaten, är förhoppningen att en del leder till en mycket stark livsförlängning. Ett nytt område inom farmaci: läkemedel för långtidshälsa Upptäcka nya användingsområden för redan existerande läkemedel. 01/01/15 Major Mouse Testing Program 16

17 Finansiering & Budget Notera: Kostnader justeras. Antalet tester beror på finansieringen. Fas III Anta att 400 terapier görs med gamla möss och 600 terapier behöver en ny stamm av möss; varje experiment behöver 60 möss (30 hanar och 30 honor) och varje av de 2 systemen (åldrade möss/nya stammar av möss) behöver en kontrollgrupp med 1000 möss (asymmetrisk design; 50% hane-hona). Anta att mushanteringen kostar 1.5 för varje mus och vecka (beror på hur de lever) och att möss lever I genomsnitt 27 månader. En snabb kalkyl ger att kostnaden att hantera möss är 1.5*(27*(600* )+9*(400* ))*(30.5/7) = 8 M Anta att varje åldrad mus kostar 100 och varje ung transgenisk mus kostar 30 att producera. Den initiella kostnaden är(600* )*100+(400* )*30 = 4.5 M Totalen för Fas III är 12.5 M Fas IV Anta att 10% av terapierna är fas III leder till en fas IV,och I genomsnitt för en terapi fas IV kostar det 6 gånger så mycket som fas III (förlivsförlängningen måste bli bekräftad och justerad). Kostnaen av fas IV är 12.5*10%*6 = 7.5 M Total Totalkostnaden för att testa 1000 terapier borde ligga runt = 20 M,enligt ovanstående antagande. De största kostnaderna är understrukna ovan 01/01/15 Major Mouse Testing Program 17

18 Terapier att testa på möss Exempel på terapier ifrån guppen på Facebook Control life extensions: aspirin, metformin, rapamycin, statins H I G H P R I O R I T Y Snell, Ames, IGF-1 mutationer vid hög ålder TA-65, other telomerase activator, and human telomerase variant TM5441 (fyrdubblar den friska livslängden; minskade nivåer av senescence marker PAI-1) Centrophenoxin/Meclofenoxate: minskade nivåer av lipofuscin & ej publicerad livsförlängning hos råttor. Pharmacoperones (inverterar GNRHRmutation) Neuraminidase 1 supplementation (rapporteras att delvis minska Alzheimer s sjukdom) GDF11 injektioner (rapporteras att delvis minska åldrande I hjärta och hjärna hos möss) D-Glucosamine (imiterar effekter av kalorirestriktion, rapporterad livsförlänging hos åldrade möss Dimethylaminoethanol (förlängda livstider rapporterade; lägre doser bör testas) Trehalose (förändrar autofagi; förändrar IGF-1 axis; clears proteins related neurodegener.) LysoSENS s nedbrytning av 7-ketoCholesterol (bör snart vara redo att testa) Genetisk stabilisering av transthyretin-strukturer)... [Många övriga.] M I D Biphosphonates (tas mot osteoroporos men verkar reducera mortalitet på andra sättet) Fullerenes supplementation hos råttor (+90% ökning I livslängd har apporterats) Tafamidis (behandling av familjära transthyretin-sjukdomar) NAD+ supplementation... [Många övriga] 01/01/15 Major Mouse Testing Program 18

19 Många lovande behandlingar! 1. Genterapier hos människor Genterapier hos möss. För varianter som hittas I mänskliga populationer som tros leda till långa friska liv hos människor, och kan förlivas till en genterapie hos åldrade möss. Konceptet: Om möss lever länge och är friska, detta är orsak att tro på ett kausalt samband mellan hälsa hos människor and och en sådan genterapi är förmodligen effektiv hos människor också. 2. Läkemedelsbehandling hos människor Läkemedelsbehandling hos möss. Läkemedelsbehandling hos mänskliga populationer som tros leda till långa friska liv hos människor. Konceptet: Om möss lever länge och är friska, detta är orsak att tro på ett kausalt samband mellan hälsa hos människor and och en sådan genterapi är förmodligen effektiv hos människor också. 3. Fundamentala forskningsresultat. Olika behandlingar på möss : Normalt in vivo och in vitro resultat från möss, råttor, nematoder eller fruktflugor med betydande resultat på livslängd & den friska livstiden på något sätt som kan införliva hos människor. 01/01/15 Major Mouse Testing Program 19

20 Ett exempel: transpose rs till möss Rs är en mänsklig variant av en gen somkodar för tubulin beta4b protein. Varianten motsvarar attha"t" någonstans. Den hittades i Framingham Heart Study, I Amerikanska medborgare, att de med 2 kopior av genen T har mindre hjärt-och-kärlrisker, mindre risk för cancer, och mindre risk för för tidig död än övriga, detta är statistiskt signifikant (p_value = 6e-53) Referens: https://www.ncbi.nlm.nih.gov/pmc/articles/pmc / Labbmöss som har samma gen! ("ortholog") detta indikerar att den har samma funktion I möss. Naturligt har de ett "C", inte ett "T". Därför vill vi ge samma variant, väldigt konkret, en del av denna gen i labmöss är "GCCGCATGTCTATGAAGGAGGTGGACGAACAGATGCTTAATGTCCAAAACA«, målet är att göra om den till "GCCGCATGTCTATGAAGGAGGTGGATGAACAGATGCTTAATGTCCAAAACA" genom att använda CRISPR teknologin. Om det gör att de lever längre (förbättrar deras hälsa etc)så indikerar det att det fungerar på människor Målet är att testa rs och andra potentiella medel (Vi har mer än 1400!). Vad som först kommer komma från mänsklig statistik och bekräftas hos möss borde fungera bra hos människor, så ganska troligt om inte projektet stoppas. - 5 år från nu kommer några personer (frst patienter och teknikintresserade äldre) kommer börja med genterapin och man kommer följa upp för att se om det är bra för deras hälsa., - Och potentiellt inom 10 år så kommer det bli vanligt to ta dessa genterapier för att leva längre I god hälsa 01/01/15 Major Mouse Testing Program 20

21 ålder: tekniker 1. Läkemedelskänsliga stammar av möss Varför skapa stammar av möss? Varför inte behandla normala, åldrade möss? Experter har förklarat att nuvarande tekniker för genterapi endast påverkar en mindre del av kroppen: även om en gen för långt liv introduceras, det ärosäkert om man kan få en betydande effekt med sådana tekniker, det finns en risk att förstöra det huvudsakliga testprogrammet dom föreslår att göra läkemedelskänsliga transgeniska möss (http://www.clontech.com/us/products/inducible_systems/protein) Teknik Fas 1 (6 månader): för varje testad genvariant, skapar man en stam av möss embryon sätts in i genvariant med läkemedelskänslig promoter med CRISPR-tekniken och sättas in i honor. Avkomman som innehåller mutationen för att bli korsade och producera 30 hanar och 30 honor. 30 hanar Fas 2 (18 månader): mössen matas och hushålls normalt. 30 honor De bör bete sig som kontrollen då inte genen är uttryckt. Fas 3 (14 månader): vid en ålder av 18 månader, ges de ett läkemedel? som sätter på genen. Deras överlevnadskurva jämförs med kontrollen Note: vi överger inte behandlingen av normala åldrade individer: a) Efter dessa 38 månader, fas IV: för de fall (10%?) som uppvisar en statistisk tydlig livsförlängning, genvarianten testas I åldrade rpttor och möss genom olika tekniker för genterapi (kommande slides) b) +In parallel under dessa 38 months, genterapitekniker (kommande slides) testas redan för de mest troliga generna för långt liv idag, för att göra de möjliga för människor, samt träna för a) 01/01/15 Major Mouse Testing Program 21

