Tillämpning av olika molekylärbiologiska verktyg för kloning av en gen

Save this PDF as:
 WORD  PNG  TXT  JPG

Storlek: px
Starta visningen från sidan:

Download "Tillämpning av olika molekylärbiologiska verktyg för kloning av en gen"

Transkript

1 IFM/Kemi Linköpings Universitet September 2011/LGM Projektlaboration i genteknik Tillämpning av olika molekylärbiologiska verktyg för kloning av en gen

2 Innehållsförteckning Inledning... 3 Amplifiering av gen med PCR... 4 Restriktionsklyvning... 5 Rening av DNA... 6 Agarosgelelektrofores... 7 Ligering av vektor och PCR fragment... 8 Transformering av vektor efter ligering... 9 Analys av transformanter Appendix

3 Inledning Denna laboration, som omfattar ~3stycken heldagar, syftar till att ge laborativ erfarenhet av några olika moment som används vid kloning såsom t.ex. restriktionsklyvning och ligering. För varje laborationsmoment finns ett standardprotokoll med olika frågeställningar /funderingar som gås igenom innan ni sätter igång labmomentet. Laborationsmässigt kommer ni att arbeta i något större laborationsgrupper (4-6 st i varje grupp) där ni inom gruppen fördelar arbetet som anges för de olika momenten enligt flödesschemat (Figur 1). Varje grupp för noggranna anteckningar för de olika laborationsmomenten. Redovisning sker i form av en muntlig utvärdering av de erhållna resultaten. Amplifiering av gen med PCR Analys av vektor och PCR produkt på agarosgel Restriktionsklyvning av vektor Rening av PCR produkt Rening av vektor efter restriktionsklyvning Restriktionsklyvning av PCR produkt Rening efter restriktionsklyvning Ligering av vektor och PCR produkt Transformering av ligeringsblandning Screening av kolonier med PCR Analys av transformanter på agarosgel Figur 1: Flödesschema över de olika momenten i projektlaborationen 3

4 Amplifiering av gen med PCR Frågeställningar/funderingar: Utgående från primersekvensen, ge förslag på lämplig PCR cykel Vad händer om annealingtemperaturen är för hög? Respektive för låg? Uppskatta det molära förhållandet mellan vektor DNA och primer, hur stort är överskottet? Hur beräknas smältpunkten för primers? Vad bör man tänka på vid designen av primers? Utförande: DNA: 1 µl Primer_forward: 1 µl Primer_reverse: 1 µl 10X dntp-mix: 2 µl 10X Reaktionsbuffert: 2 µl H 2 O: 12 µl Taq polymeras: 1 µl Totalvolym: 20 µl Tag ut 5 µl för analys på agarosgel efter reaktionen, resten används för restriktionsklyvning. Lästips: T.A Brown Gene Cloning and DNA analysis, 6 th edition, sid

5 Restriktionsklyvning Frågeställningar/funderingar: Vad innebär 1 Unit? Vid vilken temperatur och hur länge ska reaktionen ske? Hur sker inaktivering av enzymerna? Vad händer om man INTE inaktiverar enzymerna? Vad bör man tänka på i val av reaktionsbuffert då man har två olika restriktionsenzymer i blandningen? Vilka kontroller bör ingå för att veta att bägge enzymerna har fungerat? Restriktionsklyvning av vektor/fragment: DNA: ( ng) X µl Restriktionsenzym NcoI: 1 µl Restriktionsenzym HindIII: 1 µl 10X Reaktionsbuffert: 2 µl H 2 O: Y µl Totalvolym: 20 µl Tag ut 5 µl för analys på agarosgel, resterande volym renas med lämpligt reningskit. Lästips: T.A Brown Gene Cloning and DNA analysis, 6 th edition, sid

6 Rening av DNA Vid all manipulering av DNA såsom PCR amplifiering eller restriktionsklyvning behöver DNA:t renas efter reaktionen. Reningen tjänar flera syften, man blir av med överskott av t.ex. primer och restriktionsenzymer, reaktionsbufferten byts ut mot H 2 O och man får även en koncentrering av sitt prov. I denna projektlaboration kommer vi att använda oss av ett okommersiellt kit för att rena DNA. Detta kit bygger på att DNA:t binds till en fast matris och sedan elueras ut i liten volym sterilt H 2 O. Rening av PCR produkt efter amplifiering och efter klyvning (QIAgen minelute PCR purification kit) Utförande: 1) Tillsätt 5 volymer av PB-buffert till reaktionsblandningen. 2) Centrifugera 1 min i minelute kolonnen för att binda in DNA. 3) Kasta lösningen och tillsätt 750 µl tvättlösning, centrifugera 1 min och kasta lösningen. 4) Centrifugera kolonnen torr för få bort ev. överflödig tvättlösning. 5) Tillsätt 10 µl H 2 O och låt stå 1 min. Överför minelute kolonnen till ett nytt epp.rör och centrifugera 1 min. 6) Provet finns nu i epp.röret och är klart att användas för ligering. Lästips: Information från Qiagenom Minelute PCR purification Kit: actioncleanupkit.aspx?r=2538 6

7 Frågeställningar/funderingar: Agarosgelelektrofores Vilka kontroller bör vara med vid elektroforesen Vad händer om du har för låg respektive för hög spänning vid elektroforesen? Vad bör du tänka på vid preparativt agarosgelarbete? Vilken koncentration på agarosgelen ska du använda? Utförande: Gjutning av agarosgel 1) I en 250 ml flaska tillsätts g agaros och 10ml 10x TBE buffert och spädes med vatten till totalvolymen 100ml. 2) Värm agarosgelen tills den är helt flytande, i ett vattenbad eller i mikrovågsugn. Låt blandningen svalna en stund (till ca 60 o C) och gjut agarosgelen. Låt gelen svalna i minst 30 minuter. Elektroforetisk separation av DNA 1) Blanda 4 µl laddningsbuffert med 5µl DNA och 11µl H 2 O. 2) Tillsätt 5 µ färdigblandad molekylviktsmarkör 3) Lägg agarosgelen i elektroforesapparaten och fyll på med 1x TBE buffert, så att det täcker gelen. 4) Applicera sakta och försiktigt proverna i provbrunnarna med en automatpipett (de ska sjunka ned i botten på brunnen). 5) Separera DNA fragmenten genom att lägga på en spänning ~100 Volt. Kom i håg att DNA är negativt laddat. 6) När den blåa markören har nått ca 2/3 ner på gelen avbryts elektroforesen och DNA fragmenten infärgas med etidiumbromid. Etidiumbromid som interkalerat med DNA kan ses genom att gelen belyses med nm ljus på en transluminator. Skydda ögonen genom att använda skyddsglasögon och använd handskar vid arbete med Etidiumbromid. 7) Fotografera av gelen och uppskatta mängden DNA ni har erhållit. Lästips: T.A Brown Gene Cloning and DNA analysis, 6 th edition, sid

