I. Flersekvensjämförelser, sekvensmotiv och profiler. II. Fylogenetisk analys

Save this PDF as:

Storlek: px
Starta visningen från sidan:

Download "I. Flersekvensjämförelser, sekvensmotiv och profiler. II. Fylogenetisk analys"


1 I. Flersekvensjämförelser, sekvensmotiv och profiler II. Fylogenetisk analys

2 I. Flersekvensjämförelser (multiple sequence alignments, MSA) Jämföra tre eller fler sekvenser samtidigt (homologer eller funktionellt länkade sekvenser) Vilken typ av information ger det oss? 1. Försök hitta den konserverade (bevarade) kärnsekvensen Spår av den ursprungliga sekvensen 2. Hitta ett sekvensmotiv som korrelerar med den funktionella länken.

3 Välj sekvenserna väl Om vi är ute efter ett konserverat motiv så måste alla sekvenserna vara homologer annars är resultatet meningslöst. Det kan ju inte finnas ett konserverat motiv om sekvenserna inte har ett gemensamt evolutionärt ursprung. Vilken resolution på sekvensvariationen är man ute efter?

4 Mammaliskt cytokrom b

5 Eukaryotiskt cytokrom b

6 Konserverade regioner i biologiska sekvenser domäner och motiv En domän är en biokemiskt definierad region i ett protein som kan ha en känd enzymatisk aktivitet eller struktur. Isolerade domäner kan oftast bilda självständiga strukturer: Kinasdomän DNA-bindande domän Ett motiv är endast bioinformatiskt definierat. DNA, RNA eller protein Biologisk relevans Evolutionärt konserverat

7 Sekvensmotiv - exempel DNA: Estrogen response element (AGGTCAnnnTGACCT) E. coli ori sekvens (245 bp) RNA: Kozak site, translation ( A / G CCACCAUGG) Poly-adenyleringssignal (AAUAAA) Protein Zinkfingermotiv (X 3 -Cys-X 2-4 -Cys-X 12 -His-X 3-4 -His-X 4 ) Faktor Xa klyvningsställe (Ile-Glu-Gly-Arg) CDK fosforyleringssignal (Ser-Pro) N-länkad glykosyleringssignal (Asn-X-Ser/Thr)

8 Att hitta sekvensmotiv in silico Från homologa sekvenser Vi förväntar oss att alla eller så gott som alla sekvenserna kommer att innehålla motivet Från funktionellt länkade sekvenser (1) en grupp proteiner som alla fosforyleras av ett visst kinas (fosforyleringssignal) (2) en grupp proteiner som förekommer inom en viss organell (lokaliseringssekvens) Vi förväntar oss att en signifikant andel av sekvenserna (som inte måste vara homologer!) kommer att innehålla et gemensamt motiv

9 OBS! Homologa sekvenser måste inte innehålla ett konserverat motiv! Kom ihåg: homologi betyder endast att sekvenserna har ett gemensamt evolutionärt ursprung. Sekvenserna kan ha förändrats till oigenkännlighet under tidens gång.

10 So you want to make a multiple sequence alignment. 1. Välj input sekvenserna och välj dem väl ( junk goes in, junk comes out ) 2. Välj MSA-program (ClustalW, T-Coffee, BlockMaker, MAFFT, Praline, MEME etc) 3. Gör en första jämförelse 4. Utvärdera den första jämförelsen trixa med parametrar tills du är nöjd 5. Visualisera resultatet på ett meningsfullt sätt 6. Använd resultatet på ett meningsfullt sätt

11 icke-konserverad region högt konserverad region (homologa regioner) delvis konserverad region (homologa regioner i en del av sekvenserna)

12 Hur kan vi förbättra jämförelsen? ta bort problematiska sekvenser (även fast de är homologer) och gör om analysen ta bort regioner som är mindre konserverade och gör om analysen

13 Localised multiple sequence alignments Lämpar sig för homologa sekvenser som inte har särskilt hög sekvensidentitet eller för sekvenser som endast har mindre regioner av sekvenshomologi. Protein som besitter homologa domäner Sekvensmotiv i DNA sekvenser som omges av icke-konserverad sekvens Flera program tillgängliga. BLOCKS database och BlockMaker för proteinsekvenser MEME för både DNA och proteinsekvenser Gibbs Motif Sampler för både DNA och proteinsekvenser

14 Exempel: MEME (Multiple Em for Motif Elicitation) Jag ville hitta konserverade motiv i promotorsekvenserna hos SOH1 genen i elva olika jästarter. S. cerevisiae S. mikatae S. paradoxus C. glabrata S. kudriavzevii Y. lipolytica icke-konserverad sekvens

15 Hur kan vi visualisera resultatet på ett informativt sätt? Vi måste urskilja de regioner i flersekvensjämförelsen som är högst konserverad Formatera flersekvensjämförelsen Definera och visualisera det konserverade sekvensmotivet



18 Hur visualiserar man sekvensmotiv? Kan representeras i form av: konsensussekvenser regular expressions sekvenslogo positionsspecifika matriser (position weight matrix, PWM)

19 Konsensussekvenser representerar en flersekvensjämförelse i form av en enda sekvens innehåller den vanligaste nukleotiden eller aminosyran vid varje enskild position ibland kan man även specificera två nukleotider eller aminosyror om de är ungefär lika vanliga (t.ex. AG C / T GC T / A ) kan vara lik den ursprungliga sekvensen Alignment Sequence 1. ATAGTTA Sequence 2. ATTGTAA Sequence 3. ATT-TAA Sequence 4. ATAGTAC Sequence 5. ATAGTGA Consensus: ATAGTAA (OBS! I detta exempel är konsensussekvensen inte identisk med någon av inputsekvenserna.)

20 Regular expression Beskriver sekvensmotiv på ett enkelt sätt utan positionspecifika frekvenser Regular expressions kan användas direkt av sökalgoritmer för att hitta nya sekvenser som överensstämmer med motivet Position 2 and 3. vilken aminosyra som helst [G A S] X 2 T X [L V] Position 5. vilken aminosyra som helst Position 1. glycin, alanin eller serin Position 6. Leucin eller valin Position 4. treonin

21 Sequence logos Frekvensen av varje sekvenskaraktär visualiseras direkt med höjden på bokstaven Användbart när man analyserar ett stort antal sekvenser (> 50) Als peptide repeat (n = 473)

22 Nästa steg gör en profil Om vi nu har en representativ samling homologa sekvenser så kan vi uppskatta graden av sekvensvariation vid varje enskild position i ett sekvensmotiv. Med hjälp av denna information kan datorn konstruera en sekvensprofil från de positionsspecifika frekvenserna. Vi kan sedan använda sekvensprofilen för att hitta nya homologa sekvenser som matchar den profil vi har skapat.