22 Gene age: Tekniker 3. Övergående genexpression vid 18 månader: minicircles burna av liposomala vektorer Innehåll Minicircles är DNA cirklar. Dom tenderar att ha högre effektivitet än AAVs för att de stimulerar inte immunsystemet och dom måste inte nå cellkärnan för att uttrycka önskad gen. Nackdelen är att behandlingen är övergående, det behövs regelbundna behandlingar, men detta är också en fördel eftersom det är en säkerhet att kunna stoppa behandlingar stoppa behandlingar om bieffekter dyker upp. Teknik Fas 1 (2 månader): för varje genvariant som blir testad: minicircles som innehåller genen produceras I tillräcklig kvantitet genom attmodifiera bakterier (en plasmid skapas I E. coli, de prokaryota delarna är förflyttade = minicircle) genom att använda CRISPRs; dom sätts in I liposomala vektorer och injiceras I unga djur för att se om det sprider sig. Fas 2 (14 månader): minicircles injiceras I 30 hanar och 30 honor, varannan vecka, startar vid en ålder av 18 månader. Deras överlevnad jämförs med kontrollgruppen. Att uppmärksamma test E. coli 30 males 30 females? Låg effektivitet: Även om effektiviteten är relativt hög för det nuvarande området för genterapi, är det fortfarande för lågt för att en livsförlängning ska upptäckas. Detta är anledningen till att vi först väljer livslängdsrelaterade gener baserat på teknik #1 som visades 2 sidor tidigare. Evolution: Området utvecklas snabbt. Dessa slides är därför enbart indikativa: Vi kanske väljer bättre tekniker när de kommer och är tydliga (microcircles, S/MAR elements ). 01/01/15 Major Mouse Testing Program 23

23 Gene age: Tekniker 4. Övriga En fråga om specificitet för vävnader För de flesta genvarianterna vi vill testa vet vi ej priorom det är vettigt att inrikta oss på ett visst organ. En familjär mutation som kan leda till ökad livslängd I olika populationer utan att veta om det beror på uttryck I en viss vävnad Därför är de tidigare sidorna om generella genterapier:som är uttryckta, så mycket som möjligt, genom kroppen. I sådana fall, såvida det inte redan demonstrerat att en genterapi förlänger livet, startar vi med tekniken #1: att ska en stam av möss och vänta hela deras livslängd. När målet är ett specifikt organ, så kan genterapi vara betydligt mer effektivt. Detta är typiskt för blodceller och leverceller. Ett snabbt växande område Precis som indikerat på den tidigare sliden, tekniken har förbättrats mycket inom området av genterapi. Det kan vara så att 6 månader efter att ett experiment startar, så kommer en betydligt bättre teknik Men det skulle vara värreatt behöva vänta årtionden på en sådan teknik. Det kan mycket väl vara så att tekniken #1 är ett konstgjortsätt att modellera en framtida genterapi som kan vara tillgänglig för gamla människor 5-10 år från nu. Från detta perspektiv så skulle den tekniken skulle vara mycket bättre än andra. (AAVs, minicircles eller andra inte så effektiva terapier.) 01/01/15 Major Mouse Testing Program 24

24 Referenser (sid 3) C elegans, revolutionen inom livsförlängning [1] Klass MR (1983). "A method for the isolation of longevity mutants in the nematode Caenorhabditis elegans and initial results". MECHANISMS OF AGEING AND DEVELOPMENT 22 (3-4): PMID [2] Kenyon C, Chang J, Gensch E, Rudner A, Tabtiang R (1993). "A C. elegans mutant that lives twice as long as wild type". Nature (journal) 366 (6454): PMID [3] Lee SS, Lee RY, Fraser AG, Kamath RS, Ahringer J, Ruvkun G (2003). A systematic RNAi screen identifies a critical role for mitochondria in C. elegans longevity. NAT GENET. PMID [4] Ayyadevara S, Alla R, Thaden JJ, Shmookler Reis RJ (2008). "Remarkable longevity and stress resistance of nematode PI3K-null mutants". AGING CELL 7 (1): PMID Den kommande revolutionen inom livslängder för möss Bartke A, Brown- Borg H (2004). Life extension in the dwarf mouse. CURR TOP DEV BIOL. 63: PMID Harrison, D. E., Strong, R., Sharp, Z. D., Nelson, J. F., Astle, C. M., Flurkey, K., Nadon, N. L., Wilkinson, J. E., Frenkel, K., Carter, C. S., Pahor, M., Javors, M. A., Fernandez, E. and Miller, R. A. (2009) Rapamycin fed late in life extends lifespan in genetically heterogeneous mice. NATURE 460: PMID Spindler SR, Mote PL, Li R, Dhahbi JM, Yamakawa A, Flegal JM, Jeske DR, Li R, Lublin AL (2013). β1-adrenergic receptor blockade extends the life span of Drosophila and long-lived mice. AGE. PMID Martin-Montalvo A, Mercken EM, Mitchell SJ, Palacios HH, Mote PL, Scheibye-Knudsen M, Gomes AP, Ward TM, Minor RK, Blouin MJ, Schwab M, Pollak M, Zhang Y, Yu Y, Becker KG, Bohr VA, Ingram DK, Sinclair DA, Wolf NS, Spindler SR, Bernier M, de Cabo R (2013). Metformin improves healthspan and lifespan in mice. NAT COMMUN. 4:2192. PMID /01/15 Major Mouse Testing Program 25

Selektion av resistenta bakterier vid väldigt låga koncentrationer av antibiotika.