8 Frågeställningar/funderingar: Ligering av vektor och PCR fragment Vilket molärt förhållande mellan vektor och fragment ska det vara vid reaktionen? Hur vet man mängden DNA? Hur lång ligeringstid och vid vilken temperatur? Vad bör man tänka på vid ligering av blunt-ends istället för sticky-ends? Vilka kontroller bör vara med ligeringsreaktionen? Vad innebär 1 Unit? Utförande: 1) Tag ~50ng vektor och 3-faldigt molärt överskott av PCR produkt. Justera volymen till 10 µl med H 2 O. 2) Tillsätt 10 µl 2 X quick Ligation buffer och blanda. 3) Tillsätt 1 µl Quick T4 DNA ligas och blanda noggrant, centrifugera blandningen några sekunder. 4) Inkubera i rumstemperatur 5-15 min. 5) Ställ blandningen på is. 6) Transformera ligeringsblandningen eller frys ned -20 C för transformering senare. Lästips: T.A Brown Gene Cloning and DNA analysis, 6 th edition, sid

9 Transformering av vektor efter ligering Frågeställningar/funderingar: Vilka kontroller bör vara med ligeringsreaktionen? Utförande: 1) Tina de superkompetenta Nova Blue cellerna portionerade i 50µl:s portioner. 2) Till varje 50µl:s portion av superkompetenta celler tillsätts 1-5µl av prov, kontroll eller transformationskontroll. 3) Blanda försiktigt med pipettspetsen och inkubera på is 30 minuter. 4) Värmechocka cellerna genom att placera rören i värmeblock 45 sekunder vid 42 C, placera sedan rören på is i 2 minuter. 5) Tillsätt 200µl av förvärmt (42 C.) SOC odlingsmedium och inkubera transformationsreaktionen 1 timme i 37 C. 6) Tag 200 µl av den inkuberade blandningen och sprid på agarplatta. 7) Dagen efter transformation (ca 16 timmar) kontrolleras transformationsgraden. Räkna antalet kolonier på de olika agarplattorna. Lästips: T.A Brown Gene Cloning and DNA analysis, 6 th edition, sid

10 Analys av transformanter För att säkert kunna hitta transformanter med klonad gen finns ett antal olika metoder. Den allra bästa är att göra plasmidpreparation på ett antal kolonier och sedan bestämma DNA sekvensen på de olika klonerna. Då denna metod är något omständlig ska vi prova att göra koloni screening med PCR. Denna metod bygger på att ett antal kolonier från agarplattan (1 koloni i varje rör) förs över till ett rör och DNA innehållet amplifieras med PCR. Då vi använder samma primers som vi använde för att isolera genen kommer vi att kunna identifiera de kolonier som har genen insatt i vektorn. Utförande: 1) Blanda följande lösningar i PCR rör (1 rör för varje koloni, märk rören noggrant) Primer_forward: 1 µl Primer_reverse: 1 µl 10X dntp-mix: 2 µl 10X Reaktionsbuffert: 2 µl H 2 O: 12 µl Totalvolym: ~20 µl 2) Plocka en koloni med tandpetare och ympa ned i PCR röret. 3) Värm PCR röret 95 C i 5 min. 4) Tillsätt 1 µl Taq polymeras, blanda med kort centrifugering. 5) Amplifiera DNA:t med samma PCR cykel som ni använde för att isolera genen. 6) Efter avslutad PCR tillsätts 4 µl laddningsbuffert och proverna analyseras på agarosgel. 10

11 A-skftet Appendix Primer_forward: 5 -GCGCCCATGGGCAGCAGCCATCATCAT-3 Primer_reverse: 5 -GCGCAAGCTTTCACTTTTCTGTAAGTAGACATAAC ATGGGCAGCAGCCATCATCATCATCATCACAGCAGCGGCCTGGTTCCGCG TGGTAGTACTGAGGTACAGAAAAACCAAGTACTAACTCTGGAAGAATGGC AAGACAAGTGGGTGAACGGCAAGACTGCTTTTCATCAGGAACAAGGACA TCAGCTATTAAAGAAGCATTTAGATACTTTCCTTAAAGGCAAGAGTGGAC TGAGGGTATTTTTTCCTCTTTGCGGAAAAGCGGTTGAGATGAAATGGTTTG CAGACCGGGGACACAGTGTAGTTGGTGTGGAAATCAGTGAACTTGGGATA CAAGAATTTTTTACAGAGCAGAATCTTTCTTACTCAGAAGAACCAATCAC CGAAATTCCTGGAACCAAAGTATTTAAGAGTTCTTCGGGGAACATTTCATT GTACTGTTGCAGTATTTTTGATCTTCCCAGGACAAATATTGGCAAATTTGA CATGATTTGGGATAGAGGAGCATTAGTTGCCATTAATCCAGGTGATCGCA AATGCTATGCAGATACAATGTTTTCCCTCCTGGGAAAGAAGTTTCAGTATC TCCTGTGTGTTCTTTCTTATGATCCAACTAAACATCCAGGTCCACCATTTTA TGTTCCACATGCTGAAATTGAAAGGTTGTTTGGTAAAATATGCAATATACG TTGTCTTGAGAAGGTTGATGCTTTTGAAGAACGACATAAAAGTTGGGGAA TTGACTGTCTTTTTGAAAAGTTATGTCTACTTACAGAAAAGTGA-3 Figur 3: DNA sekvens av genen som ska amplifieras med PCR. B-Skiftet Primer_forward: 5 -GCGCGCGCATATGGCCCATCACTGGGGG-3 Primer_reverse: 5 -GCGCGCCGGCCGTTATTTGAAGGAAGCTTTGATTTG 3 Figur 2: Primers för PCR amplifiering. Understruket indikerar restriktionssiten och baser i kursiv stil den del av primer som binder till genen. 11

12 5 - ATGGGAGTCTTTAGCAAGTGTGAGCTGGCCCACAAGCTGAAAGCCCAG GAGATGGATGGATTCGGCGGATACAGCCTGGCCAACTGGGTGTGTATGG CCGAGTACGAGAGTAACTTCAACACCCGAGCTTTCAACGGAAAAAACGC AAACGGGAGCTCAGATTACGGCCTGTTCCAGCTGAACAACAAGTGGTGG TGCAAGGATAACAAGCGAAGCTCCTCGAACGCCTGCAACATCATGTGCT CAAAGCTGCTGGACGAGAACATAGACGATGACATCTCCTGCGCGAAGCG AGTCGTCCGAGATCCAAAGGGCATGAGCGCGTGGAAGGCCTGGGTCAAG CACTGCAAGGACAAGGACCTGAGCGAGTACCTGGCGAGCTGCAACCTGT GATGAAA-3 Figur 4: DNA sekvens av genen som ska amplifieras med PCR. Länkar: 1. New England Biolabs hemsida om restriktionsenzymer: 2. QIAgen minelute PCR purification kit: on/minelute/ _hb_qq_minelute_0604.pdf 3. New England Biolabs hemsida om quick ligation kit: 12

Tillämpning av olika molekylärbiologiska verktyg för kloning av en gen

Tillämpning av olika molekylärbiologiska verktyg för kloning av en gen IFM/Kemi Linköpings Universitet September 2004/LGM Projektlaboration i genteknik Tillämpning av olika molekylärbiologiska verktyg för kloning av en gen Innehållsförteckning Inledning... 3 Amplifiering

Läs mer

/LGM. Amplifiering och analys av humant mitokondrie-dna med hjälp av PCR teknik och agarosgelelektrofores

/LGM. Amplifiering och analys av humant mitokondrie-dna med hjälp av PCR teknik och agarosgelelektrofores 2008-01-18/LGM Amplifiering och analys av humant mitokondrie-dna med hjälp av PCR teknik och agarosgelelektrofores Syfte: Med två olika DNA extraktionsmetoder försöka få fram tillräckligt mycket celler