23 Hur man söker med en profil/pssm Ett lätt exempel: leta efter EcoRI klyvningsställen (konsensus GAATTC) För enkelhetens skull så kan vi använda % frekvenserna direkt som en PSSM (se nedan): Position G A Sekvenskarktär T C

24 Eco RI consensus GAATTC TAGTGTTATAGTAAAGAATTCGT Sliding window -principen Vi sätter ett gränsvärde på 100 % identitet (dvs 6 perfekta träffar)
















40 Profiler sammanfattning 1. Gör en position specific scoring matrix (PSSM) 2. Ange gränsvärdet för att hitta nya sekvenser. För högt så hittar vi inga nya sekvenser (känslighet) För lågt så plockar vi upp sekvenser som inte homologer (selektivitet) 3. Scanna sekvenserna med din profil. 4. Utveckla profilen med de nya sekvenserna du har hittat (vilket ger en ny PSSM) och finjustera gränsvärdet.

41 Varför är profiler bra att ha? Profiler är mycket bättre på att hitta avlägsna homologer än att använda en enskild sekvens (Exempel: proteiner) När du söker med en enstaka sekvens använder du dig av de vanliga substitutionmatriserna (PAM250, BLOSUM62) som baserar sig på stora dataset av icke-homolog sekvenser För varje ny homolog du hittar kan du lägga till den i profilen och göra den ännu mer känslig och selektiv. I bästa fall ska du hitta alla homologer utan att plocka upp icke-homologa sekvenser.

42 Profildatabaser Jämför en sekvens med alla bokförda profiler Proteinmotiv: Domäner, transmembranregioner, intracellulär lokalisering (TargetP, SignalP), proteolytiska klyvningsställen, fosforyleringsmotiv etc Pfam, Prosite, PRINTS, InterPro, NCBI Conserved Domain Database (CDD), ProDom DNA motiv Promotorer, enhancers, strukturella genomiska element, splicing sites, initieringssekvenser för transkription och translation (Ribosomal Binding Site, Kozac site) Eukaryotic Promoter Database, ConSite

RNA-syntes och Proteinsyntes

RNA-syntes och Proteinsyntes RNA-syntes och Proteinsyntes Jenny Flygare (jenny.flygare@ki.se) Genexpression - översikt 5 (p) A T G T C A G A G G A A T G A 3 (OH) T A C A G T C T C C T T A C T 3 (OH) 5 (p) VAD TRANSLATERAS DEN HÄR

Läs mer

TENTAMEN för KMB056 - Molekylär Bioteknik

TENTAMEN för KMB056 - Molekylär Bioteknik TENTAMEN för KMB056 - Molekylär Bioteknik 2011-10-22 em (V-salar) Totalt 60 poäng (Frågor 1-8: Joakim Norbeck, totalt 45 poäng; Frågor 9-12: Lisbeth Olsson, totalt 15 poäng). Betygsgränser: 30 poäng =

Läs mer

Personnummer. DUGGA Molekylärbiologi T3 / HT p (G = 24 p)

Personnummer. DUGGA Molekylärbiologi T3 / HT p (G = 24 p) KORTSVARSFRÅGOR 1. Restriktionsenzymet HindIII klyver sekvensen 5 -AAGCTT-3 och lämnar ett fyra basers 5 -överhäng. Rita ut hur DNA-ändarna ser ut på ett fragment som klyvts med HindIII. (2p) SV: 5 -A

Läs mer

Släktskap mellan människa och några ryggradsdjur

Släktskap mellan människa och några ryggradsdjur Övning: Släktskap mellan människa och några ryggradsdjur sid 1 Övning Släktskap mellan människa och några ryggradsdjur En manuell jämförelse mellan hemoglobinets aminosyrasekvenser hos några organismer

Läs mer

Bioinformatisk metodik (1MB331) VT11 - Sammanfattning

Bioinformatisk metodik (1MB331) VT11 - Sammanfattning Bioinformatisk metodik (1MB331) VT11 - Sammanfattning Per Enström & Eli Burell Innehåll 1 Inledning 2 2 Databastyper 2 2.1 Depåer (repositories)............................. 2 2.2 Vårdade (curated)..............................

Läs mer

Släktträd med hjälp av databaser och program från Internet

Släktträd med hjälp av databaser och program från Internet Övning: Släktträd sid 1 Övning i bioinformatik Släktträd med hjälp av databaser och program från Internet Det finns databaser som är fritt tillgängliga och innehåller nukleotid- och amino-syrasekvenser

Läs mer

Stamträd med hjälp av databaser och program från Internet

Stamträd med hjälp av databaser och program från Internet Övning: Stamträd sid 1 Övning Stamträd med hjälp av databaser och program från Internet Det finns databaser som är fritt tillgängliga och innehåller nukleotid- och aminosyrasekvenser från ett stort antal

Läs mer

Transkription och translation. DNA RNA Protein. Introduktion till biomedicin 2010-09-13. Jan-Olov Höög 1

Transkription och translation. DNA RNA Protein. Introduktion till biomedicin 2010-09-13. Jan-Olov Höög 1 Från DNA till protein, dvs den centrala dogmen DNA RNA Protein Biochemistry, kapitel 1 (delvis), kapitel 2 (ingående) samt kapitel 3 (delvis, kommer att behandlas mer) Transkription och translation Informationsflödet

Läs mer

Från DNA till protein, dvs den centrala dogmen

Från DNA till protein, dvs den centrala dogmen Från DNA till protein, dvs den centrala dogmen DNA RNA Protein Biochemistry, kapitel 1 5 samt kapitel 29 31. Kapitel 2 5 samt 29 31 berörs även i kommande föreläsningar. Transkription och translation Informationsflödet

Läs mer

Tentamen. Kurskod: MC1004. Medicin A, Molekylär cellbiologi. Kursansvarig: Christina Karlsson. Datum 130814 Skrivtid 4h

Tentamen. Kurskod: MC1004. Medicin A, Molekylär cellbiologi. Kursansvarig: Christina Karlsson. Datum 130814 Skrivtid 4h Tentamen Medicin A, Molekylär cellbiologi Kurskod: MC1004 Kursansvarig: Christina Karlsson Datum 130814 Skrivtid 4h Totalpoäng: 86p Poängfördelning Johanna Sundin (fråga 1 8): 18p Ignacio Rangel (fråga

Läs mer

Delprov l, fredag 11/11,

Delprov l, fredag 11/11, Delprov l, fredag 11/11, 14.00-17.00 Fråga 1 (5 p). Ringa in ett av alternativen (endast ett): A. Vilket påstående är falskt? l. Aminosyror är byggstenar till proteiner 2. Membraner består av peptidoglykan

Läs mer

Tentamen i Molekylär Cellbiologi

Tentamen i Molekylär Cellbiologi Tentamen i Molekylär Cellbiologi 1 juni 2007 MCB 13p Biomedicinarprogrammet Märk alla papper med din tentamenskod. Extrablad ska dessutom märkas med MCB och frågans nummer. Frågorna skall besvaras på frågebladet.