Selektion av resistenta bakterier vid väldigt låga koncentrationer av antibiotika. Selektion av resistenta bakterier vid väldigt låga koncentrationer av antibiotika. Linus Sandegren Uppsala Universitet Inst. för Medicinsk Biokemi och Mikrobiologi linus.sandegren@imbim.uu.se Hur påverkas

Läs mer

Klipp-och-klistra DNA: fixa mutationen med gen editering DNA, RNA och Protein

Klipp-och-klistra DNA: fixa mutationen med gen editering DNA, RNA och Protein Huntingtons sjukdom forsknings nyheter. I klartext Skriven av forskare För de globala HS medlemmarna. Klipp-och-klistra DNA: fixa mutationen med gen editering Forskare gör exakta ändringar av DNA i ett

Läs mer

Facit tds kapitel 18

Facit tds kapitel 18 Facit tds kapitel 18 Testa dig själv 18.1 1. Arvsanlagen finns i cellkärnan. Inför celldelningen samlas de i kromosomer. 2. Det kemiska ämne som bär på arvet kallas DNA. 3. Instruktionerna i DNA är ritningar,

Läs mer

Vad händer i ett genetiskt laboratorium?

Vad händer i ett genetiskt laboratorium? 12 utveckla nya metoder eller låta sådana prover delta i kvalitetskontrollprogram, såvida inte patienten har uttryckt att man inte vill att ens prov ska vara del av sådan verksamhet. Som alla andra sparade

Läs mer

Nobelpriset i fysiologi eller medicin 2012

Nobelpriset i fysiologi eller medicin 2012 Nobelpriset i fysiologi eller medicin 2012 De öppnade en värld av möjligheter Årets Nobelpristagare har visat att livets väg inte behöver vara enkelriktad. De har upptäckt att kroppens vuxna celler kan

Läs mer

Biologi breddning (mikrobiologi och immunologi) Kurskod: BI 1203-A Poäng: 50 Program: Förkunskapskrav: Biologi A och Biologi B

Biologi breddning (mikrobiologi och immunologi) Kurskod: BI 1203-A Poäng: 50 Program: Förkunskapskrav: Biologi A och Biologi B KURSBESKRIVNING Ämne: Biologi Kurs: Biologi breddning (mikrobiologi och immunologi) Kurskod: BI 1203-A Poäng: 50 Program: NV Förkunskapskrav: Biologi A och Biologi B Mål Kurserna Biologi breddning A och

Läs mer

Tiaminas och tiaminbrist i Östersjön. Svante Wistbacka Åbo Akademi

Tiaminas och tiaminbrist i Östersjön. Svante Wistbacka Åbo Akademi Tiaminas och tiaminbrist i Östersjön Svante Wistbacka Åbo Akademi Tiamin -Ett vattenlösligt vitamin i B-vitamin gruppen (vitamin B1) -Essentiell komponent i flera coenzym involverade i energimetabolismen

Läs mer

GENKOMB - en metod att hitta målprotein för läkemedel.

GENKOMB - en metod att hitta målprotein för läkemedel. ENKOMB - en metod att hitta målprotein för läkemedel. Erik urell dam meur Jakub Westholm i samarbete med strazeneca Disposition Biologisk bakgrund: cellen och arvsmassan proteinsyntes genuttryck och genuttrycksdata

Läs mer

Lärarhandledning gällande sidorna 6-27 Inledning: (länk) Läromedlet har sju kapitel: 5. Celler och bioteknik

Lärarhandledning gällande sidorna 6-27 Inledning: (länk) Läromedlet har sju kapitel: 5. Celler och bioteknik Senast uppdaterad 2012-12-09 55 Naturkunskap 1b Lärarhandledning gällande sidorna 6-27 Inledning: (länk) Celler och bioteknik C apensis Förlag AB Läromedlet har sju kapitel: 1. Ett hållbart samhälle 2.

Läs mer

Arvet och DNA. Genetik och genteknik

Arvet och DNA. Genetik och genteknik Arvet och DNA Genetik och genteknik Genetik Du är inte en kopia utav någon av dina föräldrar utan en unik blandning av egenskaper från båda dina föräldrar. Genetik är den del av biologin som handlar om

Läs mer

En sax för gener kan få Nobelpris

En sax för gener kan få Nobelpris En utskrift från Dagens Nyheters nätupplaga, DN.se, 2015 09 28 11:56:30 Artikelns ursprungsadress: http://www.dn.se/nyheter/vetenskap/en sax for gener kan fa nobelpris/ En sax för gener kan få Nobelpris

Läs mer

ÄGGSTOCKSCANCER FAKTABLAD. Vad är äggstockscancer (ovarialcancer)?

ÄGGSTOCKSCANCER FAKTABLAD. Vad är äggstockscancer (ovarialcancer)? ÄGGSTOCKSCANCER FAKTABLAD Vad är äggstockscancer (ovarialcancer)? ENGAGe ger ut en serie faktablad för att öka medvetenheten om gynekologisk cancer och stödja sitt nätverk på gräsrotsnivå. Äggstockscancer

Läs mer

GODA ANLEDNINGAR. till att bevara ditt barns stamceller. Ge ditt barn en gåva för livet samla och bevara stamceller från navelsträngen

GODA ANLEDNINGAR. till att bevara ditt barns stamceller. Ge ditt barn en gåva för livet samla och bevara stamceller från navelsträngen Ring 040-692 23 27 eller gå in på stemcare.se om du vill bevara ditt barns stamceller 5 GODA ANLEDNINGAR till att bevara ditt barns stamceller Ge ditt barn en gåva för livet samla och bevara stamceller

Läs mer

Det magiska med färgat ljus

Det magiska med färgat ljus Huntingtons sjukdom forsknings nyheter. I klartext Skriven av forskare För de globala HS medlemmarna. Upplysning av framskridandet av Huntingtons sjukdom Forskare har använt sig av möss med upplysta hjärnceller

Läs mer

Läkemedel. måndag 18 november 13. Ett projekt av Jonas, Jakob, Daniel och Mukti

Läkemedel. måndag 18 november 13. Ett projekt av Jonas, Jakob, Daniel och Mukti Läkemedel Ett projekt av Jonas, Jakob, Daniel och Mukti Ett projekt av Jonas, Jakob, Daniel och Mukti Vad har läkemedel tillfredsställt? God hälsa Sjukdomar och infektioner Droger Cancer, Alzheimer, AIDS

Läs mer

GODA ANLEDNINGAR. till att bevara ditt barns stamceller. Ge ditt barn en gåva för livet samla och bevara stamceller från navelsträngen

GODA ANLEDNINGAR. till att bevara ditt barns stamceller. Ge ditt barn en gåva för livet samla och bevara stamceller från navelsträngen Ring 040-15 22 22 eller gå in på stemcare.se om du vill bevara ditt barns stamceller 5 GODA ANLEDNINGAR till att bevara ditt barns stamceller Ge ditt barn en gåva för livet samla och bevara stamceller

Läs mer

GODKÄND BETYGSKRITERIER BIOLOGI

GODKÄND BETYGSKRITERIER BIOLOGI BETYGSKRITERIER BIOLOGI GODKÄND Växter känna till växtens grundproblem och hur växten tacklar problemen jämfört med djuren känna till att växterna har utvecklats successivt från enkla alger till blomväxter