Läs mer

Linköpings Universitet. Lägesspecifik Mutagenes av proteiner

Linköpings Universitet. Lägesspecifik Mutagenes av proteiner IFM/Kemi Linköpings Universitet Augusti 2007/LGM Lägesspecifik Mutagenes av proteiner Lägesspecifik mutagenes Introduktion In vitro lägesspecifik mutagenes är en ovärderlig teknik för att t.ex. studera

Läs mer

Linköpings Universitet. Laboration i genteknik

Linköpings Universitet. Laboration i genteknik IFM/Kemi Linköpings Universitet Maj 2008/LGM Laboration i genteknik Restriktionskarta av pcantab Restriktionsklyvning samt separation av DNA-fragment mha agarosgelelektrofores Material: pcantab (minst

Läs mer

TFKE32/TFKI09/9KEA21. Laboration i Genteknik

TFKE32/TFKI09/9KEA21. Laboration i Genteknik TFKE32/TFKI09/9KEA21 Laboration i Genteknik Denna laboration består av tre delar: A. Restriktionsklyvning av plasmiden pcantab samt konstruering av restriktionskarta. B. Preparation av plasmiden pcantab

Läs mer

LAB 12. Preparation och analys av plasmid-dna från E.coli

LAB 12. Preparation och analys av plasmid-dna från E.coli Institutionen för biokemi och biofysik LAB 12 Preparation och analys av plasmid-dna från E.coli Basåret 2012 (finns på basårshemsida: www.kemi.su.se, välj Basår) INTRODUKTION I denna laboration ska vi

Läs mer

Laboration v.40 Detektion av Legionella pneumophilia med nestad PCR

Laboration v.40 Detektion av Legionella pneumophilia med nestad PCR Avdelningen för kemi och biomedicin Karlstads universitet Laboration v.40 Detektion av Legionella pneumophilia med nestad PCR Frågeställning: Vattenlednings system med tillväxt av Legionella pneumophilia

Läs mer

Laboration DNA. Datum:16/11 20/ Labgrupp: 11 Laboranter: Johanna Olsson & Kent Johansson

Laboration DNA. Datum:16/11 20/ Labgrupp: 11 Laboranter: Johanna Olsson & Kent Johansson Laboration DNA Datum:16/11 20/11 2015 Labgrupp: 11 Laboranter: Johanna Olsson & Kent Johansson Material och metod Materiallista hänvisas till labhandledning s.3 (BIMA15 ht 2015, Lab III: DNA.) Uppsamling

Läs mer

Genkloning och PCR av tetracyklinresistensgen. från pacyc184 till puc19

Genkloning och PCR av tetracyklinresistensgen. från pacyc184 till puc19 Umeå Universitet Biomedicinska analytikerprogrammet Genkloning och PCR av tetracyklinresistensgen från pacyc184 till puc19 Årskull: Laborationsrapport i Molekylärbiologisk laboratoriemetodik, termin 3

Läs mer

Genkloning och PCR av tetracyklinresistensgen från pacyc184

Genkloning och PCR av tetracyklinresistensgen från pacyc184 Umeå Universitet Biomedicinska analytikerprogrammet Genkloning och PCR av tetracyklinresistensgen från pacyc184 Årskull: Laborationsrapport i molekylärbiologisk labmetodik, termin 4 Laborationsdatum: Inlämnad:

Läs mer

DNA-labb / Plasmidlabb

DNA-labb / Plasmidlabb Översikt DNA-labb Plasmidlabb Preparation och analys av -DNA från Escherichia coli Varför är vi här idag? Kort introduktion till biokemi och rekombinant DNA- teknologi Vad skall vi göra idag? Genomgång

Läs mer

Polymerase Chain Reaction

Polymerase Chain Reaction Polymerase Chain Reaction The Polymerase Chain Reaction Molekylärbiologisk metodik T3 ht 11 Märit Karls Kunskapsmål för detta avsnitt Från kursplan: Studenten skall kunna: förklara grundläggande principer

Läs mer

Expression, produktion och rening av Fatty acid binding protein (FABP) från ökenmyran Cataglyphis fortis

Expression, produktion och rening av Fatty acid binding protein (FABP) från ökenmyran Cataglyphis fortis UNIVERSITETET I LINKÖPING Proteinkemi Kemiavdelningen 2011-02-04 Expression, produktion och rening av Fatty acid binding protein (FABP) från ökenmyran Cataglyphis fortis Produktion av FABP i E. coli bakterier

Läs mer

Ladokkod: TK151C Tentamen ges för: Bt3. Namn: Person nummer: Tentamensdatum: 17/12 2012. Tid: 09:00-13:00. Hjälpmedel

Ladokkod: TK151C Tentamen ges för: Bt3. Namn: Person nummer: Tentamensdatum: 17/12 2012. Tid: 09:00-13:00. Hjälpmedel Molekylärbiologi 7.5 ECTS Ladokkod: TK151C Tentamen ges för: Bt3 Namn: Person nummer: Tentamensdatum: 17/12 2012 Tid: 09:00-13:00 Hjälpmedel Tillåtna hjälpmedel är lexikon. Dock EJ elektroniskt lexikon

Läs mer

Laboratoriemetod för att manuellt rena DNA från ett prov på 0,5 ml

Laboratoriemetod för att manuellt rena DNA från ett prov på 0,5 ml Laboratoriemetod för att manuellt rena DNA från ett prov på 0,5 ml För att rena genomiskt DNA från insamlingssatser tillhörande Oragene och ORAcollect -familjerna. Besök vår hemsida, www.dnagenotek.com,

Läs mer

Mångfaldigande av mänskligt mitokondrie-dna

Mångfaldigande av mänskligt mitokondrie-dna John Schollar och Andy Harrison NCBE, The University of Reading Mångfaldigande av mänskligt mitokondrie-dna Syfte Med denna procedur kan du mångfaldiga ett 460 baspar långt stycke DNA, som finns i kontrollregion

Läs mer

ChromoQuant In vitro diagnostiskt test kit för analys av vanligen förekommande aneuploidier i kromosomerna 13, 18 och 21 samt i X och Y.

ChromoQuant In vitro diagnostiskt test kit för analys av vanligen förekommande aneuploidier i kromosomerna 13, 18 och 21 samt i X och Y. Bruksanvisning revision 6 (December 2008) ChromoQuant In vitro diagnostiskt test kit för analys av vanligen förekommande aneuploidier i kromosomerna 13, 18 och 21 samt i X och Y. Se förpackning Se förpackning

Läs mer

Institutionen för laboratoriemedicin Bilaga 2 Biomedicinska analytikerprogrammet Analytisk Kemi och Biokemisk metodik Ht 2010, Termin 3

Institutionen för laboratoriemedicin Bilaga 2 Biomedicinska analytikerprogrammet Analytisk Kemi och Biokemisk metodik Ht 2010, Termin 3 Institutionen för laboratoriemedicin Bilaga 2 Biomedicinska analytikerprogrammet Analytisk Kemi och Biokemisk metodik Ht 2010, Termin 3 Laborationsdatum: 17 22 november 2010 Grupp: 2 Projekt: Rening och

Läs mer

Undersökning av förekomst av okända virus hos svenska fjällrävar med encefalit

Undersökning av förekomst av okända virus hos svenska fjällrävar med encefalit Undersökning av förekomst av okända virus hos svenska fjällrävar med encefalit Helena Thörnvall Handledare: Mikael Berg Inst. för Biomedicin och Veterinär Folkhälsovetenskap, avdelningen för Parasitologi

Läs mer

Preparation och spektroskopisk karakterisering av Myoglobin

Preparation och spektroskopisk karakterisering av Myoglobin Datum på laborationen: 2010-11-16 Handledare: Alexander Engström Preparation och spektroskopisk karakterisering av Myoglobin Namn/Laborant: Jacob Blomkvist Medlaborant: Emmi Lindgren Antonia Alfredsson

Läs mer

ChromoQuant In vitro diagnostiskt test kit för analys av vanligen förekommande aneuploidier i kromosomerna 13, 18 och 21 samt i X och Y.