Läs mer

Instuderingsfrågor avsnitten Molekylär genetik och Rekombinant DNA tekniker, MCB

Instuderingsfrågor avsnitten Molekylär genetik och Rekombinant DNA tekniker, MCB Instuderingsfrågor avsnitten Molekylär genetik och Rekombinant DNA tekniker, MCB Molekylärgenetikdelen 1. Vad är DNA? 2. Vad heter byggstenarna i DNA? 3. Vad är RNA? 4. Vad är en bas, nukleosid, nukleotid

Läs mer

Från DNA till protein, dvs den centrala dogmen

Från DNA till protein, dvs den centrala dogmen Från DNA till protein, dvs den centrala dogmen DNA RNA Protein Biochemistry, kapitel 1 5 samt kapitel 29 31. Kapitel 2 5 samt 29 31 berörs även i kommande föreläsningar. ph, kapitel 1, gås igenom i separata

Läs mer

Molekylärbiologins centrala dogma

Molekylärbiologins centrala dogma Molekylärbiologins centrala dogma m Replikation:Bassekvensen i DNA står för den genetiska informationen. När en cell ska delas måste DNA:tdupliceras man måste få nytt DNA med exakt samma bassekvens som

Läs mer

TENTAMEN för KMB056 - Molekylär Bioteknik

TENTAMEN för KMB056 - Molekylär Bioteknik TENTAMEN för KMB056 - Molekylär Bioteknik 2013-01-15 em (V-salar) Totalt 60 poäng (Frågor 1-8: Joakim Norbeck, totalt 45 poäng; Frågor 9-12: Lisbeth Olsson, totalt 15 poäng). Betygsgränser: 30-38.5 poäng

Läs mer

En bioinformatisk genjakt

En bioinformatisk genjakt En bioinformatisk genjakt Efter en ide från: CUSMOBIO, Milano, Italien. Hur man kan söka i databaser efter information om en gen som kan ge ökad risk för bröstcacer. Bakgrund Människor utan symptom men

Läs mer

Transkription och translation = Översättning av bassekvensen till aminosyrasekvens

Transkription och translation = Översättning av bassekvensen till aminosyrasekvens Transkription och translation = Översättning av bassekvensen till aminosyrasekvens OBS! Grova drag för prokaryota system! Mycket mer komplicerat i eukaryota system! RNA: Tre huvudtyper: trna transfer RNA

Läs mer

Kontroll av genuttrycket på transkriptionsnivå

Kontroll av genuttrycket på transkriptionsnivå Kontroll av genuttrycket på transkriptionsnivå 7.1-7.6 Vägen från gen till funktionellt protein består av många steg, fig1-11. Det finns exempel på kontrollmekanismer för alla dessa steg. Transkriptionsstart

Läs mer

RNA och den genetiska koden

RNA och den genetiska koden RNA och den genetiska koden Table of Contents Struktur... 1 DNA och RNA... 2 Puriner och Pyrimidiner... 2 Watson-Crick baspar... 2 RNA som molekyl... 2 Primär struktur... 2 Sekundära strukturer... 2 Typer

Läs mer

TENTAMEN för KMB056 - Molekylär Bioteknik

TENTAMEN för KMB056 - Molekylär Bioteknik TENTAMEN för KMB056 - Molekylär Bioteknik 2012-10-23 em (V-salar) Totalt 60 poäng (Frågor 1-9: Joakim Norbeck, totalt 45 poäng; Frågor 10-11: Lisbeth Olsson, totalt 15 poäng). Betygsgränser: 30 poäng =

Läs mer

DNA-labb / Plasmidlabb

DNA-labb / Plasmidlabb Översikt DNA-labb Plasmidlabb Preparation och analys av -DNA från Escherichia coli Varför är vi här idag? Kort introduktion till biokemi och rekombinant DNA- teknologi Vad skall vi göra idag? Genomgång

Läs mer

Hierarkisk proteinstruktur. Hierarkisk proteinstruktur. α-helix Fig 3-4. Primärstruktur Fig 3-3

Hierarkisk proteinstruktur. Hierarkisk proteinstruktur. α-helix Fig 3-4. Primärstruktur Fig 3-3 Hierarkisk proteinstruktur Hierarkisk proteinstruktur Primärstruktur Fig 3-3 -Bestäms av sekvensen av aminosyror -Hålls samman med peptidbindningen, vilken också ger en rikting -Börjar med aminogrupp &

Läs mer

Ärftliga sjukdomar och egenskaper hos hund

Ärftliga sjukdomar och egenskaper hos hund Engelsk bulldog Tibetansk terrier Västgötaspets Dvärgpinscher Chow chow Foto: Pleple2000 Foto: Flickr user skaty222 Foto: Sören T Eriksson Foto: Entheta Foto:Jurriaan Schulman Alla bilder Wikimedia commons

Läs mer



Läs mer


KARLSTADS UNIVERSITET KARLSTADS UNIVERSITET Avd för kemi och biomedicinsk vetenskap Tentamen i Molekylär Cellbiologi 7,5 hp (5p) BMGBM0 (BMC210) Datum: 2009-11-21 Tid: 9.00-14.00 Sal: Se anslagstavlan i universitetets huvudentré

Läs mer

Eukaryot proteinexpression

Eukaryot proteinexpression Välkomna Eukaryot proteinexpression 30 oktober 2008 Sissela Liljeqvist Föreläsningens innehåll Prokaryot vs Eukaryot översikt eukaryota värdar och expressionsvektorer (='budbärare') Saccharomyces cerevisiae

Läs mer

Genetik I. Jessica Abbott

Genetik I. Jessica Abbott Genetik I Jessica Abbott Att kunna/förstå efter föreläsningarna i genetik: DNA och RNA Packning av DNA Replikation Transkription och translation Cellcykeln Mitos och meios Översikt över genetiska verktyg