Läs mer

Läkemedelsprövningar och slutsatser

Läkemedelsprövningar och slutsatser Huntingtons sjukdom forsknings nyheter. I klartext Skriven av forskare För de globala HS medlemmarna. TRACK-HD avslöjar betydande förändringar hos pre-symtomatiska mutationsbärare och personer med HS Ettårsrapporten

Läs mer

DELOMRÅDEN AV EN OFFENTLIG SAMMANFATTNING

DELOMRÅDEN AV EN OFFENTLIG SAMMANFATTNING EU RMP Läkemedelssubstans Bicalutamid Versionnummer 2 Datum 2 maj 2014 DEL VI: OFFENTLIG SAMMANFATTNING AV RISKHANTERINGSPLANEN VI: 2 DELOMRÅDEN AV EN OFFENTLIG SAMMANFATTNING Bicalutamid (CASODEX 1 )

Läs mer

PROJEKTDIREKTIV. Genomizer. Dokumenthistorik version datum utförda förändringar utförda av granskad

PROJEKTDIREKTIV. Genomizer. Dokumenthistorik version datum utförda förändringar utförda av granskad PROJEKTDIREKTIV Genomizer Dokumenthistorik version datum utförda förändringar utförda av granskad 1.1 20140410 Formulerat om kraven på leverabeln Teknisk dokumentation, samt ändrat formateringen av punkterna

Läs mer

KAN SKADLIGA GENER UTROTAS?

KAN SKADLIGA GENER UTROTAS? KAN SKADLIGA GENER UTROTAS? Den bärande idén bakom omfattande s.k. genetiska hälsoprogram är att det är möjligt att befria en hundstam från skadliga gener. En diskussion kring utformning av program för

Läs mer

Hört och lärt på NES2012 Session: Visual ergonomics

Hört och lärt på NES2012 Session: Visual ergonomics Ergonomisektionen/LSR Hört och lärt på NES2012 Session: Visual ergonomics Frukostseminarie I samverkan med Mousetrapper 2 oktober, 2012 08.30-09.30 Susanne Glimne Leg. Optiker/Universitetsadjunkt Optikerprogrammet

Läs mer

ACAS - ADAPTIVE COMPETENCY ASSESSMENT SURVEY - Copyright Dansk & Partners

ACAS - ADAPTIVE COMPETENCY ASSESSMENT SURVEY - Copyright Dansk & Partners ACAS - ADAPTIVE COMPETENCY ASSESSMENT SURVEY - En kartläggning av kostigarna i organisationen görs med metoden ACAS Adaptive Competence Assessment Survey Kostigarna = de informella vägarna för kompetensöverföring

Läs mer

en otrolig teknologi två fantastiska produkter

en otrolig teknologi två fantastiska produkter en otrolig teknologi två fantastiska produkter ASEA och RENU 28 liknar inte något du provat tidigare. Båda produkterna bygger på ASEA:s patenterade vetenskapliga teknologi. Vi berättar gärna mer om dessa

Läs mer

Individanpassad behandling av tumörsjukdomar NYA VÄGAR FÖR INDIVIDUALISERAD MALIGNT MELANOM. malignt melanom

Individanpassad behandling av tumörsjukdomar NYA VÄGAR FÖR INDIVIDUALISERAD MALIGNT MELANOM. malignt melanom Vid Sahlgrenska universitetssjukhuset och Sahlgrenska Akademin pågår utveckling av en ny analysplattform där patientens egen tumör är den biomarkör som avgör val av framtida behandling. För att uppnå detta

Läs mer

Vad Varje Cancerpatient Behöver Veta. Genom Guds nåd lever jag och är cancerfri!

Vad Varje Cancerpatient Behöver Veta. Genom Guds nåd lever jag och är cancerfri! Vad Varje Cancerpatient Behöver Veta. Genom Guds nåd lever jag och är cancerfri! Hej, det här är Chris från Chris Beat Cancer. I dag har jag ett väldigt speciellt videoklipp till er. Jag blir ofta kontaktad

Läs mer

Allmänt om adaptogener. Sammanfattning. Adaptogener. Rotary, Skurup, 2007. Kontaktinfo. Läs mer om adaptogener klicka här

Allmänt om adaptogener. Sammanfattning. Adaptogener. Rotary, Skurup, 2007. Kontaktinfo. Läs mer om adaptogener klicka här Allmänt om adaptogener Sammanfattning Adaptogener Rotary, Skurup, 2007 Läs mer om adaptogener klicka här Kontaktinfo Tack Adaptogener växter Ginseng Ginseng rot Fjärilsranka frukt 2 Adaptogener - produkter

Läs mer

Fakta äggstockscancer

Fakta äggstockscancer Fakta äggstockscancer Varje år insjuknar drygt 800 kvinnor i Sverige i äggstockscancer (ovariecancer) och omkring 600 avlider i sjukdomen. De flesta som drabbas är över 60 år och före 40 år är det mycket

Läs mer

Nej, i förhållande till den beräknade besparing som Bioptron ger, innebär den en avsevärd vård och kostnadseffektivisering.

Nej, i förhållande till den beräknade besparing som Bioptron ger, innebär den en avsevärd vård och kostnadseffektivisering. Hur hjälper behandling med Bioptron immunsystemet? Ljusbehandling har visat sig minska smärta på flera olika sätt. Activerar celler som gör bakterierna till sitt byte. Aktiverar celler som bryter ner mikrober.

Läs mer

Kanban är inte din process. (låt mig berätta varför) #DevLin2012 15 Mars 2012

Kanban är inte din process. (låt mig berätta varför) #DevLin2012 15 Mars 2012 Kanban är inte din process (låt mig berätta varför) #DevLin2012 15 Mars 2012 Torbjörn Tobbe Gyllebring @drunkcod tobbe@cint.com Är du eller känner du en Kanban hipster? Förut körde vi X nu kör vi Kanban

Läs mer

Stillasittande & ohälsa

Stillasittande & ohälsa Stillasittande & ohälsa FaR:s dag att skapa möjligheter till fysisk aktivitet 19 november Malmö Johan Faskunger Fil dr Fysisk aktivitet & hälsovetenskap Föreläsningens upplägg: Stillasittande & ohälsa

Läs mer

Wireframe när, vad, hur och varför?

Wireframe när, vad, hur och varför? Wireframe när, vad, hur och varför - 1 Wireframe när, vad, hur och varför? Arbetsflöde är ett samlande begrepp för alla steg som används för att göra en webbplats. Från första början till färdig sajt.