ChromoQuant In vitro diagnostiskt test kit för analys av vanligen förekommande aneuploidier i kromosomerna 13, 18 och 21 samt i X och Y. Bruksanvisning revision 7 (Februari 2009) ChromoQuant In vitro diagnostiskt test kit för analys av vanligen förekommande aneuploidier i kromosomerna 13, 18 och 21 samt i X och Y. Se förpackning Se förpackning

Läs mer

Sammanställning över alternativ till etidiumbromid

Sammanställning över alternativ till etidiumbromid 1 (6) Sammanställning över alternativ till etidiumbromid I nedanstående tabeller har leverantörerna VWR, Invitrogen och Sigma-Aldrich lämnat uppgifter om produkter/n de saluför som alternativ till etidiumbromid.

Läs mer

Isolering och rening av proteinet tiopurinmetyltransferas

Isolering och rening av proteinet tiopurinmetyltransferas Isolering och rening av proteinet tiopurinmetyltransferas Inledning och syfte Proteinet tiopurinmetyltransferas (TPMT) är ett humant enzym vars naturliga funktion ännu är okänd. Proteinet katalyserar överföring

Läs mer

Kopiera DNA med hjälp av PCR-metoden. Niklas Dahrén

Kopiera DNA med hjälp av PCR-metoden. Niklas Dahrén Kopiera DNA med hjälp av PCR-metoden Niklas Dahrén Först lite allmän kunskap om kromosomer, DNA, gener etc. Varje kromosom består av en lång DNAmolekyl som är lindad runt histoner En gen är en liten del

Läs mer

Preparation av hemoglobin med hjälp av gelfiltrering

Preparation av hemoglobin med hjälp av gelfiltrering Preparation av hemoglobin med hjälp av gelfiltrering Teori Vid preparation av ett protein används en rad olika metoder för att specifikt rena fram det önskade proteinet. I vårt fall ska hemoglobin från

Läs mer

Instuderingsfrågor avsnitten Molekylär genetik och Rekombinant DNA tekniker, MCB

Instuderingsfrågor avsnitten Molekylär genetik och Rekombinant DNA tekniker, MCB Instuderingsfrågor avsnitten Molekylär genetik och Rekombinant DNA tekniker, MCB Molekylärgenetikdelen 1. Vad är DNA? 2. Vad heter byggstenarna i DNA? 3. Vad är RNA? 4. Vad är en bas, nukleosid, nukleotid

Läs mer

C V C. Bruksanvisning till Biofortuna SSPGo TM HLA Wipe Test BF-40-01. Revision 3. Juli 2014

C V C. Bruksanvisning till Biofortuna SSPGo TM HLA Wipe Test BF-40-01. Revision 3. Juli 2014 Dot159v1 Instructions for Use for Biofortuna SSPGo TM HLA Wipe Test BF-40-01 Sidan 1 av 8 Bruksanvisning till Biofortuna SSPGo TM HLA Wipe Test BF-40-01 Revision 3 Juli 2014 Dot159v1 Instructions for Use

Läs mer

Lärarhandledning gällande sidorna 6-27 Inledning: (länk) Läromedlet har sju kapitel: 5. Celler och bioteknik

Lärarhandledning gällande sidorna 6-27 Inledning: (länk) Läromedlet har sju kapitel: 5. Celler och bioteknik Senast uppdaterad 2012-12-09 55 Naturkunskap 1b Lärarhandledning gällande sidorna 6-27 Inledning: (länk) Celler och bioteknik C apensis Förlag AB Läromedlet har sju kapitel: 1. Ett hållbart samhälle 2.

Läs mer

Biologi breddning (mikrobiologi och immunologi) Kurskod: BI 1203-A Poäng: 50 Program: Förkunskapskrav: Biologi A och Biologi B

Biologi breddning (mikrobiologi och immunologi) Kurskod: BI 1203-A Poäng: 50 Program: Förkunskapskrav: Biologi A och Biologi B KURSBESKRIVNING Ämne: Biologi Kurs: Biologi breddning (mikrobiologi och immunologi) Kurskod: BI 1203-A Poäng: 50 Program: NV Förkunskapskrav: Biologi A och Biologi B Mål Kurserna Biologi breddning A och

Läs mer

Expression of recombinant protein including an. His-tag to facilitate purification for diagnosis of. CCHF and Lassa viruses

Expression of recombinant protein including an. His-tag to facilitate purification for diagnosis of. CCHF and Lassa viruses Examensarbete 10 poäng C-nivå Vt. 2006 Institutionen för medicinsk biokemi och mikrobiologi Biomedicinska analytikerprogrammet Expression of recombinant protein including an His-tag to facilitate purification

Läs mer

Laborationer i Cellbiologi med biokemi Lab 6-10

Laborationer i Cellbiologi med biokemi Lab 6-10 Laborationer i Cellbiologi med biokemi Lab 6-10 Biomedicinprogrammet, termin 2 VT 2013 2 Innehållsförteckning Ordnings- och säkerhetsföreskrifter 3 6: Odling av bakterier 4 7: Polymerase Chain Reaction

Läs mer

Kloning och rening av GFP

Kloning och rening av GFP Kloning och rening av GFP Ida Harila Projektarbete 100p Luleå 2012 Handledare: Marcus Wallgren Sammanfattning Upptäckten och användningsområden för det grönt fluorescerande proteinet, GFP har visat ha

Läs mer

DNA FRÅN BLOD & KINDCELLER

DNA FRÅN BLOD & KINDCELLER EQUALIS Användarmöte, Molekylärdiagnostik 2012 Quality Hotel, Ekoxen, Linköping 7 8 november, 2012 DNA FRÅN BLOD & KINDCELLER Majid Osman, kemist, PhD Klinisk kemi, Linköping DNA stabilitet Provtagning

Läs mer

BIOLOGISK SYNTES AV PROTEIN

BIOLOGISK SYNTES AV PROTEIN UMEÅ UNIVERSITET LABORATIONSHANDLEDNING Biokemi Farmaceutisk kemi 1 Lars Backman 2011-09-09 BIOLOGISK SYNTES AV PROTEIN Utblick Våra gener innehåller all information som behövs för att tillverka en ny

Läs mer

BIMA15 HT Säkerhetsföreskrifter och kompletterande laborationer 1

BIMA15 HT Säkerhetsföreskrifter och kompletterande laborationer 1 BIMA15 HT 2015. Säkerhetsföreskrifter och kompletterande laborationer 1 Innehåll: 1. Säkerhet på labbet 2. Övning: spädning och spektrofotometer 3. Övning: att väga och ställa ph 4. Labrapport Laborationerna