Läs mer

Bioinformatik. Marina Axelson-Fisk Matematisk orientering, 30 nov 2015

Bioinformatik. Marina Axelson-Fisk Matematisk orientering, 30 nov 2015 Bioinformatik Marina Axelson-Fisk Matematisk orientering, 30 nov 2015 Bioinformatik Bioinformatik Var används bioinformatik? DNA analys Medicin DNA-sekvensering och assemblering Sekvensanalys Proteinstruktur

Läs mer

Protein en livsviktig byggsten

Protein en livsviktig byggsten Protein en livsviktig byggsten Ingvar Bosaeus Enheten för klinisk nutrition Sahlgrenska universitetssjukhuset Göteborg KSLA 2015-02-19 Aminosyra Alpha Amino- grupp Fredrik Bertz Karboxyl- grupp 20 aa

Läs mer

Molekylärbiologi: Betygskriterier

Molekylärbiologi: Betygskriterier Molekylärbiologi: Betygskriterier De obligatoriska momenten laboration och presentationsövningar examineras separat (endast G). Se separat utdelade anvisningar. Betygskriterier för teoridelen (se nedan).

Läs mer

TENTAMEN för KMB056 - Molekylär Bioteknik

TENTAMEN för KMB056 - Molekylär Bioteknik TENTAMEN för KMB056 - Molekylär Bioteknik 2012-01-12 em (V-salar) Totalt 60 poäng (Frågor 1-8: Joakim Norbeck, totalt 45 poäng; Frågor 9-12: Lisbeth Olsson, totalt 15 poäng). Betygsgränser: 30 poäng =

Läs mer

VI-1. Proteiner VI. PROTEINER. Källor: - L. Stryer, Biochemistry, 3 rd Ed., Freeman, New York, 1988.

VI-1. Proteiner VI. PROTEINER. Källor: - L. Stryer, Biochemistry, 3 rd Ed., Freeman, New York, 1988. Proteiner VI. PTEINE VI-1 Källor: - L. Stryer, Biochemistry, 3 rd Ed., Freeman, New York, 1988. VI-2 Molekylmodellering VI.1. Aminosyra En aminosyra (rättare: α-aminosyra) har strukturen som visas i figur

Läs mer

Namn: Personnummer: Plats nr: Inlämnad kl: ID kollad: Poäng: Betyg: SKRIV NAMN PÅ ALLA SIDOR ÄVEN OM FRÅGAN LÄMNAS OBESVARAD.

Namn: Personnummer: Plats nr: Inlämnad kl: ID kollad: Poäng: Betyg: SKRIV NAMN PÅ ALLA SIDOR ÄVEN OM FRÅGAN LÄMNAS OBESVARAD. STOCKHOLMS UNIVERSITET Institutionen för biologisk grundutbildning Tentamen i Molekylär Cellbiologi 2008-06-17 Namn: Personnummer: Plats nr: Inlämnad kl: ID kollad: Poäng: Betyg: Skrivtiden är 5 timmar.

Läs mer

Analys av nukleinsyra. Molekylärbiologisk metodik T3 ht 11 Märit Karls

Analys av nukleinsyra. Molekylärbiologisk metodik T3 ht 11 Märit Karls Analys av nukleinsyra Molekylärbiologisk metodik T3 ht 11 Märit Karls Studietips Detta kompendium är INTE en lärobok. Det är inte meningen att man skall kunna läsa kompendiet och förstå innehållet. Ni

Läs mer

Kap 26 Nukleinsyror och proteinsyntes. Bilder från McMurry

Kap 26 Nukleinsyror och proteinsyntes. Bilder från McMurry Kap 26 Nukleinsyror och proteinsyntes Bilder från McMurry Namn Efternamn 26 februari 2011 2 Varje DNA molekyl är uppbyggd av många gener induviduella DNA segmant som innehåller instruktioner för syntes

Läs mer

Rening av proteiner: hur och varför?

Rening av proteiner: hur och varför? Rening av proteiner: hur och varför? (och lite biologiska grunder) Joakim Norbeck! norbeck@chalmers.se! Grunder! Plasmider! Protein-rening! Detektion!!!!! Mest relevanta sidor i "Cell" är 510-518 & 532-552!

Läs mer

Tentamen. Lycka till! Medicin A, Molekylär cellbiologi. Kurskod: MC1004. Kursansvarig: Christina Karlsson. Datum 120512 Skrivtid 4h

Tentamen. Lycka till! Medicin A, Molekylär cellbiologi. Kurskod: MC1004. Kursansvarig: Christina Karlsson. Datum 120512 Skrivtid 4h Tentamen Medicin A, Molekylär cellbiologi Kurskod: MC1004 Kursansvarig: Christina Karlsson Datum 120512 Skrivtid 4h Totalpoäng: 88p Poängfördelning Johanna Sundin: fråga 1-10: 18p Ignacio Rangel: fråga

Läs mer

Tidiga erfarenheter av arvets mysterier

Tidiga erfarenheter av arvets mysterier Cellens genetik Cellen Växtcellen Växtcellen Tidiga erfarenheter av arvets mysterier Artförädling genom riktad avel Religiösa förbud mot syskongiftemål Redan de gamla grekerna.. Aristoteles ~350 år före

Läs mer

Proteinsyntesen. Anders Liljas Biokemi och strukturbiologi Lunds universitet

Proteinsyntesen. Anders Liljas Biokemi och strukturbiologi Lunds universitet Proteinsyntesen Anders Liljas Biokemi och strukturbiologi Lunds universitet Ett fundament i proteinsyntesen är strukturen av nukleinsyror. F. Crick, J. Watson & Wilkins Nobelpris i medicin 1962 Wikipedia

Läs mer

Protein prediktion, homologi och protein engineering

Protein prediktion, homologi och protein engineering Protein prediktion, homologi och protein engineering Alignment Alignment D-E-A-L-V-S-V-A-F-T-S-I-V-G-G D-E-A---------------F-T-S-I-V-G-G D-E-A-F-T-S-I-V-G-G-M-D-D-P-G Prediktion Prediktion

Läs mer

Transkriptionen. Niklas Dahrén

Transkriptionen. Niklas Dahrén Transkriptionen Niklas Dahrén Innehållet i denna undervisningsfilm: Översikt över proteinsyntesen Transkrip1onen Modifiering (bearbetning) av mrna Fler filmer på samma tema: Från gen 1ll protein Den gene1ska

Läs mer

Genetik II. Jessica Abbott

Genetik II. Jessica Abbott Genetik II Jessica Abbott Nukleosid Sockergrupp + kvävebas Kvävebaser: Puriner (adenin, guanin) Pyrimidiner (cytosin, thymin i DNA, uracil i RNA) Basparning A=T G C Packning av DNA i eukaryot cellkärna

Läs mer

Resultat:... (Cellbiologi:... Immunologi...) Betyg...