Läs mer

Stefan Widgren, SVA. Har EHEC bakterien kommit för att stanna? Konferens tisdag 25 oktober 2011, 10.00 17.00

Stefan Widgren, SVA. Har EHEC bakterien kommit för att stanna? Konferens tisdag 25 oktober 2011, 10.00 17.00 VTEC på djur i Sverige Stefan Widgren, SVA Har EHEC bakterien kommit för att stanna? Konferens tisdag 25 oktober 2011, 10.00 17.00 Kungl. Skogs och Lantbruksakademien, Stockholm Definitioner EHEC = Enterohemorrhagisk

Läs mer

FAKTABLAD Genetiskt provinsamling i rovdjursinventeringen

FAKTABLAD Genetiskt provinsamling i rovdjursinventeringen 1(5) FAKTABLAD Genetiskt provinsamling i rovdjursinventeringen Målsättning Syftet med detta faktablad är att ge en översikt av den genetiska provtagningen som tillämpas vid rovdjursinventeringen i Sverige

Läs mer

Hundar hjälper oss att förstå människans sjukdomar. Kerstin Lindblad-Toh

Hundar hjälper oss att förstå människans sjukdomar. Kerstin Lindblad-Toh Hundar hjälper oss att förstå människans sjukdomar Kerstin Lindblad-Toh Målsättning med min forskning Att hitta människors sjukdomsgener via: - djurmodeller - en bättre förståelse av arvsmassan - storskalig

Läs mer

Innovation och Entreprenörskap på Landsbygden

Innovation och Entreprenörskap på Landsbygden CENTER FOR INNOVATION, RESEARCH AND COMPETENCE IN THE LEARNING ECONOMY Innovation och Entreprenörskap på Landsbygden Martin Andersson Lund University and Blekinge Institute of Technology (BTH) martin.andersson@circle.lu.se

Läs mer

Fakta om tuberös skleros (TSC)

Fakta om tuberös skleros (TSC) Fakta om tuberös skleros (TSC) Tuberös skleros är en medfödd genetisk sjukdom som karaktäriseras av tumörliknande förändringar i hjärnan och olika organ i kroppen. Förändringarna kan vara allt från små

Läs mer

Målsättning med föreläsningen. - Ni ska känna till de grundläggande begreppen inom immaterialrätten

Målsättning med föreläsningen. - Ni ska känna till de grundläggande begreppen inom immaterialrätten Målsättning med föreläsningen - Ni ska känna till de grundläggande begreppen inom immaterialrätten - Ni ska kunna avgöra om, varför och hur er affärsidé kan skyddas - Ni ska kunna motivera era slutsatser

Läs mer

TENTAMEN. 18 januari 2006. APEX och BVLP, ht 05

TENTAMEN. 18 januari 2006. APEX och BVLP, ht 05 TENTAMEN 18 januari 2006 APEX och BVLP, ht 05 Block III: Integrativ biomedicin med farmakologisk inriktning Delkurs 5: Immunologi, infektion, tumörbiologi, och hematologi Kod: Max poäng: 77 Gränser (G/VG):

Läs mer

En bioinformatisk genjakt

En bioinformatisk genjakt En bioinformatisk genjakt Efter en ide från: CUSMOBIO, Milano, Italien. Hur man kan söka i databaser efter information om en gen som kan ge ökad risk för bröstcacer. Bakgrund Människor utan symptom men

Läs mer

PROJEKTDIREKTIV. Genomizer. Dokumenthistorik version datum utförda förändringar utförda av granskad. 1.0 20150327 Utlagd version jp jem, jp

PROJEKTDIREKTIV. Genomizer. Dokumenthistorik version datum utförda förändringar utförda av granskad. 1.0 20150327 Utlagd version jp jem, jp PROJEKTDIREKTIV Genomizer Dokumenthistorik version datum utförda förändringar utförda av granskad 1.1 20150408 Tidpunkt för posterredovisningen uppdaterad, ny tid är 9/4 15.15 jp jp 1.0 20150327 Utlagd

Läs mer

Allmänt om bakterier

Allmänt om bakterier Bakterier Allmänt om bakterier Bakterier är varken djur eller växter De saknar cellvägg och klorofyll De är viktiga nedbrytare - bryter ner döda växter och djur En matsked jord = 10 miljarder bakterier

Läs mer

Protokoll Föreningsutskottet 2013-10-22

Protokoll Föreningsutskottet 2013-10-22 Protokoll Föreningsutskottet 2013-10-22 Närvarande: Oliver Stenbom, Andreas Estmark, Henrik Almén, Ellinor Ugland, Oliver Jonstoij Berg. 1. Mötets öppnande. Ordförande Oliver Stenbom öppnade mötet. 2.

Läs mer

Kromosomer, celldelning och förökning

Kromosomer, celldelning och förökning Kromosomer, celldelning och förökning Kromosomen Hur ligger DNA lagrat? DNA 2 nm Prokaryota celler har vanligtvis endast en kromosom. I eukaryota celler finns alltid mer än en DNA-molekyl som bildar olika

Läs mer

Vad är Fabrys sjukdom? Information om Fabrys sjukdom

Vad är Fabrys sjukdom? Information om Fabrys sjukdom Vad är Fabrys sjukdom? Information om Fabrys sjukdom Inledning Fabrys sjukdom (även känd som Anderson-Fabrys sjukdom efter de två forskare som upptäckte sjukdomen) är en sällsynt genetisk sjukdom. Orsaken

Läs mer

PARTNER-studien. Du har bjudits in för att delta i den här studien eftersom du är den HIV-negativa partnern i förhållandet.

PARTNER-studien. Du har bjudits in för att delta i den här studien eftersom du är den HIV-negativa partnern i förhållandet. Deltagarinformation och informerat samtycke för den HIV-negativa partnern PARTNER-studien PARTNER-studien är en studie som riktar sig till par där: (i) den ena partnern är HIV-positiv och den andra är

Läs mer

α1-antitrypsin Brist Joyce Carlson, Labmedicin Skåne Klinisk kemi och Biobanken

α1-antitrypsin Brist Joyce Carlson, Labmedicin Skåne Klinisk kemi och Biobanken α1-antitrypsin Brist Joyce Carlson, Labmedicin Skåne Klinisk kemi och Biobanken Andlös upptäckt hos två patienter från Eksjö med emfysem 1962 Proteas- antiproteas imbalans Proteas Hämmare Proteas- antiproteas

Läs mer

Maria Bäck, Göteborg. Rörelserädsla. Ett hinder för lyckad hjärtrehabilitering?