Läs mer

Projektarbete 100p Carl Jaede 2010-05-07

Projektarbete 100p Carl Jaede 2010-05-07 [Type text] [Type text] [Type text] Abstract This report describes the procedure and result of a laboratory experiment where GFP has been cloned inside living bacteria. It also contains a large theoretical

Läs mer

Förordning nr 765/2002, benfria styckningsdelar av nötkött, exportbidrag [2241]

Förordning nr 765/2002, benfria styckningsdelar av nötkött, exportbidrag [2241] Förordning nr 765/2002, benfria styckningsdelar av nötkött, exportbidrag [2241] Kommissionens förordning (EG) nr 765/2002 av den 3 maj 2002 om provtagning och antagande av vissa föreskrifter för fysisk

Läs mer

Syntes av acetylsalicylsyra (aspirin)

Syntes av acetylsalicylsyra (aspirin) 1 Syntes av acetylsalicylsyra (aspirin) Acetylsalicylsyra har länge varit ett av de mest använda läkemedlen och marknadsförs under många handelsnamn. Det lanserades 1899 under namnet Aspirin av det tyska

Läs mer

Identifiering av en genetisk markör för könsbestämning av Gasterosteus aculeatus

Identifiering av en genetisk markör för könsbestämning av Gasterosteus aculeatus Identifiering av en genetisk markör för könsbestämning av Gasterosteus aculeatus 1 Sammanfattning Arbetets uppgift var att identifiera en DNA-sekvens som skulle kunna finnas hos storspiggens könsbestämningsregion.

Läs mer

Personnummer. DUGGA Molekylärbiologi T3 / HT p (G = 24 p)

Personnummer. DUGGA Molekylärbiologi T3 / HT p (G = 24 p) KORTSVARSFRÅGOR 1. Restriktionsenzymet HindIII klyver sekvensen 5 -AAGCTT-3 och lämnar ett fyra basers 5 -överhäng. Rita ut hur DNA-ändarna ser ut på ett fragment som klyvts med HindIII. (2p) SV: 5 -A

Läs mer

JANINA WARENHOLT Molekylär patologi LUND

JANINA WARENHOLT Molekylär patologi LUND MPCR Multiplex Polymerase Chain Reaktion JANINA WARENHOLT Molekylär patologi LUND Vad är multiplex PCR Variant av PCR Möjliggör samtidigt att amplifiera (masskopiera) många målsekvenser i en enda reaktion.

Läs mer

Analys av nukleinsyra. Molekylärbiologisk metodik T3 ht 11 Märit Karls

Analys av nukleinsyra. Molekylärbiologisk metodik T3 ht 11 Märit Karls Analys av nukleinsyra Molekylärbiologisk metodik T3 ht 11 Märit Karls Studietips Detta kompendium är INTE en lärobok. Det är inte meningen att man skall kunna läsa kompendiet och förstå innehållet. Ni

Läs mer

18-19 december 2006 Christina Fjæraa Doktorand, avd för kemi och biomedicinsk vetenskap Karlstads Universitet

18-19 december 2006 Christina Fjæraa Doktorand, avd för kemi och biomedicinsk vetenskap Karlstads Universitet 18-19 december 2006 Christina Fjæraa Doktorand, avd för kemi och biomedicinsk vetenskap Karlstads Universitet Christina.fjaeraa@kau.se 054-7001687 Immunologi Laboration; Epstein Barr Virus (EBV) serologi.

Läs mer

Molekylärgenetiskt verktyg för diagnos av T- resp. B-cellslymfom i vävnad/paraffin Diagnostik av Lymfom. Olika ingångar för B-, resp. T-cellslymfom Metodiker: - Morfologi (Mikroskopi) - Immunohistokemi

Läs mer

BIMA12/13 ht 2012, Introduktionslab. 1. Teoretisk introduktion till laborativt arbete

BIMA12/13 ht 2012, Introduktionslab. 1. Teoretisk introduktion till laborativt arbete BIMA12/13 ht 2012, Introduktionslab Innehåll: 1. Teoretisk introduktion till laborativt arbete 2. Praktisk labintroduktion 3. Labrapport 4. Bilaga: Kemiska hälsorisker i dagens laborativa arbete inom området

Läs mer

Undersökning av Ammoniumoxiderande Arkéer i reningsverks slam

Undersökning av Ammoniumoxiderande Arkéer i reningsverks slam MÄLARDALENS HÖGSKOLA Akademin för hållbar samhälls- och teknikutveckling Undersökning av Ammoniumoxiderande Arkéer i reningsverks slam Nuha Moses Matti Examensarbete, 15 poäng, 2009 Handledare vid Mälardalens

Läs mer

Glukosdehydrogenas. Laktos och Galaktos. Enzymatisk bestämning i livsmedel

Glukosdehydrogenas. Laktos och Galaktos. Enzymatisk bestämning i livsmedel Glukosdehydrogenas Laktos och Ga. Enzymatisk bestämning i livsmedel Innehållsförteckning 1. Ändamål och Användningsområde...1 2. Princip...1 3. Reagens...1 3.1 Citratbuffert...1 3.2 NAD-Citratbuffert...2

Läs mer

NUKLEINSYRORNAS UPPBYGGNAD: Två olika nukleinsyror: DNA deoxyribonukleinsyra RNA ribonukleinsyra

NUKLEINSYRORNAS UPPBYGGNAD: Två olika nukleinsyror: DNA deoxyribonukleinsyra RNA ribonukleinsyra NUKLEINSYRORNAS UPPBYGGNAD: Två olika nukleinsyror: DNA deoxyribonukleinsyra RNA ribonukleinsyra Monomererna som bygger upp nukleinsyrorna kallas NUKLEOTIDER. En nukleotid består av tre delar: en kvävebas

Läs mer

få se en naturvetenskaplig forskningsmiljö och träffa människorna i den miljön.

få se en naturvetenskaplig forskningsmiljö och träffa människorna i den miljön. Martin Andersson 780920-1978 Kurs 3, Professionen Lärarutbildningen Malmö högskola NO-relaterat studiebesök Jag tänkte att mina gymnasieelever skulle få göra ett studiebesök på en universitetsavdelning

Läs mer

Personnummer. DUGGA Molekylärbiologi T3 / HT p (G = 28 p)

Personnummer. DUGGA Molekylärbiologi T3 / HT p (G = 28 p) KORTSVARSFRÅGOR 1. Restriktionsenzymet KpnI klyver sekvensen 5 -GGTACC-3 och lämnar ett fyra basers 3 -överhäng. Enzymet BamHI klyver sekvensen 5 -GGATCC-3 och lämnar ett fyra basers 5 överhäng. Ange det

Läs mer

Tentamen i Cellbiologi med Biokemi

Tentamen i Cellbiologi med Biokemi Del 1, Del 2, Totalt Tentamen i Cellbiologi med Biokemi 5 juni 2013 CMB 22,5 hsp Biomedicinarprogrammet U / G / VG Instruktioner: Märk alla papper med din tentamenskod. Ev extrablad dessutom med datum,

Läs mer

Immunologi. Laboration; Epstein Barr Virus (EBV) serologi. Oxblodshemolysat test (OCH) Epstein Barr Virus ELISA (EBNA)

Immunologi. Laboration; Epstein Barr Virus (EBV) serologi. Oxblodshemolysat test (OCH) Epstein Barr Virus ELISA (EBNA) Immunologi Laboration; Epstein Barr Virus (EBV) serologi. Oxblodshemolysat test (OCH) Epstein Barr Virus ELISA (EBNA) 1 OCH Referenser. Jawas et al: Medical Microbiology. Delves, Martin, Burton and Roitt:

Läs mer

Tentamen i Molekylär Cellbiologi

Tentamen i Molekylär Cellbiologi Tentamen i Molekylär Cellbiologi 1 juni 2007 MCB 13p Biomedicinarprogrammet Märk alla papper med din tentamenskod. Extrablad ska dessutom märkas med MCB och frågans nummer. Frågorna skall besvaras på frågebladet.