Resultat:... (Cellbiologi:... Immunologi...) Betyg... Cellbiologi del tentamen augusti 2005 1 Tentamen i Cellbiologi med Immunologi KTH 23 aug 2005 kl 9-13 Skriv svaren direkt i tentan. Vid behov använd extra blad Namn:... Årskurs/årgång... (typ I02, bio99,

Läs mer

NUKLEINSYRORNAS UPPBYGGNAD: Två olika nukleinsyror: DNA deoxyribonukleinsyra RNA ribonukleinsyra

NUKLEINSYRORNAS UPPBYGGNAD: Två olika nukleinsyror: DNA deoxyribonukleinsyra RNA ribonukleinsyra NUKLEINSYRORNAS UPPBYGGNAD: Två olika nukleinsyror: DNA deoxyribonukleinsyra RNA ribonukleinsyra Monomererna som bygger upp nukleinsyrorna kallas NUKLEOTIDER. En nukleotid består av tre delar: en kvävebas

Läs mer

Tentamen i 2D1396 Bioinformatik, 2 juni 2006

Tentamen i 2D1396 Bioinformatik, 2 juni 2006 Tentamen i 2D396 Bioinformatik, 2 juni 2006 Kursansvarig: Lars Arvestad Inga hjälpmedel förutom skrivmedel är tillåtna. Skriv tydligt! Skriv bara på en sida av pappret och behandla bara en uppgift per

Läs mer

STOCKHOLMS UNIVERSITET. Institutionen för biologisk grundutbildning. Tentamen i Molekylär cellbiologi 10 p Namn: _.. Personnummer:.

STOCKHOLMS UNIVERSITET. Institutionen för biologisk grundutbildning. Tentamen i Molekylär cellbiologi 10 p Namn: _.. Personnummer:. STOCKHOLMS UNIVERSITET Institutionen för biologisk grundutbildning Tentamen i Molekylär cellbiologi 10 p. 2002-04-24 Namn: _.. Personnummer:. Plats nr: Poäng: Skrivtiden är fem timmar. Tänk på att skriva

Läs mer

Övning i bioinformatik

Övning i bioinformatik Övning: Släktträd sid 1 Övning i bioinformatik Släktträd med hjälp av databaser och program från Internet Det finns databaser som är fritt tillgängliga och innehåller nukleotid- och amino-syrasekvenser

Läs mer

Biologisk enfald. enheten i mångfalden. Anders Liljas Biokemi och Strukturbiologi

Biologisk enfald. enheten i mångfalden. Anders Liljas Biokemi och Strukturbiologi Biologisk enfald enheten i mångfalden Anders Liljas Biokemi och Strukturbiologi Naturen har en enorm mångfald av livsformer. I luften, på land och i vattnet Charles Darwin (1809-1882) Darwin studerade

Läs mer

Gener, genom och kromosomer , 6.6 och sid

Gener, genom och kromosomer , 6.6 och sid Gener, genom och kromosomer 6.1-6.3, 6.6 och sid 263-265 En gen är en DNA-sekvens som kan.. En kromosom är en DNA-molekyl. I cellen finns det lika mycket protein som DNA i kromosomerna, se fig6-1. Ett

Läs mer

Tentamen i Cellbiologi med Biokemi

Tentamen i Cellbiologi med Biokemi Del 1, Del 2, Totalt Tentamen i Cellbiologi med Biokemi 5 juni 2013 CMB 22,5 hsp Biomedicinarprogrammet U / G / VG Instruktioner: Märk alla papper med din tentamenskod. Ev extrablad dessutom med datum,

Läs mer

1. Typarter för den torra mon är lingon och renlav.

1. Typarter för den torra mon är lingon och renlav. 1 STUDENTEXAMENS- NÄMNDEN MODELLPROV I BIOLOGI Högst 8 frågor får besvaras. Svaren på de med + utmärkta mera krävande frågorna bedöms enligt betygsskalan 0 9 i stället för den normala 0 6. För uppgifter

Läs mer

TENTAMEN för KMB056 - Molekylär Bioteknik

TENTAMEN för KMB056 - Molekylär Bioteknik TENTAMEN för KMB056 - Molekylär Bioteknik 2012-10-23 em (V-salar) Totalt 60 poäng (Frågor 1-9: Joakim Norbeck, totalt 45 poäng; Frågor 10-11: Lisbeth Olsson, totalt 15 poäng). Betygsgränser: 30 poäng =

Läs mer

Användandet av olika jämförelsemetoder för att upptäcka proteiner som har liknande tredimensionell struktur

Användandet av olika jämförelsemetoder för att upptäcka proteiner som har liknande tredimensionell struktur Användandet av olika jämförelsemetoder för att upptäcka proteiner som har liknande tredimensionell struktur Exjobbsrapport i Biomedicinsk teknik, 2D1025, Nada, KTH av Magnus Nilsson Sammanfattning Samtidigt

Läs mer

Mikrobiologins tekniksprång Dr. Erik Nygren SP Food and Bioscience

Mikrobiologins tekniksprång Dr. Erik Nygren SP Food and Bioscience Mikrobiologins tekniksprång Dr. Erik Nygren SP Food and Bioscience Mikrobiologins tekniksprång Den högteknologiska mikrobiologin erbjuder idag nya verktyg för att förebygga smittspridning och öka produktsäkerhet.

Läs mer

KOMMENTARER TILL KAPITEL 7 OCH 8. Den centrala dogmen är gemensam för eukaryoter och prokaryoter.