Maria Bäck, Göteborg. Rörelserädsla. Ett hinder för lyckad hjärtrehabilitering? Kardiovaskulära Vårmötet XIVSvenska 25-27 april, 2012, Stockholm Maria Bäck, Göteborg Rörelserädsla Ett hinder för lyckad hjärtrehabilitering? Sahlgrenska Akademin, Institutionen för Medicin, Göteborgs

Läs mer

Fysisk aktivitet på Recept som behandlingsmetod inom hälso- och sjukvården

Fysisk aktivitet på Recept som behandlingsmetod inom hälso- och sjukvården Varför r skall vi arbeta med fysisk aktivitet/ FaR och andra levnadsvanor? Fysisk aktivitet på Recept som behandlingsmetod inom hälso- och sjukvården Stefan Lundqvist Leg sjukgymnast Medicinska, hälsoskäl

Läs mer

Kosttillskott fo r att minska riskfaktorer

Kosttillskott fo r att minska riskfaktorer KAPITEL 3 Kosttillskott fo r att minska riskfaktorer Artiklar i Läkartidningen 201209 och 20120912 diskuterar livsstil och hjärtkärlsjukdomar. Denna genomgång kan fungera som bas för att belysa betydelsen

Läs mer

Återhämtning - en introduktion

Återhämtning - en introduktion - en introduktion Återhämtning från allvarliga psykiska problem Luleå 24 april 2012 Alain Topor FoU-enheten. Psykiatri Södra Stockholm Institutionen för Socialt Arbete. Stockholms Universitet alain.topor@socarb.su.se

Läs mer

AvI-index. Ett instrument för att mäta IT-systems användbarhet

AvI-index. Ett instrument för att mäta IT-systems användbarhet ANDERS GUNÉR AvI-index Ett instrument för att mäta IT-systems användbarhet Iordanis Kavathatzopoulos Uppsala universitet ISBN 978-91-976643-5-6 Copyright 2008 Iordanis Kavathatzopoulos. Uppsala universitet,

Läs mer

Fysisk aktivitet och träning vid övervikt och fetma, vilka effekter nås?

Fysisk aktivitet och träning vid övervikt och fetma, vilka effekter nås? Fysisk aktivitet och träning vid övervikt och fetma, vilka effekter nås? Anita Wisén Forskargruppen sjukgymnastik Institutionen för hälsa, vård och samhälle Vad är fysisk aktivitet och träning? Intensitet

Läs mer

Diabetes som vällevnadens pris en jakt på sambandet mellan livsstil och diabetes.

Diabetes som vällevnadens pris en jakt på sambandet mellan livsstil och diabetes. V ä r l d s d i a b e t e s d a g e n M a l m ö 2 0 1 4 Diabetes som vällevnadens pris en jakt på sambandet mellan livsstil och diabetes. Patrik Rorsman Radcliffe Department of Medicine Oxford Centre for

Läs mer

Mitokondriella sjukdomar. Gittan Kollberg Avd för klinisk kemi Sahlgrenska Sjukhuset Göteborg

Mitokondriella sjukdomar. Gittan Kollberg Avd för klinisk kemi Sahlgrenska Sjukhuset Göteborg Mitokondriella sjukdomar Gittan Kollberg Avd för klinisk kemi Sahlgrenska Sjukhuset Göteborg Mitokondriell sjukdom Definition Oxidativ fosforylering Genetik och ärftlighet Biokemisk utredning av mitokondriefunktion

Läs mer

Konvention om rättigheter för personer med funktionsnedsättning. Lättläst version

Konvention om rättigheter för personer med funktionsnedsättning. Lättläst version Konvention om rättigheter för personer med funktionsnedsättning Lättläst version Konventionen om rättigheter för personer med funktionsnedsättning Här är konventionen omskriven till lättläst. Allt viktigt

Läs mer

ECONOMIC EVALUATION IN DENTISTRY A SYSTEMATIC REVIEW

ECONOMIC EVALUATION IN DENTISTRY A SYSTEMATIC REVIEW ECONOMIC EVALUATION IN DENTISTRY A SYSTEMATIC REVIEW Helena Christell, Stephen Birch, Keith Horner, Madeleine Rohlin, Christina Lindh Faculty of Odontology, Malmö University School of Dentistry, Manchester

Läs mer

Färgämne kan göra tomaten nyttigare

Färgämne kan göra tomaten nyttigare genteknik Färgämne kan göra tomaten nyttigare AV PER SNAPRUD UR F&F 1/2009. En ny typ av genförändrade tomater innehåller extra mycket antocyaniner, ämnen som ger färg åt bland annat rosor, röda höstlöv

Läs mer

Kan man bli symtomfri? Typ 1

Kan man bli symtomfri? Typ 1 Kan man bli symtomfri? Typ 1 Jag kom i kontakt med en kille som haft typ 1-diabetes i ungefär 15 år. Han har laborerat med att äta kolhydratsnålt och har därigenom klarat en del dagar utan att behöva ta

Läs mer

Finländarnas hälsa har kontinuerligt förbättrats under. Läkemedel används för att BOTA SJUKDOMAR OCH SPARA PENGAR

Finländarnas hälsa har kontinuerligt förbättrats under. Läkemedel används för att BOTA SJUKDOMAR OCH SPARA PENGAR JUSSI HUTTUNEN Med. dr., specialist i invärtesmedicin Generaldirektör emeritus, tid. Folkhälsoinstitutet Läkemedel används för att BOTA SJUKDOMAR OCH SPARA PENGAR En väl genomförd läkemedelsbehandling

Läs mer

Med LinkedIn kan du attrahera affärer och kontakter genom att bli synlig och sökbar. Det kan revolutionera sättet du gör affärer!

Med LinkedIn kan du attrahera affärer och kontakter genom att bli synlig och sökbar. Det kan revolutionera sättet du gör affärer! Varför LinkedIn? I alla tider har kontakter gjorts framgångsrikt genom personliga referenser. Nu kan du få kontakter genom personliga referenser på internet genom LinkedIn, världens största professionella

Läs mer

Deltagarinformation och informerat samtycke för den HIV-positiva partnern. PARTNER-studien

Deltagarinformation och informerat samtycke för den HIV-positiva partnern. PARTNER-studien Deltagarinformation och informerat samtycke för den HIV-positiva partnern PARTNER-studien PARTNER-studien är en studie som riktar sig till par där: (i) den ena partnern är HIV-positiv och den andra är

Läs mer

Åldrande och framtidens äldrevård de senaste forskningsrönen

Åldrande och framtidens äldrevård de senaste forskningsrönen Åldrande och framtidens äldrevård de senaste forskningsrönen Miia Kivipelto, MD, PhD Associate professor Bengt Winblad, Professor Aging Research Center Karolinska Institutet and Karolinska University Hospital,

Läs mer

Nystart för Karo Bio. VD Per Bengtsson. Årsstämma 12 juni 2012

Nystart för Karo Bio. VD Per Bengtsson. Årsstämma 12 juni 2012 Nystart för Karo Bio VD Per Bengtsson Årsstämma 12 juni 2012 Det gångna året Eprotiromeprogrammet avbröts i februari 2012 Långtidsstudie i hundar visade broskskador efter 12 månader Erosioner och svullnad

Läs mer

Metoder för stöd till barn som anhöriga

Metoder för stöd till barn som anhöriga Metoder för stöd till barn som anhöriga Länssamordnarna för anhörigstöd i Norrland Pågående arbeten Arbetet pågår nu med två kunskapsöversikter: Metoder för stöd till barn och unga med föräldrar som har

Läs mer

Datorer och matematik hjälper oss att motverka sjukdomar

Datorer och matematik hjälper oss att motverka sjukdomar Datorer och matematik hjälper oss att motverka sjukdomar Adam Ameur Bioinformatiker Lund, 26e November 2014 Introduktion till bioinformatik Bioinformatik - en tvärvetenskaplig disciplin där algoritmer