Läs mer

Cirkulerande cellfritt DNA

Cirkulerande cellfritt DNA Cirkulerande cellfritt DNA - en introduktion Anne Ricksten Equalismöte 2016-11-14 Vad är cirkulerande fritt DNA (cfdna)? Extracellulärt DNA som finns i cirkulationen Fragmenterat DNA, medelstorlek på ca

Läs mer

Maxwell 16 Blood DNA Purification System

Maxwell 16 Blood DNA Purification System Teknisk manual Maxwell 16 Blood DNA Purification System Varning - hantera kassetterna med försiktighet, förseglingens kanter kan vara vassa. 2800 Woods Hollow Rd. Madison, WI USA Medicinsk utrustning för

Läs mer

Separation av plasmaproteiner med elektrofores, HYDRAGEL PROTEIN(E) K20

Separation av plasmaproteiner med elektrofores, HYDRAGEL PROTEIN(E) K20 Umeå Universitet Biomedicinska analytikerprogrammet Separation av plasmaproteiner med elektrofores, HYDRAGEL PROTEIN(E) K20 Årskull: Laborationsrapport i Klinisk laboratoriemetodik 1, termin 4 Laborationsdatum:

Läs mer

Riskbedömning avdelningen för Evolutionsbiologi Uppsala Universitet, EBC Norbyvägen 18 D, Uppsala

Riskbedömning avdelningen för Evolutionsbiologi Uppsala Universitet, EBC Norbyvägen 18 D, Uppsala 1 (16) Riskbedömning avdelningen för Evolutionsbiologi Uppsala Universitet, EBC Norbyvägen 18 D, Uppsala Risk-undersökning utförd -03-18 Deltagare: Malin Johansson Gunilla Kärf -05-03 Malin Johansson Gunilla

Läs mer

Rening av proteiner: hur och varför?

Rening av proteiner: hur och varför? Rening av proteiner: hur och varför? (och lite biologiska grunder) Joakim Norbeck! norbeck@chalmers.se! Grunder! Plasmider! Protein-rening! Detektion!!!!! Mest relevanta sidor i "Cell" är 510-518 & 532-552!

Läs mer

Erik Eriksson VMD Enheten för Bakteriologi

Erik Eriksson VMD Enheten för Bakteriologi Diagnostik VTEC/EHEC Erik Eriksson VMD Enheten för Bakteriologi SVA Tänker prata om VTEC / EHEC Sjukdomsframkallande faktorer PCR Magnetiska kulor (Immunomagnetisk separation) Diagnostik de vanligaste

Läs mer

Etylacetat är lättantändligt, ingen öppen låga eller elplatta i närheten.

Etylacetat är lättantändligt, ingen öppen låga eller elplatta i närheten. 1 Isolering av koffein Koffein är en organisk förening som finns i bl.a. kaffe och te. Den hör till gruppen alkaloider. Kaffets uppiggande verkan beror på koffeinet. I en kopp medelstarkt kaffe finns 80-100

Läs mer

Diagnosticera sicklecellsanemi med DNA-analys. Niklas Dahrén

Diagnosticera sicklecellsanemi med DNA-analys. Niklas Dahrén Diagnosticera sicklecellsanemi med DNA-analys Niklas Dahrén Sicklecellsanemi Erytrocyterna ser ut som skäror : Sjukdomen innebär a0 de röda blodkropparna (erytrocyterna) ser ut som skäror (eng. sickle)

Läs mer

Detektion av Streptococcus agalactiae (GBS) från selektiv odlingsbuljong med MALDI-TOF och illumigene

Detektion av Streptococcus agalactiae (GBS) från selektiv odlingsbuljong med MALDI-TOF och illumigene Detektion av Streptococcus agalactiae (GBS) från selektiv odlingsbuljong med MALDI-TOF och illumigene Emma Sjöberg Handledare: Martin Sundqvist, M.D., Ph.D. Avdelningen för Klinisk mikrobiologi Karlskrona,

Läs mer

Bruksanvisning för SURVEYOR Scan NRAS Kit Exons 2, 3 & 4 CE IVD

Bruksanvisning för SURVEYOR Scan NRAS Kit Exons 2, 3 & 4 CE IVD 1 Tillverkare Bruksanvisning för SURVEYOR Scan NRAS Kit Exons 2, 3 & 4 CE IVD för DHPLC-system Läs dessa anvisningar noga innan du använder produkten. Spara denna bruksanvisning för framtida bruk. Denna

Läs mer

BASÅRET KEMI B BIOKEMI VT 2012. GENETISK INFORMATION 191-210 (sid. 157-177)

BASÅRET KEMI B BIOKEMI VT 2012. GENETISK INFORMATION 191-210 (sid. 157-177) BASÅRET KEMI B BIOKEMI GENETISK INFORMATION 191-210 (sid. 157-177) DNA/RNA, Transkription, Translation VAR I CELLEN SKER DETTA? Replikation - kopiering av DNA, sker i cellkärnan Transkription - avläsa

Läs mer

GRÅÄRTERS BLOMNING - En studie i hur geografiskt ursprung påverkar den genetiska variationen

GRÅÄRTERS BLOMNING - En studie i hur geografiskt ursprung påverkar den genetiska variationen PROJEKTARBETESRAPPORT Läsåret 2010/2011 GRÅÄRTERS BLOMNING - En studie i hur geografiskt ursprung påverkar den genetiska variationen Projektgrupp: Louise Dahlin, Sanna Renius och Frida Ulander, NV3E Handledare:

Läs mer

RAPD-PCR för storskalig typning av Bacillus cereus

RAPD-PCR för storskalig typning av Bacillus cereus Rapport nr 4988 2000-12-15 RAPD-PCR för storskalig typning av Bacillus cereus En metod att skilja olika stammar åt med genetiska fingeravtryck Birgitta Svensson, Kerstin Ekelund, Anders Christiansson,

Läs mer

Tentamen i Biomedicinsk laboratorievetenskap A, 7,5 hp

Tentamen i Biomedicinsk laboratorievetenskap A, 7,5 hp Tentamen i Biomedicinsk laboratorievetenskap A, 7,5 hp Kursens namn: BMLVA 7,5 högskolepoäng Kurskod: BL1001 Kursansvarig: Charlotte Sahlberg Bang Datum: 2011-12-10 Skrivtid: 240 min Totalpoäng: 46 p Poängfördelning:

Läs mer

Molekylärbiologisk diagnostik av tarmparasiter

Molekylärbiologisk diagnostik av tarmparasiter Molekylärbiologisk diagnostik av tarmparasiter Vad, När, Var och Hur? Jessica Ögren Länssjukhuset Ryhov Juni 2012 Molekylärbiologiska metoder De senaste två decennierna har molekylärbiologiska tekniker

Läs mer

Bruksanvisning till Biofortuna SSPGo TM HLA Typing Kits. CE revision 5, januari 2014

Bruksanvisning till Biofortuna SSPGo TM HLA Typing Kits. CE revision 5, januari 2014 DOT119v8: Bruksanvisning till Biofortuna SSPGo TM HLA Typing Kits. CE revision 5 Sida 1 av 12 1. Användningsområde Bruksanvisning till Biofortuna SSPGo TM HLA Typing Kits CE revision 5, januari 2014 Biofortuna

Läs mer

Optimerat NGS-flöde för rutintypning av bakterier

Optimerat NGS-flöde för rutintypning av bakterier Optimerat NGS-flöde för rutintypning av bakterier Paula Mölling, Molekylärbiolog, Docent Bianca Törös, Daniel Golparian, Sara Thulin Hedberg, Paula Mölling Laboratoriemedicinska länskliniken, Molekylärdiagnostik

Läs mer

EXPERIMENTELLT PROV

EXPERIMENTELLT PROV EXPERIMENTELLT PRV 2010-03-17 Provet omfattar 2 uppgifter som redovisas enligt anvisningarna. Provtid: 180 minuter. jälpmedel: Miniräknare. BS! EJ tabell- och formelsamling Börja redovisningen av varje

Läs mer

TENTAMEN för KMB056 - Molekylär Bioteknik

TENTAMEN för KMB056 - Molekylär Bioteknik TENTAMEN för KMB056 - Molekylär Bioteknik 2012-10-23 em (V-salar) Totalt 60 poäng (Frågor 1-9: Joakim Norbeck, totalt 45 poäng; Frågor 10-11: Lisbeth Olsson, totalt 15 poäng). Betygsgränser: 30 poäng =

Läs mer

1. Tvålframställning Kemikalie/formel:

1. Tvålframställning Kemikalie/formel: 1. Tvålframställning Kemikalie/formel: A: NaOH Natriumhydroxid B: Cocosfett C: Gasol A B C D Aggregationstillstånd flytande fast gas koncentration/mängd Farosymbol/-klass Informationskälla 2M Frätande

Läs mer

DNA-LABORATION Southern blot / PCR

DNA-LABORATION Southern blot / PCR Författare: xxx, yyy, zzzz, nnn Grupp: NR, DFM1, termin??? Namn och OBS student e-mail för de medlemmar i gruppen som godkänt rapporten skall stå på framsidan. DNA-LABORATION Southern blot / PCR Stockholm

Läs mer

ETT EXEMPEL PÅ PROTEINKRISTALLISERING

ETT EXEMPEL PÅ PROTEINKRISTALLISERING KRISTLLISERING V LYSOZYM ETT EXEMPEL PÅ PROTEINKRISTLLISERING Laboration i kursen Experimentell Kemi Gävle 15:e augusti 2013 Handledare: nna Frick, Göteborgs Universitet (anna.frick@chem.gu.se) KRISTLLISERING

Läs mer

Detektion av Borrelia burgdorferi IgG. med hjälp av ELISA

Detektion av Borrelia burgdorferi IgG. med hjälp av ELISA Umeå Universitet Biomedicinska analytikerprogrammet Detektion av Borrelia burgdorferi IgG med hjälp av ELISA Årskull: Laborationsrapport i immunologi termin 3 Laborationsdatum: Inlämnad: Godkänd: Handledare:

Läs mer

PROGENSA PCA3 Urine Specimen Transport Kit

PROGENSA PCA3 Urine Specimen Transport Kit Läkaranvisningar PROGENSA PCA3 Urine Specimen Transport Kit För in vitro-diagnostiskt bruk. Endast för USA-export. Anvisningar 1. Det kan underlätta att be patienten dricka rikligt med vatten (cirka 500

Läs mer

Kromatografi. Kromatografi

Kromatografi. Kromatografi Kromatografi Tekniker för att Rena Ex. inför vidare studier, terapeutisk användning etc. Fraktionera Ex. inför vidare analys, Depletion av HAPs från plasma inför 2D-gel (max-kapacitet

Läs mer

Introduktion till laboration Biokemi 1

Introduktion till laboration Biokemi 1 Introduktion till laboration Biokemi 1 Annica Blissing IFM Biochemistry Upplägg Laborationen sträcker sig över flera tillfällen Isolering, gelfiltrering, absorbansmätning och påvisande av sulfat Provberedning,

Läs mer

Undersökning av växternas evolution

Undersökning av växternas evolution 134567 Andy Harrison, John Schollar and Dean Madden NCBE, The University of Reading, Earley Gate, Reading, RG6 6BZ, UK Undersökning av växternas evolution Mångfaldigande av kloroplast-dna med hjälp av

Läs mer

Detektion av Endosymbionter hos insekter via PCR, kloning och sekvensering

Detektion av Endosymbionter hos insekter via PCR, kloning och sekvensering MÄLARDALENS HÖGSKOLA Akademin för hållbar samhälls- och teknikutveckling Detektion av Endosymbionter hos insekter via PCR, kloning och sekvensering Shaheen Rahman Examensarbete, 15 hp Handledare: Carl

Läs mer

Maxwell 16 Viral Total Nucleic Acid Purification System BRUKSANVISNING FÖR PRODUKTEN AS1155.

Maxwell 16 Viral Total Nucleic Acid Purification System BRUKSANVISNING FÖR PRODUKTEN AS1155. Maxwell 16 Viral Total Nucleic Acid Purification System BRUKSANVISNING FÖR PRODUKTEN AS1155. Varning - hantera kassetterna med försiktighet, förseglingens kanter kan vara vassa. 2800 Woods Hollow Rd. Madison,

Läs mer

30. Undersökning av aminosyror i surkål

30. Undersökning av aminosyror i surkål 30. Undersökning av aminosyror i surkål VAD GÅR LABORATIONEN UT PÅ? Du ska l ära dig tekniken vid tunnskiktskromatografi, TLC undersöka vad som händer med proteinerna och polysackariderna vid mjölksyrajäsning

Läs mer

CSI - Katte DNA-fingerprinting Välkänt från polisarbete. Metoden föddes 1985 i England. Från början krävdes stora mängder DNA, men nu funkar även mycket små mängder. DNA-sekvens Användning Metoden

Läs mer

Leucosep-rör LTK.615 BIPACKSEDEL. För in vitro-diagnostik PI-LT.615-SE-V3

Leucosep-rör LTK.615 BIPACKSEDEL. För in vitro-diagnostik PI-LT.615-SE-V3 Leucosep-rör LTK.615 BIPACKSEDEL För in vitro-diagnostik PI-LT.615-SE-V3 Bruksanvisning Avsedd användning Leucosep-rör är avsedda att användas vid insamling och separation av perifera mononukleära celler

Läs mer

DiviTum V2. Bruksanvisning IVD. Denna bruksanvisning avser endast DiviTum V2. Ref. 932, rev. SV 1

DiviTum V2. Bruksanvisning IVD. Denna bruksanvisning avser endast DiviTum V2. Ref. 932, rev. SV 1 DiviTum V2 Bruksanvisning Denna bruksanvisning avser endast DiviTum V2 IVD 40 Ref. 932, rev. SV 1 1 Innehåll 1. Introduktion... 3 Avsedd användning... 3 Bakgrund... 3 Analysprincipen för DiviTum V2...