KOMMENTARER TILL KAPITEL 7 OCH 8. Den centrala dogmen är gemensam för eukaryoter och prokaryoter. 1 KOMMENTARER TILL KAPITEL 7 OCH 8 Den centrala dogmen är gemensam för eukaryoter och prokaryoter. DNA transkriberas till RNA som i sin tur translateras till proteiner. Genetiska skillnader mellan prokaryoter

Läs mer

DUGGA Molekylärbiologi T2 / VT p (G = 25 p)

DUGGA Molekylärbiologi T2 / VT p (G = 25 p) KORTSVARSFRÅGOR 1. Restriktionsenzymet BamHI klyver sekvensen 5 -G*GATCC-3 och lämnar 4 basers 5' överhäng. Rita upp det längsta DNA-fragmentet som bildas efter klyvning av nedanstående given sekvens med

Läs mer

Alternativ splicing: en process som medför att flera olika mrna-transkript bildas från individuella gener

Alternativ splicing: en process som medför att flera olika mrna-transkript bildas från individuella gener Institutionen för fysik, kemi och biologi Examensarbete Alternativ splicing: en process som medför att flera olika mrna-transkript bildas från individuella gener Isabella Savas Examensarbetet utfört vid

Läs mer


TENTAMEN I STRUKTURBIOLOGI Molekylär Cellbiologi TENTAMEN I STRUKTURBIOLOGI MÅNDAGEN DEN 26 MARS 2001 EFTERNAMN:... FÖRNAMN:... PERSONNUMMER:... POÄNGSUMMA: RESULTAT: Skriv namn och personnummer på ev. lösa blad. Tentamen innehåller

Läs mer



Läs mer

Nomenklatur för vanliga SNP-analyser Gör vi rätt?

Nomenklatur för vanliga SNP-analyser Gör vi rätt? Nomenklatur för vanliga SNP-analyser Gör vi rätt? Camilla Valtonen-André Tisdagen den 10 nov 2015 Nomenklatur för vanliga SNP-analyser Nomenklatur vad är det? Vad är rätt nomenklatur? Guidelines Varför

Läs mer

Föreläsning 5. Stereokemi Kapitel 6

Föreläsning 5. Stereokemi Kapitel 6 Föreläsning 5 Stereokemi Kapitel 6 1) Introduktion 2) Definition av begrepp 3) Stereokemi i verkligheten 4) Nomenklatur 5) Flera stereocenter 6) Ringsystem 7) Kirala molekyler utan stereocentra 1. Introduktion

Läs mer

Svar till övningstentafrågor i Biokemi, Basåret VT 2012

Svar till övningstentafrågor i Biokemi, Basåret VT 2012 Svar till övningstentafrågor i Biokemi, Basåret VT 2012 1. - gen = en bassekvens i DNA, som innehåller information om aminosyrasekvensen för en polypeptidkedja, Se sidan 195 (161) i boken. - genom = allt

Läs mer

Personnummer. DUGGA Molekylärbiologi T3 / HT p (G = 28 p)

Personnummer. DUGGA Molekylärbiologi T3 / HT p (G = 28 p) KORTSVARSFRÅGOR 1. Restriktionsenzymet KpnI klyver sekvensen 5 -GGTACC-3 och lämnar ett fyra basers 3 -överhäng. Enzymet BamHI klyver sekvensen 5 -GGATCC-3 och lämnar ett fyra basers 5 överhäng. Ange det

Läs mer

Proteinkvalitet i fodersäd. Bengt Lundegårdh Global Organic Sweden AB

Proteinkvalitet i fodersäd. Bengt Lundegårdh Global Organic Sweden AB Proteinkvalitet i fodersäd Bengt Lundegårdh Global Organic Sweden AB Essentiella aminosyror Vilka är mest begränsande i foder från spannmål % av totalt mängd protein Aminosyra Gris Värphöns Vete Korn Råg

Läs mer

Evolution, del 2: Evolutionsprocesser och förändringar i det genetiska materialet. Jessica Abbott Forskare Evolutionär Ekologi

Evolution, del 2: Evolutionsprocesser och förändringar i det genetiska materialet. Jessica Abbott Forskare Evolutionär Ekologi Evolution, del 2: Evolutionsprocesser och förändringar i det genetiska materialet Jessica Abbott Forskare Evolutionär Ekologi Naturlig selektion Alleler som ger bättre överlevnad och/eller reproduktionsförmåga

Läs mer

DNA-molekylen. 1869 upptäcktes DNA - varken protein, kolhydrat eller lipid.

DNA-molekylen. 1869 upptäcktes DNA - varken protein, kolhydrat eller lipid. Genetik Ärftlighetslära - hur går det till när egenskaper går i arv? Molekylär genetik - information i DNA och RNA Klassisk genetik - hur olika egenskaper ärvs Bioteknik - Hur DNA flyttas mellan olika

Läs mer

Exam Molecular Bioinformatics X3 (1MB330) - 1 March, Page 1 of 6. Skriv svar på varje uppgift på separata blad. Lycka till!!

Exam Molecular Bioinformatics X3 (1MB330) - 1 March, Page 1 of 6. Skriv svar på varje uppgift på separata blad. Lycka till!! Exam Molecular Bioinformatics X (MB) - March, - Page of Skriv svar på varje uppgift på separata blad. Lycka till!! Write the answers to each of the questions on separate sheets of paper. ood luck!! ) Sequence

Läs mer

Tentamen i Molekylär Cellbiologi 9 p Namn: Personnummer: Plats nr: Inlämnad kl: ID kollad: Poäng: Betyg:

Tentamen i Molekylär Cellbiologi 9 p Namn: Personnummer: Plats nr: Inlämnad kl: ID kollad: Poäng: Betyg: STOCKHOLMS UNIVERSITET Institutionen för biologisk grundutbildning Tentamen i Molekylär Cellbiologi 9 p. 2003-11-12 Namn: Personnummer: Plats nr: Inlämnad kl: ID kollad: Poäng: Betyg: Skrivtiden är fem

Läs mer

Omtentamen Läkarutbildningen T1:B vårterminen 2006 Kodnr:

Omtentamen Läkarutbildningen T1:B vårterminen 2006 Kodnr: Magnus Karlsson, 40 år, har den senaste tiden lidit av huvudvärk från och till. Under ett besök hos distriktsläkaren klagar han även över trötthet och det kommer också fram att det är något konstigt med

Läs mer


FINLANDS FÖRFATTNINGSSAMLING FINLANDS FÖRFATTNINGSSAMLING Utgiven i Helsingfors den 24 februari 2014 141/2014 Jord- och skogsbruksministeriets förordning om ändring av handels- och industriministeriets förordning om modersmjölksersättning

Läs mer

Felveckning och denaturering av proteiner. Niklas Dahrén

Felveckning och denaturering av proteiner. Niklas Dahrén Felveckning och denaturering av proteiner Niklas Dahrén Felveckning av proteiner Strukturen är helt avgörande för proteinets funktion ü E# protein är helt beroende av sin struktur för a& kunna fullgöra

Läs mer

Tentamen Molekylärbiologi T3 / HT07 2007-10-25 VG = 66-83p G = 45-65p U = 0-44p. 1. Vad menas med att ett DNA-fragment har blunt ends?