Läs mer

Spelar fysisk aktivitet någon roll för äldres psykiska tillstånd? Ingvar Karlsson

Spelar fysisk aktivitet någon roll för äldres psykiska tillstånd? Ingvar Karlsson Spelar fysisk aktivitet någon roll för äldres psykiska tillstånd? Ingvar Karlsson Hur kan fysisk aktivitet påverka hjärnan? Den fysiska aktiviteten skapar cytokiner som påverkar levern. I levern bildas

Läs mer

Cell Fusion i Hjärnan och Ryggmärgen Nya Möjligheter att Stödja Skadade Nervceller

Cell Fusion i Hjärnan och Ryggmärgen Nya Möjligheter att Stödja Skadade Nervceller Cell Fusion i Hjärnan och Ryggmärgen Nya Möjligheter att Stödja Skadade Nervceller Clas B. Johansson, Docent, af Jochnick fellow CMM, Karolinska Institutet Forskningsområden - Reparativ neurobiologi Blodcellers

Läs mer

Frågor och svar om stamceller

Frågor och svar om stamceller Frågor och svar om stamceller Att det finns stamceller i vår kropp och att de kan användas i medicinska behandlingar för att ersätta sjuka celler har man vetat länge. Mot slutet av 1990-talet lyckades

Läs mer

Johan Holm, Lund. Marfans syndrom. Patienten bakom syndromet vad är bra för kardiologen att veta?

Johan Holm, Lund. Marfans syndrom. Patienten bakom syndromet vad är bra för kardiologen att veta? Johan Holm, Lund Marfans syndrom Patienten bakom syndromet vad är bra för kardiologen att veta? Intressekonflikt: Regelbundna föreläsningar för Actelion Science, Vol 332, April 2011 Akut aortadissektion

Läs mer

National Prevention Strategy

National Prevention Strategy National Prevention Strategy Patrik Johansson, MD, MPH University of Nebraska Medical Center, College of Public Health, Member The Advisory Group on Prevention, Health Promotion, Integrative and Public

Läs mer

Symtomlindring i livets slutskede. Marit Karlsson Med dr, överläkare, LAH Linköping

Symtomlindring i livets slutskede. Marit Karlsson Med dr, överläkare, LAH Linköping Symtomlindring i livets slutskede Marit Med dr, överläkare, LAH Linköping Symtom i livets absoluta slutskede Sista två veckorna i livet Översiktsstudie baserad på 12 studier innehållande totalt 2412 patienter

Läs mer

Biosimilarer Vad är det?

Biosimilarer Vad är det? Biosimilarer Vad är det? Biosimilarer Vad är det? Introduktion Läkemedel är en viktig del av en god hälso- och sjukvård. Traditionellt har läkemedel tillverkats på kemisk väg men under de senaste decennierna

Läs mer

Bra att veta om din behandling med ORENCIA (abatacept) vid reumatoid artrit

Bra att veta om din behandling med ORENCIA (abatacept) vid reumatoid artrit Bra att veta om din behandling med ORENCIA (abatacept) vid reumatoid artrit O R E N C I A a b ata c e p t 1 2 O R E N C I A a b ata c e p t Innehåll Om Orencia 5 Din behandlingsplan 6 Biverkningar 9 Vanliga

Läs mer

profile4professionals Axiologisk Karriärprofil Kim Sample 4 Oktober 2006 v1.2.7

profile4professionals Axiologisk Karriärprofil Kim Sample 4 Oktober 2006 v1.2.7 profile4professionals Axiologisk Karriärprofil Kim Sample 4 Oktober 2006 v1.2.7 Bäste Kim, Välkommen! Vi tror att denna rapport kommer att bli en värdefull tillgång för dig oavsett om du befinner dig i

Läs mer

Värdet av det utförda ligger i utförandet. Albert Einstein

Värdet av det utförda ligger i utförandet. Albert Einstein Värdet av det utförda ligger i utförandet. Albert Einstein Idro%srörelsen 2.0 Kanske ingen revolu4on, men evolu4on! Utmaningar IF:s SF:s svensk idro% Nio samhällstrender/ samhällsförändringar som påverkar

Läs mer

Genetik- läran om det biologiska arvet

Genetik- läran om det biologiska arvet Genetik- läran om det biologiska arvet Om vi tittar på ett släktfotografi ser vi att vissa ansiktsdrag hos föräldrarna kommer igen hos barnen, från generation till generation. Det kan vara formen på ansiktet,

Läs mer

Introduktion till informationssökning. Lotta Janson Lotta Mathiesen

Introduktion till informationssökning. Lotta Janson Lotta Mathiesen Introduktion till informationssökning Lotta Janson Lotta Mathiesen Dagens innehåll Om projektet Introduktion till medicinsk informationssökning Vad är en vetenskaplig artikel Sökresurser (vetenskapliga

Läs mer

Designprinciper för säkerhet och Epilog. Marcus Bendtsen Institutionen för Datavetenskap (IDA) Avdelningen för Databas- och Informationsteknik (ADIT)

Designprinciper för säkerhet och Epilog. Marcus Bendtsen Institutionen för Datavetenskap (IDA) Avdelningen för Databas- och Informationsteknik (ADIT) Designprinciper för säkerhet och Epilog Marcus Bendtsen Institutionen för Datavetenskap (IDA) Avdelningen för Databas- och Informationsteknik (ADIT) Designprinciper för säkerhet Tumregler och utgångspunkter

Läs mer

Hjälper till att få tillbaka spänsten i benen.

Hjälper till att få tillbaka spänsten i benen. Hjälper till att få tillbaka spänsten i benen. Upprätthåller din hunds rörlighet för att få ut det mesta av livet. En guide från din veterinär och Nestlé Purina. Ledmobilitet GAD (dog UPPRÄTTHÅLLER HÄLSAN

Läs mer

Användarträff 2014. 19-20 November

Användarträff 2014. 19-20 November Användarträff 2014 19-20 November Välkommen till Pythagoras användarträff 2014! Så var det dags igen för årets användarkonferens. I år törs vi lova att den är fylld med fler nyheter än något tidigare år.

Läs mer

Rodnad och utslag? Läs mer om rosacea.

Rodnad och utslag? Läs mer om rosacea. Rodnad och utslag? Läs mer om rosacea. metronidazol Är du röd i ansiktet med akneliknande utslag, rodnad eller ytliga blodkärl? Det kan vara rosacea. Rosacea är en vanlig, kronisk hudsjukdom som kan uppträda

Läs mer

Karo Bio Världsledande inom nukleära receptorer

Karo Bio Världsledande inom nukleära receptorer Karo Bio Världsledande inom nukleära receptorer VD Per Bengtsson 29 november 2011 Karo Bio i korthet Grundat 1987 Karo Bio Karolinska Institutet Huddinge Noterat på NASDAQ OMX Stockholm sedan 1998 Börsvärde

Läs mer

Hälsa och välbefinnande en fråga om livsfilosofi?