Läs mer

LAB 11 STUDIER AV TEMPERATUR OCH

LAB 11 STUDIER AV TEMPERATUR OCH Institutionen för biokemi och biofysik LAB 11 STUDIER AV TEMPERATUR OCH ph-beroende HOS ENZYMET AMYLAS Basåret 2011 (finns på basårshemsida: www.kemi.su.se, välj basår) Introduktion Enzymet α-amylas som

Läs mer

Import och exportföreskrifter/jordbruksverkets licensområde m.m. 1

Import och exportföreskrifter/jordbruksverkets licensområde m.m. 1 Import och exportföreskrifter/jordbruksverkets licensområde m.m. 1 Kommissionens förordning (EG) nr 765/2002 av den 3 maj 2002 om provtagning och antagande av vissa föreskrifter för fysisk kontroll av

Läs mer

UTVECKLING AV EN PCR METOD FÖR IDENTIFIERING AV NYUPPTÄCKTA MJÖLKSYRABAKTERIER

UTVECKLING AV EN PCR METOD FÖR IDENTIFIERING AV NYUPPTÄCKTA MJÖLKSYRABAKTERIER Hälsa och samhälle UTVECKLING AV EN PCR METOD FÖR IDENTIFIERING AV NYUPPTÄCKTA MJÖLKSYRABAKTERIER MARIA CELANDER Examensarbete Biomedicinsk Laboratorievetenskap Malmö högskola 15 hp Hälsa och samhälle

Läs mer

Provtagningsanvisning för Ögonsekret odling. Avgränsning/Bakgrund. Provtagning

Provtagningsanvisning för Ögonsekret odling. Avgränsning/Bakgrund. Provtagning Sidan 1 av 5 Avgränsning/Bakgrund Här beskrivs provtagning för allmän bakteriologisk frågeställning vid konjunktivit, keratit eller endoftalmit. För odling avseende gonokocker krävs att detta begärs på

Läs mer

ASFALTBELÄGGNING OCH -MASSA

ASFALTBELÄGGNING OCH -MASSA Sid 1 (5) ASFALTBELÄGGNING OCH -MASSA Återvinning av bindemedel från asfaltmassor, utförd med rotationsindunstare. Recovery of binder from bituminous mixes: procedure with rotary evaporator. 1. ORIENTERING

Läs mer

TENTAMEN för KMB056 - Molekylär Bioteknik

TENTAMEN för KMB056 - Molekylär Bioteknik TENTAMEN för KMB056 - Molekylär Bioteknik 2012-01-12 em (V-salar) Totalt 60 poäng (Frågor 1-8: Joakim Norbeck, totalt 45 poäng; Frågor 9-12: Lisbeth Olsson, totalt 15 poäng). Betygsgränser: 30 poäng =

Läs mer

Laboration Enzymer. Labföreläsning. Introduktion, enzymer. Kinetik. Första ordningens kinetik. Michaelis-Menten-kinetik

Laboration Enzymer. Labföreläsning. Introduktion, enzymer. Kinetik. Första ordningens kinetik. Michaelis-Menten-kinetik Labföreläsning Maria Svärd maria.svard@ki.se Molekylär Strukturbiologi, MBB, KI Introduktion, er och kinetik Första ordningens kinetik Michaelis-Menten-kinetik K M, v max och k cat Lineweaver-Burk-plot

Läs mer

Cellcykel/Celldöd. Laborationsrapport 20/2-14. Basgrupp 1

Cellcykel/Celldöd. Laborationsrapport 20/2-14. Basgrupp 1 Cellcykel/Celldöd Laborationsrapport 20/2-14 Basgrupp 1 Louise Andersson Alexander Barhebreus Pontus Boberg Amanda Dahl Simon Ingves Christina Larsson Kajsa Lethin Thea Wennman Syfte Se skillnad på hur

Läs mer

En studie över förekomsten av genuttryck för enzym i biosyntesen av malarialäkemedlet artemisinin hos Artemisia vulgaris och Artemisia absinthium

En studie över förekomsten av genuttryck för enzym i biosyntesen av malarialäkemedlet artemisinin hos Artemisia vulgaris och Artemisia absinthium Fakulteten för hälso- och livsvetenskap Examensarbete En studie över förekomsten av genuttryck för enzym i biosyntesen av malarialäkemedlet artemisinin hos Artemisia vulgaris och Artemisia absinthium 1

Läs mer

Namn: student x & student y Kurs: FAGBH0 Utförd: 090526

Namn: student x & student y Kurs: FAGBH0 Utförd: 090526 Laboration: Isolering av kinin Namn: student x & student y Kurs: FAGBH0 Utförd: 090526 Handledare: Patrik Holm 1 Innehållsförteckning Innehållsförteckning... 2 Sammanfattning... 3 Inledning... 3 Utförande...

Läs mer

HLA SSP Kits. Kit klart för användning med SSP reagens för DNA baserad HLA typning. [IVD] For In Vitro Diagnostic Use

HLA SSP Kits. Kit klart för användning med SSP reagens för DNA baserad HLA typning. [IVD] For In Vitro Diagnostic Use [SE] HLA SSP Kits Kit klart för användning med SSP reagens för DNA baserad HLA typning [IVD] For In Vitro Diagnostic Use HLA-A SSP [REF] 826 201 0197 HLA-B SSP [REF] 826 206 0197 HLA-C SSP [REF] 826 212

Läs mer

Centrum för genetisk identifiering Teknisk rapport Björnspillningsinventering 2015

Centrum för genetisk identifiering Teknisk rapport Björnspillningsinventering 2015 RAPPORT Datum Dnr 1(7) 2017-11-07 4.1-628-2015 Centrum för genetisk identifiering Teknisk rapport Björnspillningsinventering 2015 Postadress: Besöksadress: Telefon: 08-519 540 00 Box 50007 Frescativägen

Läs mer

Molekylär bioteknik. Vad är en gen? Molekylärbiologiska verktygslådan. Eukaryot transkription/translation. Prokaryot transkription/translation

Molekylär bioteknik. Vad är en gen? Molekylärbiologiska verktygslådan. Eukaryot transkription/translation. Prokaryot transkription/translation Molekylär bioteknik Föreläsning 1 Molekylär Bioteknik 2008 Molekylärbiologi Mikrobiologi Biokemi enetik Kemiteknik ellbiologi ransgena djur -växter -djur Diagnostik -genetisk predisposition -detektion

Läs mer

DNA-ordlista. 16S: Egentligen 16S rrna. Mitokondriell gen med förhållandevis liten variation som ofta används för att artbestämma DNA från däggdjur.

DNA-ordlista. 16S: Egentligen 16S rrna. Mitokondriell gen med förhållandevis liten variation som ofta används för att artbestämma DNA från däggdjur. DNA-ordlista 16S: Egentligen 16S rrna. Mitokondriell gen med förhållandevis liten variation som ofta används för att artbestämma DNA från däggdjur. Alignment: Att placera DNA-sekvenser intill varandra.

Läs mer