Tentamen Molekylärbiologi T3 / HT07 2007-10-25 VG = 66-83p G = 45-65p U = 0-44p. 1. Vad menas med att ett DNA-fragment har blunt ends? KORTSVARSFRÅGOR 1. Vad menas med att ett DNA-fragment har blunt ends? (1p) Inget enkelsträngat DNA finns på DNA ändarna. 2. Vilken enzymatisk aktivitet har klenowenzymet och vad kan det användas till?

Läs mer


CELLKÄRNAN INNEHÅLL CELLKÄRNAN. cellkärnan CELLKÄRNAN Kap 8 i 3rd edtion, kap 9 + fig 16.24, s. 673-675, fig 16.27 i 4th edition Chromatin: S. 150-151, 257-258 3rd edition, s166-170, 281-283 4th edition. INNEHÅLL cellkärnan membran, nuclear lamina

Läs mer

Eukaryot proteinexpression

Eukaryot proteinexpression Föreläsningens innehåll Eukaryot proteinexpression 9:e november 2009 Patrik Samuelson översikt eukaryota värdar och expressionsvektorer (='budbärare') Saccharomyces cerevisiae Pichia pastoris Baculovirus/insektsceller

Läs mer

Provet kommer att räknas igenom under vt16 på torsdag eftermiddagar ca Meddelande om sal och exakt tid anslås på min kontorsdörr (rum419).

Provet kommer att räknas igenom under vt16 på torsdag eftermiddagar ca Meddelande om sal och exakt tid anslås på min kontorsdörr (rum419). Ke2. Komvux, Lund. Prov 2. Övning. Provet kommer att räknas igenom under vt16 på torsdag eftermiddagar ca 1330-1500. Meddelande om sal och exakt tid anslås på min kontorsdörr (rum419). Övningsprovet innehåller

Läs mer

5. Transkriptionell reglering OBS! Långsam omställning!

5. Transkriptionell reglering OBS! Långsam omställning! Reglering: 1. Allosterisk reglering Ex. feedbackinhibering en produkt i en reaktionssekvens inhiberar ett tidigare steg i samma sekvens 2. Olika isoformer i olika organ 3. Kovalent modifiering Ex. fosforylering

Läs mer

Övningstentafrågor i Biokemi, Basåret VT 2012

Övningstentafrågor i Biokemi, Basåret VT 2012 Övningstentafrågor i Biokemi, Basåret VT 2012 1. Förklara kortfattat följande ord/begrepp. (4p) - gen - genom - proteom - mutation - kofaktor - prostetisk grupp - ATP - replikation Celler: 2. Rita en eukaryot

Läs mer

HUGO-projektet. Kartläggningen av det mänskliga genomet

HUGO-projektet. Kartläggningen av det mänskliga genomet Vem är HUGO? HUGO-projektet Kartläggningen av det mänskliga genomet Kartläggning av genom Genom= allt DNA hos en organism. Kartläggningen sker genom att man bestämmer DNA-sekvensen för hela genomet och

Läs mer

Tentamen i tema Reproduktion/Utveckling Läkarprogrammet, T2, 2015-02-27, kl 8.15-12.15. Instruktioner

Tentamen i tema Reproduktion/Utveckling Läkarprogrammet, T2, 2015-02-27, kl 8.15-12.15. Instruktioner Tentamen i tema Reproduktion/Utveckling Läkarprogrammet, T2, 2015-02-27, kl 8.15-12.15 Instruktioner 1) Skriv din kod längst upp till höger på SAMTLIGA papper i detta häfte samt på eventuella extrablad

Läs mer

Organisk kemi / Biokemi. Livets kemi

Organisk kemi / Biokemi. Livets kemi Organisk kemi / Biokemi Livets kemi Vecka Lektion 1 Lektion 2 Veckans lab Läxa 41 Kolhydrater Kolhydrater Sockerarter Fotosyntesen Bio-kemi 8C och D vecka 41-48 42 Kolhydrater Fetter Trommers prov s186-191

Läs mer

Maria Nyström Jessica Leander Louise Danielsson. G-proteinet Ras. 3 juni 2003. Handledare: Hans Eklund

Maria Nyström Jessica Leander Louise Danielsson. G-proteinet Ras. 3 juni 2003. Handledare: Hans Eklund Maria Nyström Jessica Leander Louise Danielsson G-proteinet Ras 3 juni 2003 Handledare: Hans Eklund Inledning Detta projektarbete behandlar en del av den signalväg som initieras av tillväxthormon och avslutas

Läs mer

APOPTOS Programmerad celldöd

APOPTOS Programmerad celldöd APOPTOS Programmerad celldöd Håkan Billig 2014 hakan.billig@fysiologi.gu.se 1 APOPTOS 1. Exempel på celldöd under normalt liv Grodyngel Fosterutveckling Anpassa cellantal Nerv-målcells interaktion hormon-målcells

Läs mer

Chapter 5-7. Introduction. Content. Double helix, Watson and Crick + Maria Bolin + fig 5-2

Chapter 5-7. Introduction. Content. Double helix, Watson and Crick + Maria Bolin + fig 5-2 Chapter 5-7 Introduction Double helix, Watson and Crick + Maria Bolin + fig 5-2 On Feb. 28, 1953, Francis Crick walked into the Eagle pub in Cambridge, England, and, as James Watson later recalled, announced

Läs mer

Kursbok: The immune system Peter Parham

Kursbok: The immune system Peter Parham T cells aktivering. Kursbok: The immune system Peter Parham Kapitel 6 Primary Immune response: First encounter of naive T cells with antigen on APC. This happens in the secondary lymphoid tissues. Priming

Läs mer

Hållbara foder och välfärd för fisk och människa

Hållbara foder och välfärd för fisk och människa Hållbara foder och välfärd för fisk och människa Kristina Snuttan Sundell och Eva Brännäs Zoologisk institutionen och Vattenbrukscentrum Väst Göteborgs Universitet Institutionen för vilt, fisk och miljö

Läs mer

Genexpressions analys - RNA-uttryck

Genexpressions analys - RNA-uttryck Genexpressions analys - RNA-uttryck Alla gener som är aktiva transkriberas: det bildas ett RNA (transkript). Proteinkodande gener transkriberas till mrna, ribosomalrna gener till rrna osv. Man pratar ofta