Hälsa och välbefinnande en fråga om livsfilosofi? Hälsa och välbefinnande en fråga om livsfilosofi? Några reflektioner kring depression och smärta i det moderna samhället Chris Bingefors Effekt och effektivitet av läkemedelsbehandling Feedback av kunskap

Läs mer

Användningsfalls- mönster

Användningsfalls- mönster Användningsfalls- mönster Gunnar Övergaard gunnar.overgaard overgaard@jaczone.comcom Återanvända Erfarenhet Kanske dags att lära sig att om den här funktionen ska vara med i ett system så ska modellen

Läs mer

Inledning och introduktion till diabetes

Inledning och introduktion till diabetes Inledning och introduktion till diabetes Kristina Lejon Universitetslektor, immunologi, Institutionen för klinisk mikrobiologi Välkomna till den här dagen där vi ska berätta om diabetesforskning, framför

Läs mer

Snabbguide till GlobalTwitcher (Juni 2012)

Snabbguide till GlobalTwitcher (Juni 2012) Snabbguide till GlobalTwitcher (Juni 2012) Denna snabbguide är avsedd att hjälpa nya medlemmer att komma igång med huvudfunktionerna på GlobalTwitcher (GT). Siten innehåller dock ett stort antal funktioner

Läs mer

www.share-project.org Resultat från studien 50+ i Europa

www.share-project.org Resultat från studien 50+ i Europa www.share-project.org Resultat från studien 50+ i Europa Vad händer nu? Nästa steg för 50+ i Europa är att lägga till människors livshistoria till den existerande SHARE-databasen. Genom att koppla samman

Läs mer

Behandling med ICD och CRT. Björn Fredriksson SÄS/Borås 28 och 29 oktober 2009

Behandling med ICD och CRT. Björn Fredriksson SÄS/Borås 28 och 29 oktober 2009 Behandling med ICD och CRT Björn Fredriksson SÄS/Borås 28 och 29 oktober 2009 Systolisk hjärtsvikt Många är symtomatiska trots läkemedelsterapi Prognosen är allvarlig trots behandling Risk för försämring:

Läs mer

Volontärutbildning. Modul 1: Introduktion / Motivation

Volontärutbildning. Modul 1: Introduktion / Motivation Volontärutbildning Modul 1: Introduktion / Motivation Välkommen och program för dagen MODUL 1: Introduktion / Motivation Mål med utbildningen Introduktion Energi och klimatförändringar Klimatförändringar

Läs mer

Vad är värdet/faran med att operera tidigt? Sofia Strömberg Kärlkirurg Sahlgrenska Universitetssjukhuset

Vad är värdet/faran med att operera tidigt? Sofia Strömberg Kärlkirurg Sahlgrenska Universitetssjukhuset Vad är värdet/faran med att operera tidigt? Sofia Strömberg Kärlkirurg Sahlgrenska Universitetssjukhuset Symtomgivande Karotisstenos Naturalförloppet vid symptomgivande karotisstenos Results: There were

Läs mer

Hepatit C hos personer som injicerar droger (PWID)

Hepatit C hos personer som injicerar droger (PWID) Hepatit C hos personer som injicerar droger (PWID) Martin Kåberg Specialistläkare Infektion Överläkare Psykiatri/beroende Medicinskt ansvarig för sprututbytet Karolinska Universitetssjukhuset/Capio Maria

Läs mer

www.lucas-cpr.com a product by JOLIFE När varje sekund räknas...

www.lucas-cpr.com a product by JOLIFE När varje sekund räknas... www.lucas-cpr.com a product by JOLIFE När varje sekund räknas... När va Effektiva, jämna och oavbrutna kompressioner i enlighet med Riktlinjerna HLR 2005 Sternumkompressioner; 100 kompressioner per minut

Läs mer

Innehåll. Förord... 7. Inledning... 11. Tack... 195 Vidare läsning... 197 Illustrationer... 203 Register... 205. kapitel 1 Ursprung...

Innehåll. Förord... 7. Inledning... 11. Tack... 195 Vidare läsning... 197 Illustrationer... 203 Register... 205. kapitel 1 Ursprung... Innehåll Förord.... 7 Inledning.... 11 kapitel 1 Ursprung... 13 kapitel 2 Evolution.... 21 kapitel 3 Upptäckt... 33 kapitel 4 Miljö och civilisation... 49 kapitel 5 Bakteriell patogenes... 69 kapitel 6

Läs mer

Huntingtons sjukdom forsknings nyheter. I klartext Skriven av forskare För de globala HS medlemmarna. EuroBuzz 2014: dag ett

Huntingtons sjukdom forsknings nyheter. I klartext Skriven av forskare För de globala HS medlemmarna. EuroBuzz 2014: dag ett Huntingtons sjukdom forsknings nyheter. I klartext Skriven av forskare För de globala HS medlemmarna. EuroBuzz 2014: dag ett Höjdpunkter från öppningsdagen av 2014 Europeiska Huntington Sjukdoms nätverks

Läs mer

Erik Eriksson VMD Enheten för Bakteriologi

Erik Eriksson VMD Enheten för Bakteriologi Diagnostik VTEC/EHEC Erik Eriksson VMD Enheten för Bakteriologi SVA Tänker prata om VTEC / EHEC Sjukdomsframkallande faktorer PCR Magnetiska kulor (Immunomagnetisk separation) Diagnostik de vanligaste

Läs mer

Kroppens försvarare. Immunförsvarets dubbla försvarslinjer

Kroppens försvarare. Immunförsvarets dubbla försvarslinjer Nobelpriset i fysiologi eller medicin 2011 Kroppens försvarare Varje dag, timme, minut och sekund dukar myriader av små angripare under i kampen mot vårt immunförsvar. Immunförsvaret har en fantastisk

Läs mer

Riskhantering. med exempel från Siemens

Riskhantering. med exempel från Siemens Riskhantering med exempel från Siemens Gunnel Sundberg Riskhantering Riskidentifiering Riskvärdering Riskåtgärdsplanering Riskbemötande 1 Siemens Industrial Turbomachinery AB R&D, sales, design, manufacturing,

Läs mer

Du hittar en knöl vad händer sen?

Du hittar en knöl vad händer sen? Du hittar en knöl vad händer sen? Följ med på en resa från provtagning till provsvar. Vi har besökt punktionsmottagningen och patologiska/cytologiska kliniken vid Skånes universitetssjukhus i Lund. 1 På

Läs mer

GMC Software Technology CCM Made Easy

GMC Software Technology CCM Made Easy GMC Software Technology CCM Made Easy GMC Software Technology Nordic CCM Meeting November 2013 With over 2 billion customer communications a year, GMC Inspire delivered a top 5 US bank streamlined CCM

Läs mer