Läs mer


BASÅRET KEMI B BIOKEMI VT 2012. PROTEINER OCH ENZYMER 174-190 (sid. 140-156) BASÅRET KEMI B BIOKEMI PROTEINER OCH ENZYMER 174-190 (sid. 140-156) Hur lätt blir det fel i strukturen? ganska stora skillnader i sekvens - ganska lika strukturer proteinerna är bara identiska i 27 av

Läs mer

Omtentamen i tema Reproduktion/Utveckling Läkarprogrammet, T2, , kl Instruktioner

Omtentamen i tema Reproduktion/Utveckling Läkarprogrammet, T2, , kl Instruktioner Omtentamen i tema Reproduktion/Utveckling Läkarprogrammet, T2, 2013-04-27, kl 8.15-12.15 Instruktioner 1) Skriv din kod längst upp till höger på SAMTLIGA papper i detta häfte samt på eventuella extrablad

Läs mer

Ladokkod: Tentamen ges för: Gsjuk15v. Namn: (Ifylles av student) Personnummer: (Ifylles av student) Tentamensdatum: 15-04 -29 Tid:

Ladokkod: Tentamen ges för: Gsjuk15v. Namn: (Ifylles av student) Personnummer: (Ifylles av student) Tentamensdatum: 15-04 -29 Tid: Humanbiologi Provmoment: Ladokkod: Tentamen ges för: Tenta A Gsjuk15v 15 högskolepoäng Namn: (Ifylles av student) Personnummer: (Ifylles av student) Tentamensdatum: 15-04 -29 Tid: Hjälpmedel: Inga hjälpmedel

Läs mer

Ägg till embryo Dugga Platsnummer VIKTIGT ATT DU FYLLER I OCH LÄMNAR IN! TEXTA TACK. Efternamn. Förnamn. Personnummer

Ägg till embryo Dugga Platsnummer VIKTIGT ATT DU FYLLER I OCH LÄMNAR IN! TEXTA TACK. Efternamn. Förnamn. Personnummer IDENTITETSBLAD VIKTIGT ATT DU FYLLER I OCH LÄMNAR IN! TEXTA TACK Efternamn Förnamn Personnummer Gruppnummer (Grupp 1-40 på kursen) Enligt KI:s utbildningsstyrelses beslut skall skrivningar rättas anonymt.

Läs mer

Cell och molekylärbiologi (BL3008) 2015-08-28 Omtentamen CMB-II (11 hp) Kod: Personnummer: Plats nr: Inlämnad kl: ID kollad: Poäng: Betyg:

Cell och molekylärbiologi (BL3008) 2015-08-28 Omtentamen CMB-II (11 hp) Kod: Personnummer: Plats nr: Inlämnad kl: ID kollad: Poäng: Betyg: STOCKHOLMS UNIVERSITET Institutionen för biologisk grundutbildning Cell och molekylärbiologi (BL3008) 2015-08-28 Omtentamen CMB-II (11 hp) Kod: Personnummer: Plats nr: Inlämnad kl: ID kollad: Poäng: Betyg:

Läs mer

Tentamen Molekylärbiologi X3 (1MB608) 10 March, 2008 Page 1 of 5. Skriv svaren på varje fråga på SEPARATA blad.

Tentamen Molekylärbiologi X3 (1MB608) 10 March, 2008 Page 1 of 5. Skriv svaren på varje fråga på SEPARATA blad. Tentamen Molekylärbiologi X3 (1MB608) 10 March, 2008 Page 1 of 5 Skriv svaren på varje fråga på SEPARATA blad. Skriv namn på VARJE blad. Du kan svara på engelska eller svenska. Motivera eller förklara

Läs mer

Cellbiologi. Maria Ankarcrona Nov 2010

Cellbiologi. Maria Ankarcrona Nov 2010 Cellbiologi Maria Ankarcrona Nov 2010 1 Instuderingsfrågor (från den 15/11) 1. Beskriv uppbyggnaden av den eukaryota cellens cellmembran. 2. Vilken funktion fyller cellmembranet? 3. Ge exempel på fördelar

Läs mer

Elektron-absorbtionspektroskopi för biomolekyler i UV-VIS-området

Elektron-absorbtionspektroskopi för biomolekyler i UV-VIS-området Elektron-absorbtionspektroskopi för biomolekyler i UV-VIS-området Principer Koncentrationsmätning Detektion Kromoforer, kolorimetriska assays DNA Komparativ analys Proteinrening Jonbindning Peptidgruppens

Läs mer

Svar: 3. a) Vid enzymkatalys binder enzymet in substratet/substraten till aktiva ytan. Närhet och orientering är förutsättning för katalys.

Svar: 3. a) Vid enzymkatalys binder enzymet in substratet/substraten till aktiva ytan. Närhet och orientering är förutsättning för katalys. 3. a) En enzymkatalyserad reaktion påverkas bland annat av mängden substrat. Ju högre halt av substrat, desto snabbare går reaktionen till jämvikt. Men vid tillräckligt höga halter av substrat så sker

Läs mer

Human Molekylärgenetik. Del 1 Inledning till human genetik

Human Molekylärgenetik. Del 1 Inledning till human genetik Human Molekylärgenetik Del 1 Inledning till human genetik del 1 definition varför studera molekylärgenetik? fenotyper genetisk variation monogena vs. komplexa anlag, exemplifiering genotyper vilka typer

Läs mer

Ägg till embryo Dugga 130318 Platsnummer VIKTIGT ATT DU FYLLER I OCH LÄMNAR IN! TEXTA TACK. Efternamn. Förnamn. Personnummer

Ägg till embryo Dugga 130318 Platsnummer VIKTIGT ATT DU FYLLER I OCH LÄMNAR IN! TEXTA TACK. Efternamn. Förnamn. Personnummer IDENTITETSBLAD VIKTIGT ATT DU FYLLER I OCH LÄMNAR IN! TEXTA TACK Efternamn Förnamn Personnummer Gruppnummer (Grupp 1-40 på kursen) Enligt KI:s utbildningsstyrelses beslut skall skrivningar rättas anonymt.

Läs mer

Uppsala Universitet. Statistiska Institutionen. En statistisk undersökning av transkriptionsnoggrannheten i kodande DNA-sekvenser i E.

Uppsala Universitet. Statistiska Institutionen. En statistisk undersökning av transkriptionsnoggrannheten i kodande DNA-sekvenser i E. Uppsala Universitet Statistiska Institutionen En statistisk undersökning av transkriptionsnoggrannheten i kodande DNA-sekvenser i E.coli-bakterien Författare: Johan Vegelius och Sofie Froby Juni 2015 Handledare:

Läs mer